New Results

Context-dependent Requirements for FimH and Other Canonical Virulence Factors in Gut Colonization by Extraintestinal Pathogenic Escherichia coli

Colin W. Russell, Brittany A. Fleming, Alan T. Stenquist, Morgan A. Wambaugh, Mary P. Bronner, Matthew A. Mulvey
doi: https://doi.org/10.1101/166108

ABSTRACT

Extraintestinal pathogenic Escherichia coli (ExPEC) act as commensals within the mammalian gut, but can induce pathology upon dissemination to other host environments such as the urinary tract and bloodstream. It is thought that ExPEC genomes are shaped in large part by evolutionary forces encountered within the gut where the bacteria spend much of their time, provoking the question of how their extraintestinal virulence traits arose. The principle of coincidental evolution, in which a gene that evolved in one niche happens to be advantageous in another, has been used to argue that ExPEC virulence factors originated in response to selective pressures within the gut ecosystem. As a test of this hypothesis, the fitness of ExPEC mutants lacking canonical virulence factors was assessed within the intact murine gut in the absence of any antibiotic treatment. We found that most of the tested factors—including CNF1, Usp, colibactin, flagella, and the plasmid pUTI89—were dispensable for gut colonization. Deletion of genes encoding the adhesin PapG or the toxin HlyA caused transient defects, but did not affect longer-term persistence. In contrast, a mutant missing the type 1 pilus-associated adhesin FimH displayed reduced persistence within the gut. However, this phenotype was variable, being dependent on the presence of specific competing strains and partially attributable to aberrant flagellin expression by the fimH mutant. These data indicate that FimH and other key ExPEC-associated factors are not strictly required for gut colonization, suggesting that selective pressures within the gut do not drive the development of all extraintestinal virulence traits.

INTRODUCTION

The bacterium Escherichia coli was first described by Theodor Escherich in 1884, and has since become a critical model organism that has been used to understand the fundamentals of molecular biology (1). E. coli is able to live in a variety of locations, including the soil, water, and the human gut. Although it is a prominent member of the neonatal microbiota, it is quickly overshadowed by burgeoning anaerobic bacteria as oxygen becomes scarce within the gut following birth (2, 3). In adults, E. coli is present at about 107 to 109 Colony Forming Units (CFU)/g feces, a level that is 100–10,000-fold-lower than the resident anaerobes (4). Despite being a minor component of the microbiota, the estimated number of E. coli cells that are transmitted via fecal matter from each human being to the environment in a single day is staggering – about 1011 CFU (5).

Understanding the role of E. coli within the microbiota is complicated by the fact that E. coli is a very diverse species with a wide spectrum of phenotypes (1). Some E. coli strains live harmlessly in the gut, while others act as pathogens, causing diarrhea and hemorrhaging (6). Others have been linked with the development of Crohn’s Disease and colorectal cancer (7–9). One strain, Nissle 1917, acts as a probiotic that assuages inflammation in addition to inhibiting colonization by pathogens such as Salmonella (10, 11). A group of strains known as Extraintestinal Pathogenic Escherichia coli (ExPEC) generally act as commensals within the gut, but can disseminate to other host environments and subsequently cause disease (12). ExPEC include uropathogenic E. coli (UPEC), which cause the overwhelming majority of urinary tract infections (UTIs) (13). These infections are especially prevalent among women, about half of whom will have at least one UTI during their lifetime. ExPEC is also responsible for other, more serious conditions, including sepsis and neonatal meningitis (12, 14).

The gut is thought to be the major ExPEC reservoir that seeds extraintestinal infections. Evidence for this notion is that the same ExPEC strain can often be isolated from both the feces and urine of individual patients suffering from UTIs (15–18). Indeed, ExPEC strains are frequently difficult to clear from the gut with antibiotic treatments, even when the pathogens are effectively eliminated from the urinary tract (19). Furthermore, E. coli strains belonging to phylogenetic group B2, which includes many ExPEC isolates, are much more likely to be long-term residents within the gut in comparison with other E. coli populations (20–22). The majority of adults carry group B2 E. coli strains within the gut, irrespective of extraintestinal infections (22). Cumulatively these observations suggest that ExPEC primarily inhabit the gut, with sporadic departures to extraintestinal sites.

Given that ExPEC reside mostly within the gut, and that transmission of ExPEC among individuals likely occurs chiefly through fecal-oral routes (4, 23–25), it is expected that ExPEC genomes have been shaped in large part by the evolutionary pressures present within the gut. How then, did extraintestinal virulence factors come into being? The hypothesis of coincidental evolution has often been evoked to answer this question (26). In general terms, coincidental evolution is when a factor evolves in one context, but happens to be useful in another context as well (27). When the hypothesis of coincidental evolution is applied to the ExPEC life cycle, the implication is that factors that promote virulence in extraintestinal niches evolved in the gut for a function possibly unrelated to virulence.

Little concrete evidence has been put forth to support or contradict coincidental evolution in the context of ExPEC infection, other than the fact that known extraintestinal virulence factors are often encoded by gut isolates (21, 26, 28). One prediction of this hypothesis is that extraintestinal virulence factors should play a role in gut colonization. To date, this possibility has only been addressed by one study in which an ExPEC mutant that lacks multiple pathogenicity-associated islands (PAIs) was found to be defective in its ability to persist within the murine intestinal tract (5). It is clear that more experimental work needs to be done to determine to what extent coincidental evolution applies to single virulence factors within ExPEC. To address this issue, several canonical virulence factors were individually deleted from a reference ExPEC isolate and the resulting mutants were tested for their ability to colonize and persist within the mouse gastrointestinal tract. Among eight virulence factors that were examined, only the type 1 pilus-associated mannose-binding adhesin FimH had a notable persistence defect within the gut. However, this defect was variable and partly contingent upon aberrant flagellin expression by the fimH mutant and the presence of specific competing strains. These findings are discussed in the context of both coincidental evolution and the development of anti-ExPEC therapeutics.

RESULTS

ExPEC stably colonizes the murine intestinal tract in the presence of the natural, intact microbiota

To examine ExPEC colonization of the intestinal tract, we employed a model in which adult specific pathogen free (SPF) Balb/c mice were intragastrically gavaged with ~109 CFUs of the reference cystitis isolate F11. At various time points post-gavage, feces were collected, and the numbers of viable ExPE C present were enumerated. F11 and other bacterial strains used in this study were engineered to express either chloramphenicol (ClmR) or kanamycin (KanR) resistance cassettes so that they could be easily identified by plating fecal homogenates on selective media. Following inoculation, the fecal titers of F11 remained fairly stable for up to 75 days, with median values ranging between 106 and 107 CFU/g feces after the first day (Fig. 1A). These data demonstrate that ExPEC can efficiently initiate and maintain colonization of the SPF mouse gut, in line with recent reports from our group and others (24, 29–31). Consistent with the observation that nonpathogenic E. coli mostly reside within the large bowel (32), the cecum and colon carried the largest load of F11 at the 2-week time point, although considerable numbers of F11 were also present within the small intestine (Fig. 1B).

Figure 1.
Figure 1. ExPEC colonizes and persists within the gut of SPF mice without causing serious pathology

Adult female SPF Balb/c mice were inoculated via oral gavage with ~109 CFU of bacteria. (A) Titers of F11 recovered from the feces of mice at various time points post-gavage. n=5 mice. (B) F11 titers within intestinal tissues at 14 d post-gavage. (C) Mice were gavaged with a 1:1 mixture of F11 and MG1655, and fecal titers were determined for both populations at the indicated time points. *, p ≤ 0.05 by Wilcoxon signed-rank tests with corrections for multiple comparisons. (D) Fecal titers from non-competitive assays in which mice were orally inoculated with F11, F11ΔhlyA, or MG1655. ****, p ≤ 0.0001 by Mann-Whitney U Tests with corrections for multiple comparisons. #, p ≤ 0.05 by Mann-Whitney U Tests without corrections. In A-D, bars indicate median values. (E) Relative weights (mean values ± SD) of mice following oral inoculation with F11, F11ΔhlyA, or MG1655. Data were normalized to the mass of each mouse prior to gavage. ***, p ≤ 0.001 with corrections when F11 is compared to either F11ΔhlyA or MG1655 by unpaired Student’s t tests. In B-E, n=10 mice from two independent experiments. Adult female SPF Balb/c mice were inoculated via oral gavage with ~109 CFU of bacteria. (A) Titers of F11 recovered from the feces of mice at various time points post-gavage. n=5 mice. (B) F11 titers within intestinal tissues at 14 d post-gavage. (C) Mice were gavaged with a 1:1 mixture of F11 and MG1655, and fecal titers were determined for both populations at the indicated time points. *, p ≤ 0.05 by Wilcoxon signed-rank tests with corrections for multiple comparisons. (D) Fecal titers from non-competitive assays in which mice were orally inoculated with F11, F11ΔhlyA, or MG1655. ****, p ≤ 0.0001 by Mann-Whitney U Tests with corrections for multiple comparisons. #, p ≤ 0.05 by Mann-Whitney U Tests without corrections. In A-D, bars indicate median values. (E) Relative weights (mean values ± SD) of mice following oral inoculation with F11, F11ΔhlyA, or MG1655. Data were normalized to the mass of each mouse prior to gavage. ***, p ≤ 0.001 with corrections when F11 is compared to either F11ΔhlyA or MG1655 by unpaired Student’s t tests. In B-E, n=10 mice from two independent experiments. Adult female SPF Balb/c mice were inoculated via oral gavage with ~109 CFU of bacteria. (A) Titers of F11 recovered from the feces of mice at various time points post-gavage. n=5 mice. (B) F11 titers within intestinal tissues at 14 d post-gavage. (C) Mice were gavaged with a 1:1 mixture of F11 and MG1655, and fecal titers were determined for both populations at the indicated time points. *, p ≤ 0.05 by Wilcoxon signed-rank tests with corrections for multiple comparisons. (D) Fecal titers from non-competitive assays in which mice were orally inoculated with F11, F11ΔhlyA, or MG1655. ****, p ≤ 0.0001 by Mann-Whitney U Tests with corrections for multiple comparisons. #, p ≤ 0.05 by Mann-Whitney U Tests without corrections. In A-D, bars indicate median values. (E) Relative weights (mean values ± SD) of mice following oral inoculation with F11, F11ΔhlyA, or MG1655. Data were normalized to the mass of each mouse prior to gavage. ***, p ≤ 0.001 with corrections when F11 is compared to either F11ΔhlyA or MG1655 by unpaired Student’s t tests. In B-E, n=10 mice from two independent experiments. Adult female SPF Balb/c mice were inoculated via oral gavage with ~109 CFU of bacteria. (A) Titers of F11 recovered from the feces of mice at various time points post-gavage. n=5 mice. (B) F11 titers within intestinal tissues at 14 d post-gavage. (C) Mice were gavaged with a 1:1 mixture of F11 and MG1655, and fecal titers were determined for both populations at the indicated time points. *, p ≤ 0.05 by Wilcoxon signed-rank tests with corrections for multiple comparisons. (D) Fecal titers from non-competitive assays in which mice were orally inoculated with F11, F11ΔhlyA, or MG1655. ****, p ≤ 0.0001 by Mann-Whitney U Tests with corrections for multiple comparisons. #, p ≤ 0.05 by Mann-Whitney U Tests without corrections. In A-D, bars indicate median values. (E) Relative weights (mean values ± SD) of mice following oral inoculation with F11, F11ΔhlyA, or MG1655. Data were normalized to the mass of each mouse prior to gavage. ***, p ≤ 0.001 with corrections when F11 is compared to either F11ΔhlyA or MG1655 by unpaired Student’s t tests. In B-E, n=10 mice from two independent experiments.

