New Results

Loss of Caveolin-1 and caveolae leads to increased cardiac cell stiffness and functional decline of the adult zebrafish heart

Dimitrios Grivas, Álvaro González-Rajal, Carlos Guerrero Rodríguez, Ricardo Garcia, José Luis de la Pompa
doi: https://doi.org/10.1101/2020.01.16.909267

ABSTRACT

Caveolin-1 is the main structural protein of caveolae, small membrane invaginations involved in signal transduction and mechanoprotection. Here, we generated cav1-KO zebrafish lacking Cav1 and caveolae, and investigated the impact of this loss on adult heart function and response to cryoinjury. We found that cardiac function was impaired in adult cav1-KO fish, which showed a significantly decreased ejection fraction and heart rate. Using atomic force microscopy, we detected an increase in the stiffness of epicardial cells and cortical myocardium lacking Cav1/caveolae. This loss of cardiac elasticity might explain the decreased cardiac contraction and function. Surprisingly, cav1-KO mutants were able to regenerate their heart after a cryoinjury but showed a transient decrease in cardiomyocyte proliferation.

Introduction

Caveolae are small membrane invaginations present in endothelial cells, fibroblasts and less abundantly, in cardiomyocytes (Cohen et al., 2003; Patel et al., 2007; Robenek et al., 2008; Scherer et al., 1997). Caveolin-1 (Cav1) is the main structural protein of caveolae (Fra et al., 1995), as Cav1 deletion in mice abolishes caveolae formation (Drab et al., 2001). Similarly, the caveolae associated protein Cavin1, is essential for caveolae formation, because its genetic deletion leads to loss of caveolae (Liu et al., 2008). Caveolae participate in multiple cellular processes, including lipid homoeostasis and signal transduction (Cheng et al., 2015; Cohen et al., 2003; Kim et al., 2008). In particular, Cav1 interacts directly with TGFβR1, blocking Smad complex nuclear translocation and, consequently, inhibiting transcriptional activation (Razani et al., 2001). Furthermore, caveolae are involved in mechanoprotection, as they deliver the extra membrane needed for cells to buffer the mechanical forces through rapid disassembly and flattening (Sinha et al., 2011). Physiologically, caveolae protect mouse cardiac endothelial cells from rupture caused by increased cardiac output (Cheng et al., 2015). Likewise, caveolae safeguard zebrafish skeletal muscle cells from rupture after vigorous activity (Lo et al., 2015), and maintain notochord’s integrity (Garcia et al., 2017a; Lim et al., 2017).

Knock-out of Cav1 in the mouse results in cardiac remodelling. Right ventricle dilatation and left ventricle hypertrophy are among the various cardiac defects associated with loss of caveolae (Cohen et al., 2003; Park et al., 2003; Zhao et al., 2002). Additionally, Cav1 mutant mice show defective heart function, including decreased systolic and diastolic function (Cohen et al., 2003; Park et al., 2003; Wunderlich et al., 2006; Zhao et al., 2002), which are exacerbated after myocardial infarction (Jasmin et al., 2011; Shivshankar et al., 2014). Cardiac insult in Cav1 mutant mice also leads to aberrant fibrosis, mediated by increased Smad2/3 phosphorylation and M2 macrophages infiltration (Miyasato et al., 2011; Shivshankar et al., 2014). Resection of the ventricular apex in hearts of cav1a mutant zebrafish leads to regeneration arrest 30 days post injury, because of decreased cardiomyocyte proliferation and increased fibrosis in the amputation plain (Cao et al., 2016).

Here, we generated cav1-KO zebrafish and investigated the importance of Cav1 and caveolae in the mechanical properties of the cardiac tissue and in regeneration after cryoinjury. We found that while the absence of Cav1 does not affect cardiac regeneration, cav1-KO hearts show a transient decrease in cardiomyocyte proliferation during this process. Using atomic force microscopy (AFM)-force spectroscopy measurements (Dufrêne et al., 2017) we detected a significant decrease in cardiac elasticity in cav1-KO animals. Accordingly, epicardial cells and cortical myocardium in cav1-KO hearts lacking caveolae are stiffer than wild type (WT) counterparts. Furthermore, cav1-KO hearts showed a severe ventricular dysfunction, underscoring the role of caveolae in the mechanical properties and homeostasis of the heart.

Results and Discussion

Caveolin-1 expression in the intact and regenerating zebrafish heart

We began our analysis by examining Cav1 expression in intact hearts. We used the Tg(fli1a:GFP) line (Lawson and Weinstein, 2002), which expresses GFP in the endocardium and endothelium, and stained with antibodies against Cav1 and tropomyosin (Fig. 1A). Robust Cav1 expression was detected in the vasculature (asterisks in Fig. 1B-B΄) and in the endocardium (arrowheads in Fig. 1B-B΄ and Fig. 1C-C΄). Strong expression was also found in the epicardium (arrows in Fig. 1B-B΄), in the bulbus arteriosus and in the valves (Fig. 1A). Additionally, Cav1 expression was detected in the area between the cortical and trabecular myocardium (dashed area in Fig. 1B-B΄ and inset in Fig. 1B΄). We then analysed Cav1 expression in the regenerating zebrafish heart after cryoinjury (Fig. 1D). We used the Tg(wt1b:GFP) line that expresses GFP in the epicardium upon injury (González-Rosa et al., 2012). Seven days post cryoinjury (dpci), Cav1 was strongly expressed in epicardial cells (Fig. 1E, brackets) covering the injured site, overlapping with GFP. High expression was also detected in the endocardium within the injured area (Fig. 1E, arrows). To confirm these observations, we utilised the Tg(fli1a:GFP) line and found that Cav1 was expressed in GFP+ endocardial cells invading the damaged tissue (Fig. 1F-G΄, arrows). We also surveyed the expression of caveolae-related genes during heart regeneration by quantitative (q)PCR (Fig. 1H). cav1 and cavin1b were upregulated after injury, in contrast to cav2 and cav3 whose expression remained stable. These results show that Cav1 is expressed in the endocardium, endothelium and epicardium of the intact heart, three cell types that are activated during regeneration (González-Rosa et al., 2012; Kikuchi et al., 2011; Marín-Juez et al., 2016; Münch et al., 2017). Also, upon injury, Cav1 expression is strongly increased in epicardial cells surrounding the injured site, and in the endocardium invading the injured area.

Figure 1.
Figure 1. Caveolin-1 expression in the endothelium, endocardium and epicardium of the intact and injured adult zebrafish heart is abolished in CRISPR/Cas9 generated cav1-KO mutants.

(A-C΄΄) Immunostaining of Cav1 and Tropomyosin (cardiomyocytes) in intact Tg(fli1a:GFP) heart. ba=bulbus arteriosus, v=valves.

