TY - JOUR T1 - Recombinant DNA resources for the comparative genomics of <em>Ancylostoma ceylanicum</em> JF - bioRxiv DO - 10.1101/092494 SP - 092494 AU - Wadim J. Kapulkin AU - Adriana Magalska AU - Ewa Janecka AU - Arkadiusz Ciesielski AU - Malgorzata Lobocka AU - Jerzy M. Behnke AU - Halina Wedrychowicz Y1 - 2016/01/01 UR - http://biorxiv.org/content/early/2016/12/17/092494.abstract N2 - We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematode C. elegans and A. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma ceylanicum data and resources generated by the recombinant DNA approach. ER -