It is of note that the SPF mice utilized in these experiments were not treated with antibiotics and therefore each possesses an intact microbiota. This is in contrast to other commonly used mouse models in which mice are treated with streptomycin and/or other antibiotics in order to disrupt the intestinal microbiota and open up niches that can then be occupied by incoming microbes (32). Since antibiotic treatment was not required for consistent colonization of the gut by F11 (or by other ExPEC isolates (24, 29)), we wondered whether ExPEC is simply more adept at gut colonization than nonpathogenic E. coli strains. As a test of this idea, we first competed F11 head-to-head with MG1655, an often-used nonpathogenic E. coli K12 strain. Following oral gavage with equal numbers of F11 and MG1655, the K12 bacteria were cleared from all of the mice by day 3, while F11 stably persisted (Fig. 1C). When mice were gavaged with MG1655 alone, it was lost at a slower rate, but was still cleared from 80% of the mice by day 14 (Fig. 1D). This is in sharp contrast to the persistent phenotype observed with F11. Similar results were obtained using SPF C57Bl/6 mice (Fig. S1A).

To assess whether ExPEC colonization of the colon is marked by inflammation (colitis), the mice were weighed at several time points after colonization, as weight loss frequently accompanies colitis. Mice that were gavaged with F11 consistently experienced transient weight loss at the one-day time point, in comparison to mice that were inoculated with MG1655 (Fig. 1E). Since the ExPEC-associated pore forming toxin α-hemolysin (HlyA) was previously shown to induce inflammation within the gut in other mouse models (33–35), we hypothesized that HlyA contributes to the transient weight loss seen in F11-colonized animals. When mice were colonized with F11ΔhlyA, fecal titers of the mutant were notably lower at 1 and 3 days post-inoculation, relative to wild type (WT) F11 (Fig. 1D). However, the ΔhlyA mutant persisted much like the WT strain at later time points. These data, coupled with the observation that F11ΔhlyA does not elicit transient weight loss by the host (Fig. 1E), suggest that HlyA both enhances initial colonization of the gut by F11 and stimulates short-term inflammation that causes transient weight loss. By the 14-day time point, the colons of mice that were gavaged with WT F11, F11ΔhlyA, or MG1655 appear unperturbed, having normal crypt architecture and no evidence of infiltrating immune cells, as assessed by histological analysis. Altogether, these data indicate that F11 colonization induces transient inflammation of the intestinal tract with coordinate weight loss by the host. HlyA can facilitate these processes, but is not required for the longer-term persistence of F11 within the gut.

Not all ExPEC-associated toxins promote ExPEC fitness within the gut

In light of the hypothesis of coincidental evolution and observations showing that HlyA can enhance initial colonization of the gut by F11 (Fig. 1D), we wished to examine possible roles for other canonical ExPEC-associated toxins as mediators of intestinal colonization. The first of these was cytotoxic necrotizing factor type 1 (CNF1), a secreted toxin that catalyzes the deamidation of a specific glutamine residue within Rho family GTPases (36). This causes constitutive activation of Rho GTPases, leading to aberrant host cytoskeletal rearrangements and multinucleation (2, 37, 38). CNF1 has been linked with ExPEC strains in epidemiological studies (38), and can enhance host inflammatory responses and ExPEC virulence in mouse models of UTI (39) and prostatitis (40). However, the effects of CNF1 on ExPEC fitness within the host remain unclear, clouded somewhat by conflicting reports (39–42). To test if CNF1 plays a role in the gut, mice were gavaged with 109 CFU of either WT F11 or F11Δcnf1 and intestinal colonization levels were tracked by homogenizing and plating feces at various time points. Median bacterial levels for both the WT and mutant strains ranged between 105 and 106 CFU per gram of feces over the course of two weeks (Fig. 2A). At no point were the WT and F11Δcnf1 titers significantly different, suggesting that CNF1 does not impact the ability of F11 to colonize the mouse gut.

Figure 2.
Figure 2. Key ExPEC-associated factors are not required for gut colonization

Mice were orally gavaged with ~109 CFU of WT F11 or isogenic mutant strains lacking (A) cnf1, (B) usp, (C) clbCDEFG, (D) fliC, or (E) plasmid pUTI89. At the indicated time points, feces were collected, homogenized, and plated on selective media to determine bacterial titers. Bars represent median values. n=9–11 mice from two independent experiments. No statistically significant differences between WT and mutant titers were discerned using Mann-Whitney U tests.

Like HlyA and CNF1, Uropathogenic specific protein (Usp) is often encoded by ExPEC isolates (43, 44). Usp is also associated with E. coli fecal isolates that are capable of long-term persistence within the human infant intestinal tract (45). Interestingly, Usp has genotoxic nuclease activity as well as homology to colicins, a group of toxins that can be used by bacteria to harm competing microbes (46–48). Given that interbacterial competition within the gut is commonplace, we tested whether Usp is important for ExPEC gut colonization. The F11Δusp mutant did not exhibit any notable defects within the gut, indicating that Usp is not required in this niche (Fig. 2B).

Another toxin that has been linked to ExPEC pathogenesis is colibactin, which is produced by a number of factors encoded by the polyketide synthase (pks) genomic island. The pks island is not typically carried by intestinal pathogenic E. coli strains, but is enriched in extraintestinal isolates relative to commensal fecal isolates (49). Colibactin induces DNA damage and cell cycle arrest in host cells (49, 50), and the presence of colibactin-producing bacteria has been linked with the development of colorectal cancer (51). In extraintestinal infections, colibactin-deficient bacterial strains are not as virulent as their WT counterparts. Mutation of the pks island reduces ExPEC translocation from the gut in neonatal rats (52) and reduces lymphopenia in septic mice (53). Whether the pks island also plays a role in bacterial fitness during gut colonization is not clear. Whereas one study observed decreased colonization of the small intestines of neonatal rats by colibactin mutants (52), another found no colonization differences between a pks mutant and WT bacteria (54). To test whether colibactin production is important in our adult mouse model of gut colonization, we orally inoculated mice with either WT F11 or F11ΔclbCDEFG, which lacks a key operon within the pks island (55). There was no difference in the colonization ability of the WT and mutant strains (Fig. 2C), suggesting that colibactin biosynthesis does not contribute to bacterial fitness in this model of gut colonization.

Flagella are not required for ExPEC gut colonization

Flagella are filamentous organelles comprised of polymers of the flagellin protein FliC (56). Though best known for their role in motility, flagella can also promote bacterial attachment and biofilm formation, and can potently stimulate host inflammatory responses (57, 58). Several studies have provided evidence that flagella enhance ExPEC colonization of the mouse urinary tract (59–62). In contrast, flagella are not critical for gut colonization by nonpathogenic E. coli in streptomycin-treated mice (63). To determine if flagella are required for gut colonization by ExPEC in the face of an intact microbiota, we inoculated adult Balb/c mice with WT F11 or an isogenic mutant lacking fliC. In these assays, no clear differences between the WT strain and F11ΔfliC were observed (Fig. 2D), suggesting that flagella do not promote ExPEC fitness in the gut.