(B-C΄΄) Cav1 immunoreactivity in the epicardium (red, arrows) overlaps with GFP in the endothelium (asterisks) and endocardium (arrowheads). Cav1 is also expressed in the zone between the cortical and trabecular cardiomyocytes (dashed area in B-B΄, inset in B΄).

(D,E) Cav1 immunostaining in 7dpci Tg(wt1b:GFP) heart. The dashed area denotes the injured area; Cav1 is expressed in the activated epicardium (E, brackets) and endocardium (E, arrows) upon injury.

(F-G΄) Immunolabelling of Cav1 in 7dpci Tg(fli1a:GFP) heart. (G-G΄) Arrows indicate Cav1+ endocardial cells.

(H) qPCR analysis of caveolae-related genes during regeneration. Mean±s.d., Brown-Forsythe and Welch ANOVA tests, *P<0.05, **P<0.01.

Schematic representation of the two cav1 transcripts, cav1a and cav1b. Arrowhead=target site, ex=exon.

Identified mutations. Red dashed lines indicate deletions, red uppercase letters insertions, and black lowercase letters silent mutations. bp=base pairs.

Cav1 domain organisation and the predicted effect on the protein. Red letters=novel amino acids, x=stop codon. qPCR analysis of caveolae-related genes in 2-day post fertilisation (dpf) embryos. Mean±s.d., t-test, *P<0.05, **P<0.01, ***P<0.001.

(M-R) Cav1a immunostaining in 7dpci cav1+/+ (M-O) and cav1cn100 (P-R) hearts.

(S-Y) Cav1 (Cav1 and Cav1b) immunolabelling in 7dpci cav1+/+ (S-U) and cav1cn100 (V-Y) hearts. Dotted lines in P and V mark the valves. Scale bars 100μm in A, D, E, M, P, S, V and 50μm in other panels.

Generation of cav1-KO zebrafish by CRISPR/Cas9 editing

We generated cav1-KO zebrafish to study the role of Cav1 and caveolae in heart homeostasis and regeneration. We used CRISPR/Cas9 editing to target the third exon of cav1, which corresponds to the C-terminal domain (Fig. 1I). The cav1 gene generates two transcripts -cav1a and cav1b- sharing the majority of the coding sequences (Fang et al., 2006). We were able to introduce mutations in the cav1 locus, with the majority of them being small deletions (Fig. 1J). The predicted effect on the protein was an open reading frame shift that would lead to an amino acid change and the generation of a premature stop codon (Fig. 1K). We selected the cav1cn100 mutation (Fig. 1K), which showed significantly decreased cav1 expression, increased cav2 expression, but with no effect on cav3, cavin1b or cavy transcription (Fig. 1L). Mutant embryos had no morphological abnormalities, developed normally and were fertile (data not shown). We next investigated Cav1 expression by labelling 7dpci WT and mutant hearts with an antibody against Cav1a (Fig. 1M-R). The strong Cav1 signal in the epicardium, endocardium, endothelium, bulbus arteriosus and valves (Fig. 1M-O) was lost in cav1cn100 hearts, indicating the loss-of-function nature of the mutation (Fig. 1P-R). We repeated this analysis with an antibody that recognises both Cav1 proteins, Cav1a and Cav1b (Fig. 1S-Y). Normal Cav1 expression in epicardium, endocardium and endothelium (Fig. 1S-U) was absent in mutants (Fig. 1V-Y). Cavin1 is also an essential component of caveolae (Hill et al., 2008) and deletion of Cav1 diminishes Cavin1 expression in mice (Hansen et al., 2013). We therefore asked whether Cavin1 was affected by Cav1 loss (Fig. S1). Examination of 7dpci cav1+/+ cryoinjured hearts revealed strong Cavin1 expression in the epicardium, in cardiomyocytes adjacent to the injured area, in the bulbus arteriosus and in the valves (Fig. S1A-D΄). Cavin1 expression was decreased in cav1cn100 hearts (Fig. S1E-H΄). Specifically, Cavin1 was absent in the valves, whereas its expression was greatly reduced in the bulbus arteriosus (Fig. S1E) and in cardiomyocytes within the proliferative zone (Fig. S1G-G΄). Taken together, these results show that the cav1cn100 mutation leads to the loss of Cav1 and the reduced expression of Cavin1 in cryoinjured hearts.

Loss of caveolae in cav1cn100 mutant hearts

Expression of Cav1 in a system without endogenous Cav1 expression leads to de novo caveolae formation (Fra et al., 1995), whereas deletion of Cav1 results in loss of caveolae (Drab et al., 2001). We analysed cav1+/+ and cav1cn100 hearts by transmission electron microscopy (TEM) to determine whether cav1cn100 mutants could form caveolae (Fig. S2). We found caveolae in abundance in the cav1+/+ hearts (Fig. S2A, A΄, C), and the membrane of the endothelial cells was packed with caveolae-invaginations (Fig. S2A΄, arrowheads). By contrast, cav1cn100 hearts were deprived of caveolae in the coronary vasculature of the cortical layer (Fig. S2B, B΄, C). No membrane-bound caveolae were detected, indicating the complete loss of caveolae in cav1cn100 mutant hearts.

Response of caveolae-depleted hearts to injury

We next examined the effects of caveolae loss for adult heart regeneration. We cryoinjured cav1+/+ and cav1cn100 hearts and allowed them to regenerate for 90 days. We then analysed the hearts by Acid Fuchsin Orange-G (AFOG) staining, which labels both the damaged area and the healthy myocardium. We found that cav1cn100 and cav1cn100/+ hearts regenerated similarly to the cav1+/+ hearts 90dpci (Fig. 2G-J). Cryoinjury results in the formation of a scar tissue that progressively degrades during the course of 90 days (Chablais and Jaźwińska, 2012; González-Rosa et al., 2011; Schnabel et al., 2011). Thus, we monitored the regeneration process by analysing 30 and 60dpci hearts (Fig. 2A-F). cav1cn100 hearts had a similar scar size to that in cav1+/+ controls, both at 30 and 60dpci.

Figure 2.
Figure 2. Heart regeneration is unaffected in cav1cn100 mutants

(A-J) cav1+/+ and cav1cn100 hearts were cryoinjured and harvested 30 (A-C), 60 (D-F), or 90dpci (G-J), and processed for AFOG staining, which labels collagen in blue, fibrin in red and myocardium in brown. Injuries were quantified as a percentage of the damaged tissue (collagen and fibrin) to the total area of the ventricle. 30dpci nWT=ncn100=10; 60dpci nWT=ncn100=10; 90dpci nWT=9, ncn100=12, t-test. Scale bars 250μm.