The pUTI89 plasmid is not important for gut colonization

Many ExPEC isolates, including F11, carry plasmids that are identical or closely related to the pUTI89 plasmid that was first identified in the cystitis isolate UTI89 (64, 65). This plasmid, which is roughly 114 kb in length, encodes conjugation machinery, several virulence factors, and numerous hypothetical genes. Loss of pUTI89 impairs the fitness and intracellular growth of UTI89 during the early stages of a UTI in adult mice (66). Likewise, deletion of a closely related plasmid from the neonatal meningitis E. coli isolate RS218 attenuates bacterial virulence during systemic infections in rat pups (65). In addition, a number of pUTI89-associated genes have been linked with ExPEC mucus and glucose metabolism in vitro (30). To determine if pUTI89 facilitates gut colonization by F11, an F11 derivative that was cured of the plasmid was tested in our mouse model. The cured strain exhibited no defect when compared to the WT control strain (Fig. 2E), suggesting that pUTI89 is dispensable for ExPEC fitness within the gut.

Disruption of fimH reduces gut colonization fitness, whereas the lack of papG has no effect

ExPEC strains encode many types of hair-like adhesive organelles known as pili, or fimbriae. Two of the most often-studied ExPEC-associated adhesins are P and type 1 pili (T1P) (67). P pili terminate with the PapG adhesin, which binds host globoseries glycosphingolipids and can facilitate bacterial infection of the kidneys. T1P are capped by the mannose-binding adhesin FimH, which promotes biofilm formation as well as bacterial attachment to and invasion of bladder epithelial cells. In our non-competitive gut colonization assays in which the WT and mutant bacterial strains are kept separate, the deletion of either papG or fimH did not significantly impair the ability of F11 to colonize the intestinal tract (Fig. 3A and B). However, in these assays we noted that the ΔfimH mutant was cleared in 3 out of 10 mice–more than observed with any of the other tested mutants, though not statistically significant (Fig. 3B). These results prompted us to examine the fimH mutant further using competitive assays in which the WT and mutant strains are inoculated as a 1:1 mixture into mice via oral gavage. In these and other competitive assays, total ExPEC levels remain fairly steady over time at around 106 CFU/g feces, even when ratios of the individual competing ExPEC strains are variable.

Figure 3.
Figure 3. The persistence of F11 ΔfimH, but not F11 ΔpapG, within the gut is impaired in competitive assays

Mice were gavaged with WT F11, (A) F11ΔpapG, or (B) F11ΔfimH and fecal titers were determined at the indicated time points. In these non-competitive assays, no significant differences were identified by Mann-Whitney U tests. For competitive assays, mice were gavaged with a 1:1 mixture of (C) F11-KanR and F11-ClmR, (D) WT F11 and F11ΔpapG, (E) or WT F11 and F11ΔfimH. *, p ≤ 0.05 by one sample t tests without correction for multiple comparisons. Pie charts in (E) indicate fraction of mice in which F11ΔfimH (green) was not detected. #, p ≤ 0.05 by Fisher’s exact tests without corrections. In A-E, n = 11–13 mice from two independent assays. (F) Graph shows fractions of the fim switch in the ON and OFF positions from fecal samples recovered from mice following oral inoculation with F11. Bars indicate mean values ± SEM; n=5–10 mice. Results from F11 grown in static or shaking LB broth are shown for comparison.

As a control, we first competed KanR-and ClmR-tagged F11 strains against one another to assess if the resistance cassettes alone compromised bacterial fitness within the intestinal tract. In these control assays, F11-KanR exhibited a modest defect, amounting to about a 3-fold decrease relative to F11-ClmR on day 14, with a median competitive index (CI; see Methods) of −0.49 (Fig. 3C). Likewise, no striking differences between F11-ClmR and F11ΔpapG (KanR) were observed in competitive assays, with the exception of a transient 6.8-fold decrease (median CI of −0.83) in prevalence of the papG mutant on day 5 (Fig. 3D). In contrast, when F11ΔfimH (KanR) was competed against F11-ClmR, the ΔfimH mutant became progressively worse than the control strain starting at day 7 post-inoculation (Fig. 3E). By day 10, there was about a 360-fold reduction in the relative levels of F11ΔfimH recovered in the feces, reflecting a median CI of −2.55. In addition, the ΔfimH mutant began to be cleared as early as day 3, and was not detected in the feces of nearly half of the mice by day 10 (green, Fig. 3E). In comparison, F11ΔpapG dropped below levels of detection in only one mouse during the 14-d time course of these competitive assays (red, Fig. 3D). Of note, the differences between strains indicated in Figs. 3C-E are not statistically significant when p values are corrected for multiple comparisons. However, the amplitude (effect size) of the phenotypes observed with the ΔfimH mutant suggests that disruption of this gene can markedly impair ExPEC persistence within the gut in competitive assays.

T1P expression by F11 is modest following excretion from the gut

T1P are phase variable, being turned ON or OFF through recombinase-mediated flipping of an invertible promoter element within the fim gene cluster (67). The orientation of this fim switch can be monitored and quantified by PCR as a means to assess levels of T1P expression (68, 69). Within the feces of mice that are colonized by F11, we found that the fim switch is in the ON position in about 25 to 35% of the excreted bacteria recovered on days 5, 9, and 14 post-inoculation (Fig. 3F). This is on par with results from shaking broth cultures, in which the fim switch is skewed towards the OFF position. These data indicate that T1P expression by feces-associated ExPEC is limited, which may enable the pathogen to better disseminate either within the intestinal tract or after being discharged from the host.

Increased flagellin expression partially explains the colonization defect observed with F11ΔfimHΔ

T1P, and FimH in particular, may enhance ExPEC persistence within the gut via multiple mechanisms, such as aiding the formation of protective biofilm-like communities or facilitating bacterial attachment to intestinal tissues (58, 70, 71). However, it is conceivable that disruption of fimH could also reduce ExPEC fitness within the gut via effects on other bacterial or host processes. Specifically, previous work showed that deletion of the entire fim operon in the ExPEC isolate UTI89 causes the upregulation of FliC with a coordinate increase in swimming motility (72). This could be problematic for fim mutants since it is known that aberrant overexpression of FliC can impair ExPEC colonization of the gut (5), possibly as a consequence of FliC-mediated stimulation of host inflammatory responses (57). Furthermore, within the intestinal tracts of germ-free or streptomycin-treated mice, mutations that reduce bacterial motility and FliC expression are selected and can promote the persistence of the K12 strain MG1655 (73–75). Together, these observations led us to question if defects in the ability of F11ΔfimH to survive within the gut in competitive assays are associated with altered FliC expression.

In assessing this possibility, we first noted that deletion of fimH does increase the motility of F11 in swim agar plates (Fig. 4A). This phenotype correlates with augmented FliC expression (Fig. 4B), as measured by use of the low-copy reporter construct pfliC-lux in which the luxCDABE gene cluster encoding bacterial luciferase is transcriptionally fused with the conserved fliC promoter (62). These results mirror those reported for a UTI89 mutant lacking the entire fim operon (72). Interestingly, in our assays the deletion of papG in F11 had nearly the opposite effect of the fimH deletion, greatly reducing the motility of F11 and ablating FliC expression (Fig. 4A-B).

Figure 4.
Figure 4. Flagellin expression impacts the efficacy of gut colonization by F11ΔfimH

(A) WT F11 and the indicated mutant derivatives were inoculated into motility agar to assess swimming. Images of swim plates were taken at 8–10 h post-inoculation and are representative of results from three independent assays. (B) Plot shows results from fliC expression reporter assays with WT F11, F11ΔfimH, and F11ΔpapG carrying pfliC-lux. Lines indicate mean luminescence values ± SEM from three independent assays performed in triplicate. p ≤ 0.05 by multiple t tests with (*) or without (#) corrections for multiple comparisons. (C-D) Graphs show results from competitive assays in which mice were orally gavaged with a 1:1 mixture of (C) WT F11 and F11ΔfimHΔfliC (DKO) bacteria or (D) F11ΔfimH and F11ΔfimHΔfliC (DKO). Fecal titers of each strain were determined at the indicated time points by plating on selective media. *, p ≤ 0.05 by one sample t tests with corrections for multiple comparisons. Pie charts in (C-D) denote the fraction of mice in which the DKO mutant (yellow), WT F11 (blue), or F11ΔfimH (green) were not detected. No significant differences were discerned by Fisher’s exact tests. n=13–15 mice from at least two independent assays.

To test if FliC contributes to the defects in gut colonization observed with F11ΔfimH, we generated a double knockout (DKO) mutant lacking both fimH and fliC. This mutant (F11ΔfimHΔfliC) is non-motile in swim plates, similar to the single ΔfliC mutant strain (Fig. 4A). In competitive gut colonization assays with WT F11, the ΔfimHΔfliC mutant exhibited less pronounced deficiencies than F11ΔfimH (Fig. 4C; compare with Fig. 3E). The greatest defect was observed at day 14 post-inoculation, at which point F11ΔfimHΔfliC was not detected in the feces of 5 of the 13 mice. Relative to the WT strain, F11ΔfimHΔfliC titers were reduced by about 21-fold on day 14, corresponding with a median CI of −1.33. This defect was substantially smaller than the maximal ~360-fold reduction seen with the single ΔfimH mutant in competition with WT F11 on day 10 post-inoculation (see Fig. 3E). In addition, clearance of F11ΔfimHΔfliC was not observed until day 7 post-inoculation (Fig 4C), whereas loss of F11ΔfimH was evident starting at day 3 (Fig 3C). In light of the delayed defects seen with F11ΔfimHΔfliC, we extended the assays to day 21. At this point, the median CI value returned close to 0, though F11ΔfimHΔfliC was still undetectable in feces from nearly half of the mice while the WT strain was present in all but one sample (Fig. 4C). Differences between F11ΔfimHΔfliC and the WT strain were not statistically significant, either with or without corrections for multiple comparisons. The less conspicuous defects seen with F11ΔfimHΔfliC in these assays suggest that aberrant FliC expression does contribute to the compromised persistence of F11ΔfimH within the gut.