To further investigate the effect of caveolae loss in heart regeneration, we examined another of our cav1 mutants, cav1cn101. Interestingly, cav1 expression in cav1cn101 mutant embryos was unchanged, whereas cav2 was upregulated (Fig. S3A). In addition, the cav1cn101 mutation had the same effect on protein expression as the cav1cn100 mutation, with loss of Cav1 expression (Fig. S3B-M). Likewise, caveolae were absent in cav1cn101 hearts, similar to our observations for cav1cn100 (Fig. S4). We then cryoinjured cav1+/+ and cav1cn101 hearts and examined the regeneration process every 30 days for 90 days (Fig. S5). cav1cn101 hearts regenerated normally and we did not detect any differences in the size of the injury at 30, 60 or 90dpci.

These results demonstrate that loss of caveolae does not affect heart regeneration. This was unexpected, as it has been reported that ventricular resection in cav1-KO zebrafish results in enhanced fibrosis, leading to the arrest of heart regeneration at 30dpci (Cao et al., 2016). The main difference between the ventricular resection and the cryoinjury models is that the fibrotic scar is minimal in the former, whereas the latter leads to formation of a transient scar tissue. Our data indicate that formation and resolution of the fibrotic tissue scar is unaffected by Cav1 loss. Full regeneration after ventricular resection occurs 60 days post amputation (Poss et al., 2002), and it would be worth to examine heart regeneration at the final time point. In addition, despite our cav1 mutants harbour loss-of-function alleles, similar to those generated by Cao et al., 2016, the possibility of a genetic compensation mechanism (El-Brolosy et al., 2019) cannot be discarded.

Activation of TGFβ signalling and fibrosis are unaffected in cav1cn100 hearts

Caveolae are involved via Cav1 in the regulation of the TGFβ pathway (Razani et al., 2001), a major signalling node that controls extracellular matrix (ECM) deposition, and is activated during zebrafish heart regeneration (Chablais and Jazwinska, 2012). As both cav1cn100 and cav1cn101 hearts regenerated normally, we focused only on cav1cn100. To address TGFβ activity in cav1cn100 hearts upon cryoinjury, we quantified the nuclear localization of phospho-Smad3 (psmad3), a downstream effector of TGFβ (Fig. S6). We used 14dpci Tg(fli1a:GFP) hearts to calculate the proportion of psmad3+ nuclei in endocardial cells within the damaged tissue (Fig. S6A΄, B΄, C) and in the cardiomyocytes surrounding the injured site (Fig. S6A΄΄, B΄΄, D). Analysis revealed that TGFβ signalling was equally active in control and cav1cn100 hearts, in both endocardial cells and cardiomyocytes. Heart cryoinjury in the Cav1-KO mouse leads to extensive collagen deposition and cardiac remodelling (Miyasato et al., 2011). Thus, we exploited the AFOG staining protocol to examine the collagen and fibrin content after injury, and we also measured ventricular size (Fig. S7A, B). We found no differences between cav1+/+ and cav1cn100 hearts, neither in collagen deposition nor in fibrin amount in the injury, nor in the size of the ventricle. Furthermore, because hearts of Cav1-KO mice show increased interstitial fibrosis (Cohen et al., 2003; Drab et al., 2001; Murata et al., 2007; Park et al., 2003), we examined this parameter in intact cav1cn100 hearts using Picrosirius Red to stain collagen fibres. Results showed no difference in interstitial fibrosis between cav1+/+ and cav1cn100 hearts (Fig. S7C-E). Thus, loss of Cav1 and caveolae does not affect TGFβ activity or fibrosis in intact or cryoinjured hearts.

Epicardial, endocardial and cardiomyocyte function in cav1cn100 hearts upon injury

We next examined the behaviour of the different cell types involved in the regeneration process. We first analysed the epicardium and endocardium, where Cav1 is highly expressed 7dpci (Fig. S8). We crossed the Tg(wt1b:GFP) line to cav1cn100 to study epicardial proliferation and we found no difference in epicardial proliferation between cav1+/+ and cavcn100 hearts (Fig. S8A-C).

We then evaluated the abundance of endocardial cells within the damaged tissue by crossing double transgenic fish Tg(fli1a:GFP)/Tg(myl7:mRFP) expressing GFP in endocardial/endothelial cells and RFP in the membrane of cardiomyocytes, with cav1cn100 mutants (Fig. S8D,E). Three-dimensional volume rendering and analysis of the GFP+ cells inside the RFP- area showed that endocardial cells in cav1cn100 hearts populated the injured area similarly to those of cav1+/+hearts (Fig. S8F). These data indicate that epicardial proliferation and migration and proliferation of endocardial cells are unchanged in cav1cn100 hearts.

We then examined cardiomyocyte proliferation, as it has been reported that this feature is affected upon ventricular resection in a cav1-KO zebrafish model (Cao et al., 2016). We analysed the cardiomyocytes adjacent to the injured area 7dpci, because they are highly proliferative (Bednarek et al., 2015). Quantification of BrdU incorporation into cardiomyocytes revealed that proliferation was significantly lower in cav1cn100 hearts than in cav1+/+ hearts (Fig. 3A-C). We confirmed this result in the cav1cn101 animals (Fig. S9). We then addressed the proliferation status of cardiomyocytes at 14dpci (Fig. 3D-F). We found that at this time point, cav1cn100 cardiomyocytes proliferated at the same rate as cav1+/+ cardiomyocytes. These data indicate that loss of caveolae leads to the transient attenuation in cav1cn100 cardiomyocyte proliferation at 7dpci, which is normalised by 14dpci, leading to normal cardiac regeneration at 90dpci.

Figure 3.
Figure 3. Cardiomyocyte proliferation is transiently reduced upon cryoinjury in cav1cn100 hearts

(A-B) Immunolabelling of 7dpci cav1+/+ and cav1cn100 hearts for BrdU, MEF2 (cardiomyocyte nuclei) and MF20 (cardiomyocytes). (A΄-B΄) magnifications of the dashed areas in A and B. (C) Quantification of the BrdU+/MEF2+ nuclei to the total cardiomyocyte number in a 100μm radius around the injured area. nWT=5, ncn100=6, t-test, **P<0.01.

(D-E) Immunolabelling of 14dpci cav1+/+ and cav1cn100 hearts for BrdU, MEF2 and MF20.

(F) Quantification of cardiomyocyte proliferation at 14dpci. nWT=7, ncn100=4. Scale bars: 100μm in A, B, D, E; 10μm in A΄, B΄, D΄, E΄.

Impaired heart function and cardiac elasticity in cav1cn100 mutants

Cav1-deficient mice show decreased systolic function (Cohen et al., 2003; Zhao et al., 2002). Therefore, we analysed heart function in our mutants using ultrasound imaging. Echocardiography of adult cav1+/+ and cav1cn100 animals revealed that cav1cn100 hearts were less efficient in pumping blood than control hearts, as their ejection fraction was significantly lower (Fig. 4A). Additionally, the heart rate of cav1cn100 animals was lower than in control siblings (Fig. 4B). These findings indicate that caveolae are essential for normal cardiac function.

Figure 4.
Figure 4. Impaired cardiac function and stiffer heart tissue in caveolae-deprived cav1cn100 mutants.

(A) Quantification of ejection fraction in cav1+/+ and cav1cn100 hearts. nWT=22, ncn100=20.

(B) Heart rate measurements in cav1+/+ and cav1cn100 animals. nWT=23, ncn100=20. t-test, *P<0.05.

(C) AFM set-up. Arrow indicates the cantilever and the laser beam.

(D-F) The ventricular apex was oriented towards the cantilever and used for taking measurements.

(G) Biomechanical characterization of cav1+/+ and cav1cn100 ventricles as measured by AFM-force spectroscopy and expressed in Young’s moduli. nWT=9, ncn100=8, t-test, ***P<0.001.

(H) Force-distance graph for indentation and retraction of the cantilever over the ventricular surface.

Caveolae provide protection against mechanical stress (Sinha et al., 2011). Because the biomechanical properties of cells influence the behaviour of tissues (Mathur et al., 2001) and caveolae are involved in mechanoprotection, we investigated the mechanical response of cav1+/+ and cav1cn100 cardiac tissue to gain insight into the differences observed in cardiac function. We used AFM to determine the response of adult cav1cn100 hearts to force. Freshly isolated hearts were placed on an agarose gel, with the apex of the ventricle oriented towards the direction of the cantilever, and force measurements were taken (Figure 4C-F). We found that cardiac tissue stiffness was significantly greater in cav1cn100 animals than in control animals (Figure 4G). Applying the same force, the extent of deformation was 1.5 times greater in control hearts than in cav1cn100 hearts, without causing permanent deformation as the curves returned to zero (Figure 4H).

Importantly, the sensitivity of the method revealed that changes in epicardial and cortical myocytes were responsible for the observed difference in stiffness that we detected. Membrane invaginations such as caveolae, provide the necessary stretch capacity for cells to buffer the impact of mechanical forces (Sinha et al., 2011). Hence, the absence of membrane reservoirs, caveolae, due to the loss of the broad and robust expression of Cav1 in the ventricle, results in increased tissue stiffness. As we did not detect cardiac fibrosis, the reduction in cardiac elasticity is a plausible explanation for the cardiac dysfunction in cav1-KO fish.

We have shown that Cav1 is strongly expressed in the epicardium of intact hearts and that its expression is lost in cav1cn100 hearts. Additionally, RNA-seq data show that Cav1 expression is moderate but significantly higher in cortical cardiomyocytes, but significantly higher than in trabecular cardiomyocytes (Sánchez-Iranzo et al., 2018). Caveolae are required for smooth muscle cell contractility (Gosens et al., 2011; Halayko et al., 2008) and cell contraction results in changes to membrane tension that caveolae buffer (Sinha et al., 2011). In addition, Cav1 and caveolae regulate RhoA activation (a GTPase protein that regulates the cytoskeleton), which in turn regulates actomyosin contractility (Budnar et al., 2019; Grande-García et al., 2007; Peng et al., 2007). Accordingly, these data suggest that loss of Cav1 and caveolae impairs cell elasticity and/or contractility and, consequently, pumping efficiency, which could explain the significant reduction in cardiac performance. Cav1 deficiency in the mouse leads to diverse cardiac phenotypes that are attributed to endothelial loss of caveolae. Our results demonstrate that loss of Cav1 and caveolae result in cardiac stiffening accompanied by reduced cardiac function, suggesting that a global change in the mechanical properties of the heart leads to the cardiac phenotypes observed in Cav1-deficiency models.

Material and Methods

Zebrafish husbandry and transgenic lines

Animal studies were approved by the CNIC Animal Experimentation Ethics Committee and by the Community of Madrid (Ref. PROEX 118/15). Animal procedures conformed to EU Directive 2010/63EU and Recommendation 2007/526/EC regarding the protection of animals used for experimental and scientific purposes, enforced in Spanish law under Real Decreto 53/2013. Zebrafish were raised under standard conditions at 28ºC as described (Kimmel et al., 1995). Experiments were performed with 5-14-month-old adults.

CRISPR/Cas9 injections

We used the oligos cav1 Fwd CACCGGTGGGCATCCCACTCGCCC and cav1 Rvs AAACGGGCGAGTGGGATGCCCACC for the generation of cav1-KO zebrafish. The oligos were inserted into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Ann, F et al., 2013; Cong et al., 2013), which was linearised with BbsI enzyme (New England Biolabs, Ipswich, MA). Primers with the T7 polymerase promoter-specific sequences, cav1 T7 Fwd TAATACGACTCACTATAGGTGGGCATCCCA and Rvs AAAAAGCACCGACTCGGTGCCA, were used to amplify the guide RNA, which was injected into one-cell state embryos together with Cas9 protein (New England Biolabs). Mutant animals were identified by PCR using the primers: cav1 Fwd GGCGAGCTTCACCACCTTC and cav1 Rvs GCTCTTCACGCAAGGCACCA.

Adult heart cryoinjury

Fish were anesthetised by immersion in 0.04% tricaine (Sigma-Aldrich, St Louis, MO) in fish water and placed on a wet sponge under a stereoscope with the ventral side exposed. The cardiac cavity was opened using microscissors and microforceps, and the pericardium was removed. The ventricle of the heart was exposed and dried and was then touched by a copper-made probe previously immersed in liquid nitrogen (González-Rosa and Mercader, 2012). The fish were immediately returned to water to recover.

Bromodeoxyuridine injection

Adult fish were anesthetised and placed on a wet sponge under a stereoscope. BrdU was diluted in phosphate-buffered saline (PBS) to 2.5 mg/ml and 30 μl were injected intraperitoneally.

Echocardiography

Analysis of cardiac function by echocardiography in adult fish was performed as described (González-Rosa et al., 2014). Briefly, the fish were anesthetised by immersion in 60 mM tricaine and 3 mM isoflurane in fish water and transferred to a sponge immersed in the same solution. Images were acquired using the VEVO 2100 system (VisualSonics Inc., Toronto, ON, Canada) with a 50-MHz ultrasound probe. The transductor was immersed in the medium dorsally to the cardiac cavity. The fish were immediately transferred to fresh water to recover after the procedure.

Histological stains

Acid Fuchsin Orange G-staining (AFOG) and Picrosirius Red staining were performed following standard protocols (Poss et al., 2002).