F11ΔfimH outcompetes F11ΔfimHΔfliC within the gutΔ

To better understand the effects that the loss of fimH and fliC have on bacterial fitness during gut colonization, the ΔfimHΔfliC and ΔfimH mutants were directly competed. We hypothesized that the ΔfimH strain, with heightened FliC expression, would be outcompeted by the ΔfimHΔfliC DKO mutant. However, F11ΔfimHΔfliC exhibited clear and statistically significant defects in comparison with F11ΔfimH (Fig 4D). Fecal titers of the DKO mutant were below levels of detection in one out of 15 mice on day 3 post-inoculation, and by day 14 the DKO mutant was undetectable in the feces of a third of the animals. At this point, F11ΔfimH was about 270-fold more abundant than the DKO mutant, corresponding with a median CI of 2.43. These data, as well results from non-competitive assays (see Fig. 3B), indicate that the importance of FimH to ExPEC survival within the intestinal tract is dependent upon the nature of the competing microbes that are present.

WT F11 and F11ΔfimH can outcompete one other in reciprocal serial colonization assays

To further evaluate FimH requirements within the intestinal tract, we carried out serial colonization assays in which Balb/c mice were first orally gavaged with WT F11 before the introduction of F11ΔfimH 7 d later. Though fecal titers of the ΔfimH mutant were initially high and on par with the WT strain, levels of the mutant dropped precipitously and were below the limits of detection in most mice by day 3 post-inoculation (Fig. 5A). In reciprocal experiments, in which F11ΔfimH was allowed to colonize the mice prior to instillation of the WT strain, F11ΔfimH persisted while WT F11 was cleared from most of the mice by day 10 (Fig. 5B). These data show that FimH is not strictly required for ExPEC to prevent colonization of the gut by a new competing strain, though the adhesin does seem to aid this process. In addition, these results indicate that WT F11 and F11ΔfimH likely vie for the same intestinal niches, with the first strain established having the upper hand irrespective of FimH expression.

Figure 5.
Figure 5. Pre-colonization of mice with F11ΔfimH effectively limits colonization by the WT strain, and vice versa

Balb/c mice were inoculated via oral gavage with (A) WT F11 (specifically F11-ClmR) and then with F11 ΔfimH (KanR) 7 d later. (B) Alternatively, mice were inoculated with F11 ΔfimH followed 7 d later by the WT strain. Solid lines connect median fecal titers of each strain over time. The zero time point (dotted line) indicates when the second strain (WT F11 or F11ΔfimH) was introduced. *, p<0.05 by Mann-Whitney U tests with corrections for multiple measurements; n=5 mice.

DISCUSSION

The concept of coincidental evolution, coupled with phylogenetic analyses, suggests that the extraintestinal success of ExPEC strains is a by-product of their ability to colonize the gut (26). A corollary of this hypothesis is that extraintestinal virulence and fitness factors promote ExPEC colonization of the gut. In support of this possibility, researchers previously showed that deletion of the seven major pathogenicity islands (PAIs) of the ExPEC isolate 536 not only reduced the virulence of this pathogen in a murine sepsis model, but also attenuated pathogen persistence within the gut (5). Here, we set out to determine if the principal of coincidental evolution could be applied to individual virulence and fitness determinants encoded by the reference ExPEC strain F11. In non-competitive assays using adult SPF mice, we observed no defects in intestinal colonization or the persistence of ExPEC mutants lacking CNF1, Usp, colibactin, flagellin, or the plasmid pUTI89 (see Fig. 2). Mutants that are missing either papG or hlyA exhibited transient colonization defects, but these did not affect longer-term ExPEC survival within the gut (Figs. 1D, 3A, and 3D). These results indicate that at least some ExPEC-linked genes can influence bacterial fitness within the gut, though the effects may be modest. Discerning more unequivocal phenotypes for individual ExPEC-associated loci within the gut can be complicated and context-dependent, as exemplified by the analysis of ΔfimH mutants.

In non-competitive assays, we observed no significant differences between WT F11 and F11ΔfimH, although the mutant was cleared from a few mice over the course of the 14-d experiments (Fig. 3B). This prompted us to test F11ΔfimH further using competitive assays with the WT strain. In these assays, differences between the ΔfimH mutant and WT strains were more distinct, but not significantly so if the data are corrected for multiple comparisons. Still, the fact that F11ΔfimH titers within the feces from nearly half the mice fell below detectable levels by day 10 post-inoculation suggests that FimH can promote ExPEC persistence within the gut (Fig. 3E). These findings are in line with recently published work showing that intestinal persistence of the ExPEC isolate UTI89 within streptomycin-treated mice is facilitated by FimH expression (76). This study, as well as other work with enteric E. coli pathogens (71, 77, 78), suggests that FimH can promote ExPEC interactions with intestinal epithelial cells. In our mouse models, we observed that F11 is localized primarily within the lumen of the colon, though substantial numbers of the pathogen are also associated with the colonic tissue (see Fig. S1B). While FimH may mediate interactions between ExPEC and the intestinal epithelium (76), the adhesin could also influence pathogen persistence within the gut via effects on other processes, including biofilm development and the modulation of innate host defenses (58, 70, 79, 80).

Defining the contributions of FimH to ExPEC fitness within the gut is further complicated by the observation that the deletion of fimH enhances FliC expression by F11 and increases motility (Fig. 4). Analysis of a fliC and fimH DKO mutant in competition with WT F11 indicated that aberrant FliC expression is at least partially responsible for the colonization defects observed with the ΔfimH mutant (Figs. 3E and 4C). This situation mirrors results reported for the ExPEC strain 536, in which reduced intestinal persistence of the mutant lacking seven PAIs was attributed to FliC overexpression (see above, (5)). The expression of flagella is generally thought to have mostly detrimental effects on E. coli fitness within the gut, possibly due to an increased burden on bacterial metabolism and the ability of FliC to stimulate host inflammatory pathways (57, 73–75). However, in competitive assays F11ΔfimH outperformed F11ΔfimHΔfliC, even though the single mutant is hypermotile (Fig. 4D). One potential explanation for this finding is that flagella expression might at times be an advantage for E. coli within one or more intestinal niche, as previously suggested (75). This possibility is difficult to reconcile with the observation that F11ΔfliC has no substantial defects in our noncompetitive assays (Fig. 2D). It is plausible that crosstalk among bacterial regulators of motility, T1P expression, and other adhesins also contribute to the phenotypes observed in our assays with the fimH mutants and other F11 derivatives (81–85), but this will require additional studies to tease apart.

The ability of distinct types of bacteria to utilize different spatial and nutritional niches within the gut allows for the coexistence of the diverse organisms that comprise the intestinal microbiota, and helps provide a barrier against colonization by newly arriving microbes (86). This latter effect, known as colonization resistance, is one reason that it is generally necessary to treat mice with an antibiotic like streptomycin to open up niches for incoming bacteria that are delivered into the gastrointestinal tract by oral gavage (32). A striking feature of our experimental system is that F11 is able to colonize and persist indefinitely within the intestinal tract of conventional SPF mice without the need to first administer antibiotics (Fig. 1A). Our group and others have recently reported similar results with distinct ExPEC isolates in different mouse strain backgrounds (24, 29, 31, 87). ExPEC may be able to effectively colonize our untreated mice because they have very low numbers of endogenous E. coli and other Enterobacteriaceae based on 16S rRNA gene sequencing and selective plating assays (CR Russell and MA Mulvey, unpublished data). Nevertheless, these animals are still resistant to colonization by the K12 strain MG1655, indicating that MG1655 lacks one or more genes that ExPEC employs to persist within the gut. When in competition with F11, MG1655 is cleared from the gut at a notably faster rate than in noncompetitive assays (see Fig. 1), suggesting that these two strains compete for the same intestinal niches.

A better understanding of the survival mechanisms used by ExPEC within the intestinal tract may aid the development of more efficacious probiotics, while also elucidating new therapeutic strategies to combat ExPEC before it is able to disseminate and cause disease at sites beyond the intestinal tract. The effectiveness of such approaches may be dependent on multiple variables, including timing, the makeup of the microbiota, and the presence of specific competing strains that can alter ExPEC requirements for individual fitness determinants. For example, in contrast to the situation in competitive assays, F11ΔfimH has no trouble colonizing the gut in noncompetitive experiments and, once established, this mutant can even persist when challenged with the WT strain (see Figs. 3B and 5B). Thus, while FimH can facilitate ExPEC persistence within the gut in some settings, it is not always an absolute requirement. This conclusion may help reconcile results from older studies in which the expression of T1P was found to be unnecessary for E. coli persistence within the intestinal tracts of rodents and human infants (88–90).

Context-dependent variability in the phenotypic effects of fitness determinants like FimH may complicate treatment approaches, as well as our ability to discern how life within the gut affects the evolution of ExPEC virulence traits. Nevertheless, data presented here indicate that it is reasonable to apply the principle of coincidental evolution to some ExPEC-associated genes, though the phenotypic effects of these genes may be modest and variable dependent on the experimental system that is used. The lack of easily discernable phenotypes for ExPEC-associated loci within the gut suggests that selective forces encountered within other niches have also helped shape ExPEC genomes. For example, extraintestinal virulence has been correlated with the ability of ExPEC strains to resist killing by amoebae (91), while T1P expression has been linked with the transmission of ExPEC between individuals by promoting transient colonization of the oropharynx (88). In total, the results presented here show that piecing together the evolutionary history of ExPEC virulence and fitness traits is a complicated task. However, continuing efforts to resolve this problem will provide a more detailed picture of ExPEC ecology and may help identify niche-specific fitness determinants that could be attractive targets for therapeutic intervention.