Immunofluorescence

Sections of paraffin-embedded tissue were permeabilised with PBT (PBS with 0.01% TritonX-100) and washed with PBS before incubation with blocking solution (2% bovine serum albumin, 10% goat serum and 2 mM MgCl2 in PBS). Sections were then incubated overnight at 4ºC with the following primary antibodies: Caveolin-1 (BD Transduction Laboratories, San Jose, CA; or Cell Signalling Technology, Danvers MA), PTRF/Cavin1 (Atlas Antibodies AB, Stockholm, Sweden), GFP (Aves Labs, Tigard, OR), MEF-2 (Santa Cruz Biotechnology, Santa Cruz, CA), tropomyosin, MF20 (both from DSHB, Iowa City, IA), phosho-Smad3 (Abcam, Cambridge, MA) and BrdU (BD Transduction Laboratories) The following day, sections were incubated with the appropriate secondary antibody and mounted after DAPI staining.

Whole-mount confocal imaging

Analysis of endogenous fluorescence of whole-mount hearts was performed as described (Münch et al., 2017). Briefly, hearts were fixed overnight with 2% paraformaldehyde and after several PBS washes the tissues were immersed in 3% agarose. Samples were then incubated in CUBIC I solution (Susaki et al., 2014) at 37ºC for one week. Agarose blocks containing the hearts were mounted for imaging on a petri dish and approximately 700μm of the injured ventricle was scanned on a Leica SP8 confocal microscope (Leica Microsystems, Wetzler, Germany) using a 10× objective.

Electron microscopy

Hearts were fixed in 1% glutaraldehyde/4% paraformaldehyde in PBS overnight. Samples were post-fixed in 1% osmium tetroxide for 60 min and dehydrated through a series of ethanol solutions (30%, 50%, 70%, 95%, 100%) and acetone. After the last dehydration step, samples were incubated in a 1:3, 1:1, 3:1 mixture of DURCUPAN resin and acetone and cured at 60ºC for 48 hours. Ultrathin sections (50-60nm) were obtained using a diamond knife (Diatome AG, Biel, Switzerland) in a ultramicrotome (Leica Reichert ultracut S. Leica Microsystems) and collected in 200-mesh copper grids. The sections were counterstained with 2% uranyl acetate in water for 20 min followed by a lead citrate solution. Sections were examined with a JEOL JEM1010 electron microscope (Tokyo, Japan) equipped with an Orius SC200 digital camera (Gatan Inc., Pleasanton, CA).

Image analysis and quantification

To analyse cardiomyocyte proliferation, MEF2-positive nuclei were counted in an area of 100μm around the injury site using Fiji (ImageJ, NIH). BrdU-MEF2-positive cells were also counted and the % proliferation index was expressed as the MEF2:BrdU-MEF2 ratio. For TGFβ signalling activation, all phospho-smad3-positive cardiomyocyte (100μm of the injury) or GFP-positive cells (inside the injured area) were counted and normalised to the total number of cardiomyocytes or GFP-positive cells. To quantify the regeneration process, the injured area (fibrotic tissue and collagen) was measured using Fiji and expressed as a percentage of the total ventricular area. For tissue sections, at least three sections per sample were used for measurements. The 3D analysis of the whole-mount hearts was carried out using Fiji and IMARIS programmes. The volume of the GFP signal inside the injured area (RFP negative) was also measured and presented in relation to the volume of the injury. Electron microscopy images of the plasma membrane of coronary endothelial cells were taken at 50,000× magnification. Uncoated membrane invaginations of 40-90nm size were counted (Lim et al., 2017) and expressed as density per μm2 of the perinuclear area. Two endothelial cells per three sections of the same heart were examined. Fiji was used to calculate the perinuclear area and for caveolae identification.

Atomic force microscopy (AFM)-force spectroscopy

Adult zebrafish were sacrificed by immersion in 0.16% tricaine and the heart was dissected. The atrium was removed and the ventricle was placed horizontally atop a 4% agarose gel immersed in PBS with 0.1M KCl to arrest the heartbeat uniformly. AFM-force spectroscopy experiments were performed with a JPK Nanowizard III microscope (JPK Instruments, Berlin, Germany) coupled with an inverted optical microscope (AXIO Observer D1; Carl Zeiss, Germany) and equipped with Plateau-CONT-SPL cantilevers (Nanosensors, Neuchatel, Switzerland), with a nominal spring constant of 0.02-0.77 N/m and a spherical tip shape (R = 30 μm). The actual spring constant of the cantilever was determined using the thermal noise method as implemented in the AFM software. Force-distance curves (FDC) were acquired to determine Young’s modulus of the zebrafish heart apex. The tip-sample distance was modulated by applying a triangular waveform (Garcia et al., 2017b). The tip velocity was set to 10 μm/s and the amplitude to 15μm. The maximum force exerted on the heart apex during a single FDC was of 11 nN. For each zebrafish heart, a complete sequence of 375 FDC was performed. These FDC were distributed in three different areas of 100×100 μm2 several hundreds of microns apart. In each area, 125 FDC were measured (all along the zebrafish apex). To determine the contact point, we used a ratio of variances protocol. Young’s modulus was obtained by fitting a section of the force-distance curve (approach semi-cycle of the whole FDC) with a Hertz model for spherical indenters.

Quantitative RT-PCR

Three-to-five biological replicates with three technical replicates of each sample were used for the expression analysis of genes by qPCR using the power SYBR Green Master Mix (Applied Biosystems, Foster City, CA) and the ABI PRISM 7900HT FAST Real-Time PCR System. All measurements were normalised to the expression of 18s (McCurley and Callard, 2008). The following primers were used for the qPCR analysis: 18s Fwd TCGCTAGTTGGCATCGTTTATG, 18s Rvs CGGAGGTTCGAAGACGATCA, cav1 Fwd TGGGATGGGGGAATGGAAAC, cav1 Rvs TAAACGGCGAGTGAGCGTAT, cav2 Fwd GCGTTTATTGCAGGGATTGT, cav2 Rvs GGATCACTGGCATCACCAC, cav3 Fwd CAACGAAGATGTCGTGAAGG, cav3 Rvs GAGACGGTGAAGGTGGTGTAA, and for cavin1b and cavy form (Lim et al., 2017).

Statistical analysis

Sample sizes, statistical tests and P-values are specified in the figure legends and were determined with GraphPad Prism software (GraphPad Software Inc., San Diego, CA).

COMPETING INTERESTS

No competing interests declared

FUNDING

This work was supported by grants SAF2016-78370-R, CB16/11/00399 (CIBER CV), MAT2016-76507-R and RD16/0011/0021 (TERCEL) from the Spanish Ministry of Science, Innovation and Universities (MCIU) and grants from the Fundación BBVA (Ref.: BIO14_298), Fundación La Marató (Ref.: 20153431), Comunidad de Madrid (Ref. S2018/NMT-4443, Tec4Bio, European Research Council (ERC-AdG-340177) and CardioNeT (Ref.: 28600) from the European Commission to J.L.d.l.P. and R. G. D.G. held a PhD fellowship linked to grant CardioNeT (Ref.: 28600). The cost of this publication was supported in part with funds from the European Regional Development Fund. The CNIC is supported by the Instituto de Salud Carlos III (ISCIII), the MCIU and the Pro CNIC Foundation, and is a Severo Ochoa Centre of Excellence (SEV-2015-0505).

Figure S1. Cavin1b expression incav1cn100 hearts

Immunostaining of Cavin1 in 7dpci cav1+/+ (A-D΄) and cav1cn100 (E-H΄) Tg(wt1b:GFP) hearts. (B) Magnification of selected area in A. (C-D΄) Magnifications of the dashed areas in B. (F) Magnification of selected area in E. (G-H΄) Magnifications of the dashed areas in F. (A, E) Dashed lines=valves. Scale bars 100μm in A, B, E, F; 50μm in other panels.

Figure S2. Loss of caveolae incav1cn100 hearts

TEM images of cav1+/+ (A, A΄) and cav1cn100 (B, B΄) endothelium. (A΄, B΄) Higher magnification of the dashed areas in A and B. Arrowheads indicate membrane-bound caveolae. Scale bars: 1μm in A, B; 0.5μm in A΄, B΄.

(C) Caveolae number per μm2 of endothelial cell. nWT=ncn100=4, t-test, **P<0.01.

Figure S3. qPCR and Cav1 expression analysis incav1cn101 mutants

(A)Relative expression of caveolae-related genes by qPCR in cav1cn101 embryos. Mean±s.d. t-test, ***P<0.001.

(B-M) Cav1a (B-G) or Cav1 (H-M) immunostaining of 7dpci cav1+/+ and cav1cn101 hearts. Scale bars 100μm B, E, H, K and 50μm in other panels.

Figure S4. Caveolae loss incav1cn101 hearts

(A-B΄) Coronary vasculature of the cortical layer in cav1+/+ and cav1cn101 hearts. A΄ and B΄ higher magnifications of the dashed areas in A and B; arrowheads indicate membrane-bound caveolae. Scale bars: 1μm in A, B, and 0.5μm in A΄ and B΄.

Quantification of caveolae number per μm2 of coronary endothelium. nWT=ncn100=4, Mean±s.d., t-test, ****P<0.0001.

Figure S5. Heart regeneration is unaffected incav1cn101 mutants

(A-J) AFOG staining and quantification in cav1+/+ and cav1cn101 hearts after 30 (A-C), 60 (D-F) and 90dpci (G-J). Collagen in blue, fibrin in red and myocardium in brown. The damaged area was quantified as the percentage of the collagen/fibrin area to the total ventricular area. 30dpci nWT=9, ncn100=7; 60dpci nWT=8, ncn100=7; 90dpci nWT=7, ncn100=11. Mean±s.d., t-test. Scale bars: 200μm.

Figure S6. TGFβ signalling activation is unaffected in regeneratingcav1cn100 hearts

(A-B) 14dpci cav1+/+ and cav1cn100 Tg(fli1a:GFP) hearts labelled for psmad3, GFP and MF20 (cardiomyocytes). (A΄, B΄) Magnification of GFP+ endocardial cells marked in A, B. (A΄΄, B΄΄) Higher magnifications of cardiomyocytes marked in A, B. (C) Quantification of the psmad3+/GFP+ in the injured area. t-test. nWT=7, ncn100=4. (D) Percentage of cardiomyocytes with psmad3+ nuclei in a 100μm area surrounding the damaged tissue. t-test, nWT=7, ncn100=4. Scale bars: 100μm A, B; 25μm in other panels.

Figure S7. Analysis of collagen and fibrin of the injured area, ventricular size and interstitial fibrosis ofcav1cn100 hearts

(A)Percentages of the collagen and fibrin of the injury 30-, 60- and 90dpci in cav1+/+ and cav1cn100 hearts. Two-way ANOVA. nWT 30-, 60-, 90dpci = 10, 9, 9; ncn100 30-, 60-, 90dpci = 10, 10, 12.

(B)Ventricular size of all hearts analysed by AFOG staining. t-test. nWT=29; ncn100=32.

(C-D) Picrosirius Red staining in control cav1+/+ and cav1cn100 hearts. Scale bar 250μm.

(E) Quantification of the red-labelled fibres in the ventricle. t-test, nWT=5, ncn100=6.

Figure S8. Normal epicardial proliferation and endocardial cell function incav1cn100 hearts after injury

(A-B) Immunostaining of 7dpci Tg(wt1b:GFP) heart sections labelled for BrdU and GFP.

(C) Percentage of proliferating epicardial GFP+ cells. nWT=5, ncn100=6. Scale bar 100μm.

(D-E) 3D volume rendering of the apical injured site of 7dpci Tg(fli1a:GFP)/Tg(myl7:mRFP) hearts. Yellow lines indicate the injured area and heart cartoon the x/y/z axes.

(F) Quantification of the volume of GFP+ cells inside the RFP- area. t-test, nWT=3, ncn100=4. Scale bar 300μm.

Figure S9.cav1cn101 cardiomyocyte proliferation upon injury

(A-B΄) Immunolabelling of 7dpci cav1+/+ and cav1cn101 hearts for BrdU, MEF2 and MF20. (A΄-B΄) Higher magnifications of the dashed areas in A and B. Scale bars: 100μm in A, B; 20μm in A΄, B΄.

(C) Percentage of the BrdU+ cardiomyocytes to the total number of cardiomyocytes in a 100μm area surrounding the damaged tissue. nWT=4, ncn100=3. t-test, *P<0.05.

ACKNOWLEDGMENTS

We thank E. Dı́az at the CNIC animal facility for fish husbandry; B. Rios, V. García, L. Méndez for technical support; the CNIC Microscopy Unit for help; A.Vanesa Alonso and L. Flores for support with the echocardiographic experiment; F. Urbano and C. Aguado for support and help with the TEM.

Footnotes

  • Summary statement We have generated cav1-KO zebrafish strains that lack caveolae. We found that cardiac function is impaired and that the stiffness of epicardial cells and cortical myocardium is increased.