MATERIALS AND METHODS

Bacterial strains

The cystitis isolate F11 and the K-12 strain MG1655 were genetically modified using lambda-red recombination that was facilitated by the pKM208 plasmid (92). Most of the constructs used for recombination were created by PCR using either pKD4 or pKD3 as a template to amplify a kanamycin or chloramphenicol resistance cassette, respectively, flanked by ~40 base pairs of DNA with homology to the target insertion site. In some cases, longer homology regions were required, and three-part PCR was performed. This was done by PCR amplification of an antibiotic resistance cassette and regions that are upstream and downstream of the target gene. Primers used were designed to contain sections of homology to allow the three PCR products to be stitched together in a single ligation reaction.

The pCP20 plasmid was used to remove the resistance cassette as necessary (93). To cure F11 of the pUTI89 plasmid, the ccdAB toxin-antitoxin system was replaced with a tetA-sacB construct and spontaneous loss of the plasmid was selected for on LB agar plates containing fusaric acid and sucrose, as explained previously (94). The strains used in this study are listed in Table S1 along with the primers used to create them. Prior to lambda-red recombination, bacteria were grown shaking in LB broth at 37ºC. All growth in petri dishes was done using LB agar supplemented with chloramphenicol (20 µg/ml), kanamycin (50 µg/ml), or ampicillin (50 µg/ml), as appropriate.

Mouse gut colonization

Mice were handled in accordance with protocols approved by the Institutional Animal Care and Use Committee at the University of Utah (Protocol number 15-12015), following US federal guidelines indicated by the Office of Laboratory Animal Welfare (OLAW) and described in the Guide for the Care and Use of Laboratory Animals, 8th Edition.

Prior to inoculation into mice, bacteria were grown statically from frozen stocks for 24 h at 37ºC in 250 ml flasks containing 20 ml of modified M9 media [MgSO4•7H2O (1 mM), CaCl2•2H2O (0.1 mM), D-(+)-glucose (0.1%), nicotinic acid (0.00125%), thiamine HCl (0.00165%), casamino acids (0.2%), Na2HPO4 (6g/L), KH2PO4 (3 g/L), NH4Cl (1 g/L), and NaCl (0.5 g/L) in water]. A total of 12 ml of culture (6 ml of each culture for competitive experiments) was centrifuged at 8,000 X g for 10 min. Bacterial pellets were then washed once and resuspended in 0.5 ml of PBS. To inoculate the mouse gastrointestinal tract, 7–8 week old female, specific pathogen free (SPF) Balb/c or C57Bl/6 mice (The Jackson Laboratory) were orally gavaged with 50 µl PBS containing ~109 CFU of bacteria. At various time points post-inoculation, individual mice were briefly placed into unused takeout boxes for weighing and feces collection. Feces were homogenized in 1 ml of 0.7% NaCl and then samples were briefly centrifuged to pellet insoluble debris. Supernatants were serially diluted and spread onto LB agar plates containing either chloramphenicol (20 µg/ml) or kanamycin (50 µg/ml) to select for growth of the relevant bacterial strains. Prior to gavage, fecal samples were analyzed to ensure that there were no endogenous bacteria present that were resistant to chloramphenicol or kanamycin. Mice were housed 3–5 per cage, and were allowed to eat (irradiated Teklad Global Soy Protein-Free Extruded chow) and drink antibiotic-free water ad libitum. Competitive indices (CIs) were calculated as the ratio of mutant over WT bacteria recovered in the feces divided by the ratio of mutant over WT bacteria in the inoculum, as noted previously (30).

To determine F11 (specifically F11-ClmR) titers within the various regions of the gastrointestinal tract at 14 d post-inoculation, mice were anaesthetized via isofluorane, euthanized by cervical dislocation, and the cecum, colon, small intestine, and stomach were removed. The small intestine was divided into thirds, with the portion closest to the stomach labeled “proximal” and the portion closest to the cecum labeled “distal”. A part of each organ was weighed and placed into a Safe-Lock tube (Eppendorf) with three 3.2 mm stainless steel beads, and homogenized using the Bullet Blender (Next Advance). The homogenates were then serially diluted and plated onto LB agar plates containing chloramphenicol (20 µg/mL) to quantify the levels of F11-clmR present.

For histology, colon tissues were fixed in 10% neutral buffered formalin and submitted to the University of Utah Research Histology core for processing and staining with hematoxylin and eosin (H&E). Uninfected intestinal tissues and tissues recovered from mice at 14 d post-inoculation with either MG1655 or F11ΔhlyA were used for comparison. Random colon tissue sections from 5 or more mice in each experimental group were analyzed in a blinded fashion by a trained pathologist (M.P. Bronner).

Motility Assays

To test the swimming ability of particular strains, motility agar plates were made by pouring 25 mL of LB soft agar (0.1% agar) into a petri dish. Bacteria (1.5 µl from an overnight culture) were dispensed just below the surface of the plate, which was then incubated at 37º C for 8–10 h prior to imaging with a Stratagene Eagle Eye II System.

Luciferase assays

The pfliC-lux construct was kindly provided by the Mobley lab (62). Overnight shaking cultures of F11, F11ΔpapG, and F11ΔfimH carrying pfliC-lux were diluted 1:100 into 1 ml of fresh tryptone broth (Fisher Scientific) containing ampicillin (50 µg/ml). Three 100-ul-aliquots of each culture were then transferred to a white 96-well polystyrene plate (Dynex Technologies) and grown statically at 37°C. Luminescent emission spectra were collected every 30 minutes for 4.5 hours using Gen5 Software with a BioTek Synergy H1 plate reader. The instrument was set to integrate readings over 10 seconds using a gain of 135 and height of 1 mm. Before each reading, the plates were shaken for 1 second. Corresponding growth curves, which were obtained by taking OD600 measurements of cultures grown statically in clear 96-well polystyrene plates (CytoOne), showed that the strains used in these assays grew similarly.

Analysis of the fim switch

Quantification of the fim switch in the ON and OFF positions was DNA was carried out essentially as previously described (68, 69). DNA was purified from feces using the ZR Fecal DNA MiniPrep kit, whereas DNA was purified from broth cultures using the Promega Wizard Genomic DNA Purification kit. To skew the fim switch towards the ON position, F11 was grown statically at 37°C in 20 mL LB broth in 250 mL Erlenmeyer flasks for 24 h, sub-cultured 1:1000 into fresh LB broth, and then incubated for another 24 h. To drive the fim switch towards the OFF position, bacteria were grown shaking in LB broth to exponential phase. The primers F11_fimS_F (TACCGCCAGTAATGCTGCTC) and F11_fimS_R (GTCCCACCATTAACCGTCGT) were used to amplify the fim switch region by PCR using the following thermocycler conditions: 95°C for 5 minutes, 10 cycles (95°C for 30 sec, 60°C for 20 sec, 72°C for 40 sec), followed by 30 cycles (95°C for 30 sec, 56°C for 20 sec, 72°C for 40 sec), and ending with a 5 min incubation at 72°C. The reaction products were column purified, digested with HinfI for 1 h at 37°C, resolved in 1% agarose gels, and imaged. Bands representing the fim switch in the ON and OFF positions were quantified using ImageJ.

Statistical Analysis

All statistical tests were carried out using GraphPad Prism or Stata/IC-14 software. Where indicated, corrections for multiple comparisons were made using the Hochberg procedure (95). P values ≤ 0.05 were considered significant.

FUNDING INFORMATION

This work was supported by NIH grant AI095647 and by seed grants provided by the University of Utah and the Pathology Department. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Supplemental Figure S1.
Supplemental Figure S1. F11, but not MG1655, effectively colonizes the intestinal tract of SPF C57Bl/6 mice.

Adult female SPF C57Bl/6 mice were inoculated via oral gavage with ~109 CFU of either F11 or MG1655. (A) Graph shows titers of F11 and MG1655 recovered from the feces at various time points post-gavage. n=10 mice from two independent non-competitive assays. **, p<0.01 by Wilcoxon signed-rank tests, with corrections for multiple comparisons. (B) F11 titers recovered in association with the colonic tissue or within the lumen of the colon at 14 d post-gavage. P value determined by Mann-Whitney test; n=10 mice.

View this table:
Supplemental Table S1. Bacterial strains used in this study

ACKNOWLEDGMENTS

We are grateful to members of the Mulvey Lab for their insightful conversations and advice. We are also indebted to the Office of Comparative Medicine at the University of Utah for their assistance with animal care.

REFERENCES

  1. 1.↵
    Blount ZD. 2015. The unexhausted potential of E. coli. Elife 4.
  2. 2.↵
    Bezirtzoglou E. 1997. The intestinal microflora during the first weeks of life. Anaerobe 3:173–7.
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    Human Microbiome Project C. 2012. Structure, function and diversity of the healthy human microbiome. Nature 486:207–14.
    OpenUrlCrossRefPubMedWeb of Science
  4. 4.↵
    Tenaillon O, Skurnik D, Picard B, Denamur E. 2010. The population genetics of commensal Escherichia coli. Nat Rev Microbiol 8:207–17.
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Diard M, Garry L, Selva M, Mosser T, Denamur E, Matic I. 2010. Pathogenicity-associated islands in extraintestinal pathogenic Escherichia coli are fitness elements involved in intestinal colonization. J Bacteriol 192:4885–93.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    Karpman D, Stahl AL. 2014. Enterohemorrhagic Escherichia coli Pathogenesis and the Host Response. Microbiol Spectr 2.
  7. 7.↵
    Rolhion N, Darfeuille-Michaud A. 2007. Adherent-invasive Escherichia coli in inflammatory bowel disease. Inflamm Bowel Dis 13:1277–83.
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.
    Arthur JC, Perez-Chanona E, Muhlbauer M, Tomkovich S, Uronis JM, Fan TJ, Campbell BJ, Abujamel T, Dogan B, Rogers AB, Rhodes JM, Stintzi A, Simpson KW, Hansen JJ, Keku TO, Fodor AA, Jobin C. 2012. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science 338:120–3.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    Arthur JC, Gharaibeh RZ, Muhlbauer M, Perez-Chanona E, Uronis JM, McCafferty J, Fodor AA, Jobin C. 2014. Microbial genomic analysis reveals the essential role of inflammation in bacteria-induced colorectal cancer. Nat Commun 5:4724.
    OpenUrlCrossRefPubMed
  10. 10.↵
    Schultz M, Strauch UG, Linde HJ, Watzl S, Obermeier F, Gottl C, Dunger N, Grunwald N, Scholmerich J, Rath HC. 2004. Preventive effects of Escherichia coli strain Nissle 1917 on acute and chronic intestinal inflammation in two different murine models of colitis. Clin Diagn Lab Immunol 11:372–8.
    OpenUrlCrossRefPubMed
  11. 11.↵
    Deriu E, Liu JZ, Pezeshki M, Edwards RA, Ochoa RJ, Contreras H, Libby SJ, Fang FC, Raffatellu M. 2013. Probiotic bacteria reduce Salmonella typhimurium intestinal colonization by competing for iron. Cell Host Microbe 14:26–37.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    Vila J, Saez-Lopez E, Johnson JR, Romling U, Dobrindt U, Canton R, Giske CG, Naas T, Carattoli A, Martinez-Medina M, Bosch J, Retamar P, Rodriguez-Bano J, Baquero F, Soto SM. 2016. Escherichia coli: an old friend with new tidings. FEMS Microbiol Rev doi:10.1093/femsre/fuw005.
    OpenUrlCrossRefPubMed
  13. 13.↵
    Barber AE, Norton JP, Spivak AM, Mulvey MA. 2013. Urinary tract infections: current and emerging management strategies. Clin Infect Dis 57:719–24.
    OpenUrlCrossRefPubMed
  14. 14.↵
    Barber AE, Norton JP, Wiles TJ, Mulvey MA. 2016. Strengths and limitations of model systems for the study of urinary tract infections and related pathologies. Microbiol Mol Biol Rev 80:351–67.
    OpenUrlAbstract/FREE Full Text
  15. 15.↵
    Moreno E, Andreu A, Pigrau C, Kuskowski MA, Johnson JR, Prats G. 2008. Relationship between Escherichia coli strains causing acute cystitis in women and the fecal E. coli population of the host. J Clin Microbiol 46:2529–34.
    OpenUrlAbstract/FREE Full Text
  16. 16.
    Chen SL, Wu M, Henderson JP, Hooton TM, Hibbing ME, Hultgren SJ, Gordon JI. 2013. Genomic diversity and fitness of E. coli strains recovered from the intestinal and urinary tracts of women with recurrent urinary tract infection. Sci Transl Med 5:184ra60.
    OpenUrlAbstract/FREE Full Text
  17. 17.
    Foxman B, Manning SD, Tallman P, Bauer R, Zhang L, Koopman JS, Gillespie B, Sobel JD, Marrs CF. 2002. Uropathogenic Escherichia coli are more likely than commensal E. coli to be shared between heterosexual sex partners. Am J Epidemiol 156:1133–40.
    OpenUrl
  18. 18.↵
    Yamamoto S, Tsukamoto T, Terai A, Kurazono H, Takeda Y, Yoshida O. 1997. Genetic evidence supporting the fecal-perineal-urethral hypothesis in cystitis caused by Escherichia coli. J Urol 157:1127–9.
    OpenUrlCrossRefPubMedWeb of Science
  19. 19.↵
    Russo TA, Stapleton A, Wenderoth S, Hooton TM, Stamm WE. 1995. Chromosomal restriction fragment length polymorphism analysis of Escherichia coli strains causing recurrent urinary tract infections in young women. J Infectious Dis 172:440–5.
    OpenUrlCrossRefPubMedWeb of Science
  20. 20.↵
    Nowrouzian FL, Wold AE, Adlerberth I. 2005. Escherichia coli strains belonging to phylogenetic group B2 have superior capacity to persist in the intestinal microflora of infants. J Infect Dis 191:1078–83.
    OpenUrlCrossRefPubMedWeb of Science
  21. 21.↵
    Nowrouzian FL, Adlerberth I, Wold AE. 2006. Enhanced persistence in the colonic microbiota of Escherichia coli strains belonging to phylogenetic group B2: role of virulence factors and adherence to colonic cells. Microbes Infect 8:834–40.
    OpenUrlCrossRefPubMedWeb of Science
  22. 22.↵
    Smati M, Clermont O, Le Gal F, Schichmanoff O, Jaureguy F, Eddi A, Denamur E, Picard B, Coliville G. 2013. Real-time PCR for quantitative analysis of human commensal Escherichia coli populations reveals a high frequency of subdominant phylogroups. Appl Environ Microbiol 79:5005–12.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    Rosen DA, Hooton TM, Stamm WE, Humphrey PA, Hultgren SJ. 2007. Detection of intracellular bacterial communities in human urinary tract infection. PLoS Med 4:e329.
    OpenUrlCrossRefPubMed
  24. 24.↵
    Tourret J, Willing BP, Croxen MA, Dufour N, Dion S, Wachtel S, Denamur E, Finlay BB. 2016. Small intestine early innate immunity response during intestinal colonization by Escherichia coli depends on its extra-intestinal virulence status. PLoS One 11:e0153034.
    OpenUrlCrossRef
  25. 25.↵
    Manges AR, Johnson JR, Foxman B, O’Bryan TT, Fullerton KE, Riley LW. 2001. Widespread distribution of urinary tract infections caused by a multidrug-resistant Escherichia coli clonal group. N Engl J Med 345:1007–13.
    OpenUrlCrossRefPubMedWeb of Science
  26. 26.↵
    Le Gall T, Clermont O, Gouriou S, Picard B, Nassif X, Denamur E, Tenaillon O. 2007. Extraintestinal virulence is a coincidental by-product of commensalism in B2 phylogenetic group Escherichia coli strains. Mol Biol Evol 24:2373–84.
    OpenUrlCrossRefPubMedWeb of Science
  27. 27.↵
    Levin BR. 1996. The evolution and maintenance of virulence in microparasites. Emerg Infect Dis 2:93–102.
    OpenUrlCrossRefPubMedWeb of Science
  28. 28.↵
    Wold AE, Caugant DA, Lidin-Janson G, de Man P, Svanborg C. 1992. Resident colonic Escherichia coli strains frequently display uropathogenic characteristics. J Infect Dis 165:46–52.
    OpenUrlCrossRefPubMedWeb of Science
  29. 29.↵
    Norton JP, Mulvey MA. 2012. Toxin-antitoxin systems are important for niche-specific colonization and stress resistance of uropathogenic Escherichia coli. PLoS Pathog 8:e1002954.
    OpenUrlCrossRefPubMed
  30. 30.↵
    Russell CW, Richards AC, Chang AS, Mulvey MA. 2017. The rhomboid protease GlpG promotes the persistence of extraintestinal pathogenic Escherichia coli within the gut. Infect Immun doi:10.1128/IAI.00866-16.
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    Russell CW, Mulvey MA. 2015. The extraintestinal pathogenic Escherichia coli factor RqlI constrains the genotoxic effects of the RecQ-Like helicase RqlH. PLoS Pathog 11:e1005317.
    OpenUrlCrossRefPubMed
  32. 32.↵
    Myhal ML, Laux DC, Cohen PS. 1982. Relative colonizing abilities of human fecal and K 12 strains of Escherichia coli in the large intestines of streptomycin-treated mice. Eur J Clin Microbiol 1:186–92.
    OpenUrlCrossRefPubMed
  33. 33.↵
    Troeger H, Richter JF, Beutin L, Gunzel D, Dobrindt U, Epple HJ, Gitter AH, Zeitz M, Fromm M, Schulzke JD. 2007. Escherichia coli alpha-haemolysin induces focal leaks in colonic epithelium: a novel mechanism of bacterial translocation. Cell Microbiol 9:2530–40.