References

  1. ↵
    Ann, F. R., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A. and Zhang, F.(2013). Genome engineering using the CRISPR-Cas9. Nat Protoc.
  2. ↵
    Bednarek, D., González-Rosa, J. M., Guzmán-Martínez, G., Gutiérrez-Gutiérrez, Ó., Aguado, T., Sánchez-Ferrer, C., Marques, I. J., Galardi-Castilla, M., de Diego, I., Gómez, M. J.,et al.(2015). Telomerase Is Essential for Zebrafish Heart Regeneration. Cell Rep.
  3. ↵
    Budnar, S., Husain, K. B., Gomez, G. A., Naghibosadat, M., Varma, A., Verma, S., Hamilton, N. A., Morris, R. G. and Yap, A. S.(2019). Anillin Promotes Cell Contractility by Cyclic Resetting of RhoA Residence Kinetics. Dev. Cell.
  4. ↵
    Cao, J., Navis, A., Cox, B. D., Dickson, A. L., Gemberling, M., Karra, R., Bagnat, M. and Poss, K. D.(2016). Single epicardial cell transcriptome sequencing identifies Caveolin 1 as an essential factor in zebrafish heart regeneration. Development.
  5. ↵
    Chablais, F. and Jazwinska, A.(2012). The regenerative capacity of the zebrafish heart is dependent on TGF signaling. Development.
  6. ↵
    Chablais, F. and Jaźwińska, A.(2012). Induction of myocardial infarction in adult zebrafish using cryoinjury. J. Vis. Exp.
  7. ↵
    Cheng, J. P. X., Mendoza-Topaz, C., Howard, G., Chadwick, J., Shvets, E., Cowburn, A. S., Dunmore, B. J., Crosby, A., Morrell, N. W. and Nichols, B. J.(2015). Caveolae protect endothelial cells from membrane rupture during increased cardiac output. J. Cell Biol.
  8. ↵
    Cohen, A. W., Park, D. S., Woodman, S. E., Williams, T. M., Chandra, M., Shirani, J., De Souza, A. P., Kitsis, R. N., Russell, R. G., Weiss, L. M., et al.(2003). Caveolin-1 null mice develop cardiac hypertrophy with hyperactivation of p42/44 MAP kinase in cardiac fibroblasts. Am. J. Physiol. - Cell Physiol. 284,.
  9. ↵
    Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al.(2013). Multiplex genome engineering using CRISPR/Cas systems. Science (80-.).
  10. ↵
    Drab, M., Verkade, P., Elger, M., Kasper, M., Lohn, M., Lauterbach, B., Menne, J., Lindschau, C., Mende, F., Luft, F. C., et al.(2001). Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science (80-.).
  11. ↵
    Dufrêne, Y. F., Ando, T., Garcia, R., Alsteens, D., Martinez-Martin, D., Engel, A., Gerber, C. and Müller, D. J.(2017). Imaging modes of atomic force microscopy for application in molecular and cell biology. Nat. Nanotechnol.
  12. ↵
    El-Brolosy, M. A., Kontarakis, Z., Rossi, A., Kuenne, C., Günther, S., Fukuda, N., Kikhi, K., Boezio, G. L. M., Takacs, C. M., Lai, S. L., et al.(2019). Genetic compensation triggered by mutant mRNA degradation. Nature.
  13. ↵
    Fang, P. K., Solomon, K. R., Zhuang, L., Qi, M., McKee, M., Freeman, M. R. and Yelick, P. C.(2006). Caveolin-1α and-1β perform nonredundant roles in early vertebrate development. Am. J. Pathol.
  14. ↵
    Fra, A. M., Williamson, E., Simons, K. and Parton, R. G.(1995). De novo formation of caveolae in lymphocytes by expression of VIP21-caveolin. Proc. Natl. Acad. Sci.
  15. Frischmeyer, P. A., Van Hoof, A., O’Donnell, K., Guerrerio, A. L., Parker, R. and Dietz, H. C.(2002). An mRNA surveillance mechanism that eliminates transcripts lacking termination codons. Science (80-.).
  16. ↵
    Garcia, J., Bagwell, J., Njaine, B., Norman, J., Levic, D. S., Wopat, S., Miller, S. E., Liu, X., Locasale, J. W., Stainier, D. Y. R., et al.(2017a). Sheath Cell Invasion and Trans-differentiation Repair Mechanical Damage Caused by Loss of Caveolae in the Zebrafish Notochord. Curr. Biol.
  17. ↵
    Garcia, P. D., Guerrero, C. R. and Garcia, R.(2017b). Time-resolved nanomechanics of a single cell under the depolymerization of the cytoskeleton. Nanoscale.
  18. ↵
    González-Rosa, J. M. and Mercader, N.(2012). Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nat. Protoc.
  19. ↵
    González-Rosa, J. M., Martín, V., Peralta, M., Torres, M. and Mercader, N.(2011). Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development.
  20. ↵
    González-Rosa, J. M., Peralta, M. and Mercader, N.(2012). Pan-epicardial lineage tracing reveals that epicardium derived cells give rise to myofibroblasts and perivascular cells during zebrafish heart regeneration. Dev. Biol.
  21. ↵
    González-Rosa, J. M., Guzmán-Martínez, G., Marques, I. J., Sánchez-Iranzo, H., Jiménez-Borreguero, L. J. and Mercader, N.(2014). Use of echocardiography reveals reestablishment of ventricular pumping efficiency and partial ventricular wall motion recovery upon ventricular cryoinjury in the Zebrafish. PLoS One.
  22. ↵
    Gosens, R., Stelmack, G. L., Bos, S. T., Dueck, G., Mutawe, M. M., Schaafsma, D., Unruh, H., Gerthoffer, W. T., Zaagsma, J., Meurs, H., et al.(2011). Caveolin-1 is required for contractile phenotype expression by airway smooth muscle cells. J. Cell. Mol. Med.
  23. ↵
    Grande-García, A., Echarri, A., De Rooij, J., Alderson, N. B., Waterman-Storer, C. M., Valdivielso, J. M. and Del Pozo, M. A.(2007). Caveolin-1 regulates cell polarization and directional migration through Src kinase and Rho GTPases. J. Cell Biol.
  24. ↵
    Halayko, A. J., Tran, T. and Gosens, R.(2008). Phenotype and functional plasticity of airway smooth muscle: Role of caveolae and caveolins. Proc. Am. Thorac. Soc.
  25. ↵
    Hansen, C. G., Shvets, E., Howard, G., Riento, K. and Nichols, B. J.(2013). Deletion of cavin genes reveals tissue-specific mechanisms for morphogenesis of endothelial caveolae. Nat. Commun.
  26. ↵