    OpenUrlCrossRefPubMed
  34. 34.
    Bucker R, Schulz E, Gunzel D, Bojarski C, Lee IF, John LJ, Wiegand S, Janssen T, Wieler LH, Dobrindt U, Beutin L, Ewers C, Fromm M, Siegmund B, Troeger H, Schulzke JD. 2014. alpha-Haemolysin of Escherichia coli in IBD: a potentiator of inflammatory activity in the colon. Gut 63:1893–901.
    OpenUrlAbstract/FREE Full Text
  35. 35.↵
    Wiegand S, Zakrzewski SS, Eichner M, Schulz E, Gunzel D, Pieper R, Rosenthal R, Barmeyer C, Bleich A, Dobrindt U, Schulzke JD, Bucker R. 2017. Zinc treatment is efficient against Escherichia coli alpha-haemolysin-induced intestinal leakage in mice. Sci Rep 7:45649.
    OpenUrlCrossRef
  36. 36.↵
    Welch RA. 2016. Uropathogenic Escherichia coli-associated exotoxins. Microbiol Spectr 4.
  37. 37.↵
    Fiorentini C, Arancia G, Caprioli A, Falbo V, Ruggeri FM, Donelli G. 1988. Cytoskeletal changes induced in HEp-2 cells by the cytotoxic necrotizing factor of Escherichia coli. Toxicon 26:1047–56.
    OpenUrlCrossRefPubMed
  38. 38.↵
    Caprioli A, Falbo V, Roda LG, Ruggeri FM, Zona C. 1983. Partial purification and characterization of an Escherichia coli toxic factor that induces morphological cell alterations. Infect Immun 39:1300–6.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    Smith YC, Rasmussen SB, Grande KK, Conran RM, O’Brien AD. 2008. Hemolysin of uropathogenic Escherichia coli evokes extensive shedding of the uroepithelium and hemorrhage in bladder tissue within the first 24 hours after intraurethral inoculation of mice. Infect Immun 76:2978–90.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    Rippere-Lampe KE, Lang M, Ceri H, Olson M, Lockman HA, O’Brien AD. 2001. Cytotoxic necrotizing factor type 1-positive Escherichia coli causes increased inflammation and tissue damage to the prostate in a rat prostatitis model. Infect Immun 69:6515–9.
    OpenUrlAbstract/FREE Full Text
  41. 41.
    Rippere-Lampe KE, O’Brien AD, Conran R, Lockman HA. 2001. Mutation of the gene encoding cytotoxic necrotizing factor type 1 (CNF(1)) attenuates the virulence of uropathogenic Escherichia coli. Infect Immun 69:3954–64.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    Johnson DE, Drachenberg C, Lockatell CV, Island MD, Warren JW, Donnenberg MS. 2000. The role of cytotoxic necrotizing factor-1 in colonization and tissue injury in a murine model of urinary tract infection. FEMS Immunol Med Microbiol 28:37–41.
    OpenUrlCrossRefPubMed
  43. 43.↵
    Kanamaru S, Kurazono H, Ishitoya S, Terai A, Habuchi T, Nakano M, Ogawa O, Yamamoto S. 2003. Distribution and genetic association of putative uropathogenic virulence factors iroN, iha, kpsMT, ompT and usp in Escherichia coli isolated from urinary tract infections in Japan. J Urol 170:2490–3.
    OpenUrlCrossRefPubMedWeb of Science
  44. 44.↵
    Bauer RJ, Zhang L, Foxman B, Siitonen A, Jantunen ME, Saxen H, Marrs CF. 2002. Molecular epidemiology of 3 putative virulence genes for Escherichia coli urinary tract infection-usp, iha, and iroN (E. coli). J Infect Dis 185:1521–4.
    OpenUrlCrossRefPubMed
  45. 45.↵
    Ostblom A, Adlerberth I, Wold AE, Nowrouzian FL. 2011. Pathogenicity island markers, virulence determinants malX and usp, and the capacity of Escherichia coli to persist in infants’ commensal microbiotas. Appl Environ Microbiol 77:2303–8.
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    Nipic D, Podlesek Z, Budic M, Crnigoj M, Zgur-Bertok D. 2013. Escherichia coli uropathogenic-specific protein, Usp, is a bacteriocin-like genotoxin. J Infect Dis 208:1545–52.
    OpenUrlCrossRefPubMed
  47. 47.
    Zaw MT, Yamasaki E, Yamamoto S, Nair GB, Kawamoto K, Kurazono H. 2013. Uropathogenic specific protein gene, highly distributed in extraintestinal uropathogenic Escherichia coli, encodes a new member of H-N-H nuclease superfamily. Gut Pathog 5:13.
    OpenUrlCrossRefPubMed
  48. 48.↵
    Kurazono H, Yamamoto S, Nakano M, Nair GB, Terai A, Chaicumpa W, Hayashi H. 2000. Characterization of a putative virulence island in the chromosome of uropathogenic Escherichia coli possessing a gene encoding a uropathogenic-specific protein. Microb Pathog 28:183–9.
    OpenUrlCrossRefPubMedWeb of Science
  49. 49.↵
    Nougayrede JP, Homburg S, Taieb F, Boury M, Brzuszkiewicz E, Gottschalk G, Buchrieser C, Hacker J, Dobrindt U, Oswald E. 2006. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science 313:848–51.
    OpenUrlAbstract/FREE Full Text
  50. 50.↵
    Cuevas-Ramos G, Petit CR, Marcq I, Boury M, Oswald E, Nougayrede JP. 2010. Escherichia coli induces DNA damage in vivo and triggers genomic instability in mammalian cells. Proc Natl Acad Sci U S A 107:11537–42.
    OpenUrlAbstract/FREE Full Text
  51. 51.↵
    Taieb F, Petit C, Nougayrede JP, Oswald E. 2016. Distribution and genetic association of putative uropathogenic virulence factors iroN, iha, kpsMT, ompT a. EcoSal Plus 7.
  52. 52.↵
    McCarthy AJ, Martin P, Cloup E, Stabler RA, Oswald E, Taylor PW. 2015. The genotoxin colibactin is a determinant of virulence in Escherichia coli K1 experimental neonatal systemic infection. Infect Immun 83:3704–11.
    OpenUrlAbstract/FREE Full Text
  53. 53.↵
    Marcq I, Martin P, Payros D, Cuevas-Ramos G, Boury M, Watrin C, Nougayrede JP, Olier M, Oswald E. 2014. The genotoxin colibactin exacerbates lymphopenia and decreases survival rate in mice infected with septicemic Escherichia coli. J Infect Dis 210:285–94.
    OpenUrlCrossRefPubMed
  54. 54.↵
    Payros D, Secher T, Boury M, Brehin C, Menard S, Salvador-Cartier C, Cuevas-Ramos G, Watrin C, Marcq I, Nougayrede JP, Dubois D, Bedu A, Garnier F, Clermont O, Denamur E, Plaisancie P, Theodorou V, Fioramonti J, Olier M, Oswald E. 2014. Maternally acquired genotoxic Escherichia coli alters offspring’s intestinal homeostasis. Gut Microbes 5:313–25.
    OpenUrlCrossRefPubMed
  55. 55.↵
    Homburg S, Oswald E, Hacker J, Dobrindt U. 2007. Expression analysis of the colibactin gene cluster coding for a novel polyketide in Escherichia coli. FEMS Microbiol Lett 275:255–62.
    OpenUrlCrossRefPubMed
  56. 56.↵
    Morimoto YV, Minamino T. 2014. Structure and function of the bi-directional bacterial flagellar motor. Biomolecules 4:217–34.
    OpenUrlCrossRefPubMed
  57. 57.↵
    Cullender TC, Chassaing B, Janzon A, Kumar K, Muller CE, Werner JJ, Angenent LT, Bell ME, Hay AG, Peterson DA, Walter J, Vijay-Kumar M, Gewirtz AT, Ley RE. 2013. Innate and adaptive immunity interact to quench microbiome flagellar motility in the gut. Cell Host Microbe 14:571–81.
    OpenUrlCrossRefPubMed
  58. 58.↵
    Pratt LA, Kolter R. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30:285–93.
    OpenUrlCrossRefPubMedWeb of Science
  59. 59.↵
    Haugen BJ, Pellett S, Redford P, Hamilton HL, Roesch PL, Welch RA. 2007. In vivo gene expression analysis identifies genes required for enhanced colonization of the mouse urinary tract by uropathogenic Escherichia coli strain CFT073 dsdA. Infect Immun 75:278–89.
    OpenUrlAbstract/FREE Full Text
  60. 60.
    Wright KJ, Seed PC, Hultgren SJ. 2005. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun 73:7657–68.
    OpenUrlAbstract/FREE Full Text
  61. 61.
    Lane MC, Lockatell V, Monterosso G, Lamphier D, Weinert J, Hebel JR, Johnson DE, Mobley HL. 2005. Role of motility in the colonization of uropathogenic Escherichia coli in the urinary tract. Infect Immun 73:7644–56.
    OpenUrlAbstract/FREE Full Text
  62. 62.↵
    Lane MC, Alteri CJ, Smith SN, Mobley HL. 2007. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A 104:16669–74.
    OpenUrlAbstract/FREE Full Text
  63. 63.↵
    McCormick BA, Laux DC, Cohen PS. 1990. Neither motility nor chemotaxis plays a role in the ability of Escherichia coli F-18 to colonize the streptomycin-treated mouse large intestine. Infect Immun 58:2957–61.
    OpenUrlAbstract/FREE Full Text
  64. 64.↵
    Chen SL, Hung CS, Xu J, Reigstad CS, Magrini V, Sabo A, Blasiar D, Bieri T, Meyer RR, Ozersky P, Armstrong JR, Fulton RS, Latreille JP, Spieth J, Hooton TM, Mardis ER, Hultgren SJ, Gordon JI. 2006. Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. Proc Natl Acad Sci U S A 103:5977–82.
    OpenUrlAbstract/FREE Full Text
  65. 65.↵
    Wijetunge DS, Karunathilake KH, Chaudhari A, Katani R, Dudley EG, Kapur V, DebRoy C, Kariyawasam S. 2014. Complete nucleotide sequence of pRS218, a large virulence plasmid, that augments pathogenic potential of meningitis-associated Escherichia coli strain RS218. BMC Microbiol 14:203.
    OpenUrlCrossRefPubMed
  66. 66.↵
    Cusumano CK, Hung CS, Chen SL, Hultgren SJ. 2010. Virulence plasmid harbored by uropathogenic Escherichia coli functions in acute stages of pathogenesis. Infect Immun 78:1457–67.
    OpenUrlAbstract/FREE Full Text
  67. 67.↵
    Russell CW, Mulvey MA. 2014. Type 1 and P pili of uropathogenic Escherichia coli., p 49–70. In Barocchi MA, Telford JL (ed), Bacterial pili: structure, synthesis and role in disease, 1 ed doi:10.1079/9781780642550.0049. CAB International, Wallingford, UK.
    OpenUrlCrossRef
  68. 68.↵
    Roesch PL, Blomfield IC. 1998. Leucine alters the interaction of the leucine-responsive regulatory protein (Lrp) with the fim switch to stimulate site-specific recombination in Escherichia coli. Mol Microbiol 27:751–61.
    OpenUrlCrossRefPubMedWeb of Science
  69. 69.↵
    Floyd KA, Moore JL, Eberly AR, Good JA, Shaffer CL, Zaver H, Almqvist F, Skaar EP, Caprioli RM, Hadjifrangiskou M. 2015. Adhesive fiber stratification in uropathogenic Escherichia coli biofilms unveils oxygen-mediated control of type 1 pili. PLoS Pathog 11:e1004697.
    OpenUrlCrossRefPubMed
  70. 70.↵
    Nowrouzian FL, Friman V, Adlerberth I, Wold AE. 2007. Reduced phase switch capacity and functional adhesin expression of type 1-fimbriated Escherichia coli from immunoglobulin A-deficient individuals. Infect Immun 75:932–40.
    OpenUrlAbstract/FREE Full Text
  71. 71.↵
    Sheikh A, Rashu R, Begum YA, Kuhlman FM, Ciorba MA, Hultgren SJ, Qadri F, Fleckenstein JM. 2017. Highly conserved type 1 pili promote enterotoxigenic E. coli pathogen-host interactions. PLoS Negl Trop Dis 11:e0005586.
    OpenUrlCrossRef
  72. 72.↵
    Greene SE, Pinkner JS, Chorell E, Dodson KW, Shaffer CL, Conover MS, Livny J, Hadjifrangiskou M, Almqvist F, Hultgren SJ. 2014. Pilicide ec240 disrupts virulence circuits in uropathogenic Escherichia coli. MBio 5:e02038.
    OpenUrlCrossRefPubMed
  73. 73.↵
    Leatham MP, Stevenson SJ, Gauger EJ, Krogfelt KA, Lins JJ, Haddock TL, Autieri SM, Conway T, Cohen PS. 2005. Mouse intestine selects nonmotile flhDC mutants of Escherichia coli MG1655 with increased colonizing ability and better utilization of carbon sources. Infect Immun 73:8039–49.
    OpenUrlAbstract/FREE Full Text
  74. 74.
    Giraud A, Arous S, De Paepe M, Gaboriau-Routhiau V, Bambou JC, Rakotobe S, Lindner AB, Taddei F, Cerf-Bensussan N. 2008. Dissecting the genetic components of adaptation of Escherichia coli to the mouse gut. PLoS Genet 4:e2.
    OpenUrlCrossRefPubMed
  75. 75.↵
    Gauger EJ, Leatham MP, Mercado-Lubo R, Laux DC, Conway T, Cohen PS. 2007. Role of motility and the flhDC Operon in Escherichia coli MG1655 colonization of the mouse intestine. Infect Immun 75:3315–24.
    OpenUrlAbstract/FREE Full Text
  76. 76.↵
    Spaulding CN, Klein RD, Ruer S, Kau AL, Schreiber HL, Cusumano ZT, Dodson KW, Pinkner JS, Fremont DH, Janetka JW, Remaut H, Gordon JI, Hultgren SJ. 2017. Selective depletion of uropathogenic E. coli from the gut by a FimH antagonist. Nature 546:528–532.
    OpenUrlCrossRef
  77. 77.↵
    Boudeau J, Barnich N, Darfeuille-Michaud A. 2001. Type 1 pili-mediated adherence of Escherichia coli strain LF82 isolated from Crohn’s disease is involved in bacterial invasion of intestinal epithelial cells. Mol Microbiol 39:1272–84.
    OpenUrlCrossRefPubMedWeb of Science
  78. 78.↵
    Barnich N, Carvalho FA, Glasser AL, Darcha C, Jantscheff P, Allez M, Peeters H, Bommelaer G, Desreumaux P, Colombel JF, Darfeuille-Michaud A. 2007. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest 117:1566–74.
    OpenUrlCrossRefPubMedWeb of Science
  79. 79.↵
    Ashkar AA, Mossman KL, Coombes BK, Gyles CL, Mackenzie R. 2008. FimH adhesin of type 1 fimbriae is a potent inducer of innate antimicrobial responses which requires TLR4 and type 1 interferon signalling. PLoS Pathog 4:e1000233.
    OpenUrlCrossRefPubMed
  80. 80.↵
    Bollinger RR, Everett ML, Wahl SD, Lee YH, Orndorff PE, Parker W. 2006. Secretory IgA and mucin-mediated biofilm formation by environmental strains of Escherichia coli: role of type 1 pili. Mol Immunol 43:378–87.
    OpenUrlCrossRefPubMedWeb of Science
  81. 81.↵
    Snyder JA, Haugen BJ, Lockatell CV, Maroncle N, Hagan EC, Johnson DE, Welch RA, Mobley HL. 2005. Coordinate expression of fimbriae in uropathogenic Escherichia coli. Infect Immun 73:7588–96.
    OpenUrlAbstract/FREE Full Text
  82. 82.
    Holden NJ, Totsika M, Mahler E, Roe AJ, Catherwood K, Lindner K, Dobrindt U, Gally DL. 2006. Demonstration of regulatory cross-talk between P fimbriae and type 1 fimbriae in uropathogenic Escherichia coli. Microbiology 152:1143–53.
    OpenUrlCrossRefPubMedWeb of Science
  83. 83.
    Xia Y, Gally D, Forsman-Semb K, Uhlin BE. 2000. Regulatory cross-talk between adhesin operons in Escherichia coli: inhibition of type 1 fimbriae expression by the PapB protein. EMBO J 19:1450–7.
    OpenUrlAbstract/FREE Full Text
  84. 84.
    Cooper LA, Simmons LA, Mobley HL. 2012. Involvement of mismatch repair in the reciprocal control of motility and adherence of uropathogenic Escherichia coli. Infect Immun 80:1969–79.
    OpenUrlAbstract/FREE Full Text
  85. 85.↵
    Lane MC, Simms AN, Mobley HL. 2007. Complex interplay between type 1 fimbrial expression and flagellum-mediated motility of uropathogenic Escherichia coli. J Bacteriol 189:5523–33.
    OpenUrlAbstract/FREE Full Text
  86. 86.↵
    Lawley TD, Walker AW. 2013. Intestinal colonization resistance. Immunology 138:1–11.
    OpenUrlCrossRefPubMedWeb of Science
  87. 87.↵
    Green SI, Ajami NJ, Ma L, Poole NM, Price RE, Petrosino JF, Maresso AW. 2015. Murine model of chemotherapy-induced extraintestinal pathogenic Escherichia coli translocation. Infect Immun 83:3243–56.
    OpenUrlAbstract/FREE Full Text
  88. 88.↵
    Bloch CA, Stocker BA, Orndorff PE. 1992. A key role for type 1 pili in enterobacterial communicability. Mol Microbiol 6:697–701.
    OpenUrlCrossRefPubMedWeb of Science
  89. 89.
    Tullus K, Kuhn I, Orskov I, Orskov F, Mollby R. 1992. The importance of P and type 1 fimbriae for the persistence of Escherichia coli in the human gut. Epidemiol Infect 108:415–21.
    OpenUrlCrossRefPubMed
  90. 90.↵
    McCormick BA, Franklin DP, Laux DC, Cohen PS. 1989. Type 1 pili are not necessary for colonization of the streptomycin-treated mouse large intestine by type 1-piliated Escherichia coli F-18 and E. coli K-12. Infect Immun 57:3022–9.
    OpenUrlAbstract/FREE Full Text
  91. 91.↵
    Adiba S, Nizak C, van Baalen M, Denamur E, Depaulis F. 2010. From grazing resistance to pathogenesis: the coincidental evolution of virulence factors. PLoS One 5:e11882.
    OpenUrlCrossRefPubMed
  92. 92.↵
    Murphy KC, Campellone KG. 2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC Mol Biol 4:11.
    OpenUrlCrossRefPubMed
  93. 93.↵
    Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–5.
    OpenUrlAbstract/FREE Full Text
  94. 94.↵
    Li XT, Thomason LC, Sawitzke JA, Costantino N, Court DL. 2013. Positive and negative selection using the tetA-sacB cassette: recombineering and P1 transduction in Escherichia coli. Nucleic Acids Res 41:e204.
    OpenUrlCrossRefPubMed
  95. 95.↵
    Wright SP. 1993. Adjusted p-values for simultaneous inference. Biometrics 48:1005–1013.
    OpenUrl
Back to top
Posted July 20, 2017.
Download PDF
Email
Context-dependent Requirements for FimH and Other Canonical Virulence Factors in Gut Colonization by Extraintestinal Pathogenic Escherichia coli
Colin W. Russell, Brittany A. Fleming, Alan T. Stenquist, Morgan A. Wambaugh, Mary P. Bronner, Matthew A. Mulvey
bioRxiv 166108; doi: https://doi.org/10.1101/166108
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area