    Hill, M. M., Bastiani, M., Luetterforst, R., Kirkham, M., Kirkham, A., Nixon, S. J., Walser, P., Abankwa, D., Oorschot, V. M. J., Martin, S., et al.(2008). PTRF-Cavin, a Conserved Cytoplasmic Protein Required for Caveola Formation and Function. Cell.
  27. ↵
    Jasmin, J. F., Rengo, G., Lymperopoulos, A., Gupta, R., Eaton, G. J., Quann, K., Gonzales, D. M., Mercier, I., Koch, W. J. and Lisanti, M. P.(2011). Caveolin-1 deficiency exacerbates cardiac dysfunction and reduces survival in mice with myocardial infarction. Am. J. Physiol. - Hear. Circ. Physiol.
  28. ↵
    Kikuchi, K., Holdway, J. E., Major, R. J., Blum, N., Dahn, R. D., Begemann, G. and Poss, K. D.(2011). Retinoic Acid Production by Endocardium and Epicardium Is an Injury Response Essential for Zebrafish Heart Regeneration. Dev. Cell.
  29. ↵
    Kim, C. A., Delépine, M., Boutet, E., El Mourabit, H., Le Lay, S., Meier, M., Nemani, M., Bridel, E., Leite, C. C., Bertola, D. R., et al.(2008). Association of a homozygous nonsense caveolin-1 mutation with berardinelli-seip congenital lipodystrophy. J. Clin. Endocrinol. Metab.
  30. ↵
    Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.(1995). Stages of embryonic development of the zebrafish. Dev. Dyn.
  31. ↵
    Lawson, N. D. and Weinstein, B. M.(2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol.
  32. ↵
    Lim, Y. W., Lo, H. P., Ferguson, C., Martel, N., Giacomotto, J., Gomez, G. A., Yap, A. S., Hall, T. E. and Parton, R. G.(2017). Caveolae Protect Notochord Cells against Catastrophic Mechanical Failure during Development. Curr. Biol.
  33. ↵
    Liu, L., Brown, D., McKee, M., LeBrasseur, N. K., Yang, D., Albrecht, K. H., Ravid, and Pilch, P. F.(2008). Deletion of Cavin/PTRF Causes Global Loss of Caveolae, Dyslipidemia, and Glucose Intolerance. Cell Metab.
  34. ↵
    Lo, H. P., Nixon, S. J., Hall, T. E., Cowling, B. S., Ferguson, C., Morgan, G. P., Schieber, N. L., Fernandez-Rojo, M. A., Bastiani, M., Floetenmeyer, M., et al.(2015). The caveolin-Cavin system plays a conserved and critical role in mechanoprotection of skeletal muscle. J. Cell Biol.
  35. ↵
    Marín-Juez, R., Marass, M., Gauvrit, S., Rossi, A., Lai, S. L., Materna, S. C., Black, B. and Stainier, D. Y. R.(2016). Fast revascularization of the injured area is essential to support zebrafish heart regeneration. Proc. Natl. Acad. Sci. U. S. A.
  36. ↵
    Mathur, A. B., Collinsworth, A. M., Reichert, W. M., Kraus, W. E. and Truskey, G. A.(2001). Endothelial, cardiac muscle and skeletal muscle exhibit different viscous and elastic properties as determined by atomic force microscopy. J. Biomech.
  37. ↵
    Miyasato, S. K., Loeffler, J., Shohet, R., Zhang, J., Lindsey, M. and Le Saux, C. J. (2011). Caveolin-1 modulates TGF-β1 signaling in cardiac remodeling. Matrix Biol.
  38. ↵
    Münch, J., Grivas, D., González-Rajal, Á., Torregrosa-Carrión, R. and de la Pompa, J. L. (2017). Notch signalling restricts inflammation and Serpine1 expression in the dynamic endocardium of the regenerating zebrafish heart.Dev.
  39. ↵
    Murata, T., Lin, M. I., Huang, Y., Yu, J., Bauer, P. M., Giordano, F. J. and Sessa, W. C.(2007). Reexpression of caveolin-1 in endothelium rescues the vascular, cardiac, and pulmonary defects in global caveolin-1 knockout mice. J. Exp. Med.
  40. ↵
    Park, D. S., Cohen, A. W., Frank, P. G., Razani, B., Lee, H., Williams, T. M., Chandra, M., Shirani, J., De Souza, A. P., Tang, B., et al.(2003). Caveolin-1 Null (-/-) Mice Show Dramatic Reductions in Life Span. Biochemistry.
  41. ↵
    Patel, H. H., Tsutsumi, Y. M., Head, B. P., Niesman, I. R., Jennings, M., Horikawa, Y., Huang, D., Moreno, A. L., Patel, P. M., Insel, P. A., et al.(2007). Mechanisms of cardiac protection from ischemia/reperfusion injury: A role for caveolae and caveolin-1.FASEB J.
  42. ↵
    Peng, F., Wu, D., Ingram, A. J., Zhang, B., Gao, B. and Krepinsky, J. C.(2007). RhoA activation in mesangial cells by mechanical strain depends on caveolae and caveolin-1 interaction. J. Am. Soc. Nephrol.
  43. ↵
    Poss, K. D., Wilson, L. G. and Keating, M. T.(2002). Heart regeneration in zebrafish. Science (80-.).
  44. ↵
    Razani, B., Zhang, X. L., Bitzer, M., Von Gersdorff, G., Böttinger, E. P. and Lisanti, M. P.(2001). Caveolin-1 Regulates Transforming Growth Factor (TGF)-β/SMAD Signaling through an Interaction with the TGF-β Type I Receptor. J. Biol. Chem.
  45. ↵
    Robenek, H., Weissen-Plenz, G. and Severs, N. J.(2008). Freeze-fracture replica immunolabelling reveals caveolin-1 in the human cardiomyocyte plasma membrane. J Cell Mol Med.
  46. ↵
    Sánchez-Iranzo, H., Galardi-Castilla, M., Minguillón, C., Sanz-Morejón, A., González-Rosa, J. M., Felker, A., Ernst, A., Guzmán-Martínez, G., Mosimann, C. and Mercader, N.(2018). Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nat. Commun.
  47. ↵
    Scherer, P. E., Lewis, R. Y., Volonté, D., Engelman, J. A., Galbiati, F., Couet, J., Kohtz, D. S., Van Donselaar, E., Peters, P. and Lisanti, M. P.(1997). Cell-type and tissue-specific expression of caveolin-2. Caveolins 1 and 2 co-localize and form a stable hetero-oligomeric complex in vivo. J. Biol. Chem.
  48. ↵
    Schnabel, K., Wu, C. C., Kurth, T. and Weidinger, G.(2011). Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One.
  49. ↵
    Shivshankar, P., Halade, G. V., Calhoun, C., Escobar, G. P., Mehr, A. J., Jimenez, F., Martinez, C., Bhatnagar, H., Mjaatvedt, C. H., Lindsey, M. L., et al.(2014). Caveolin-1 deletion exacerbates cardiac interstitial fibrosis by promoting M2 macrophage activation in mice after myocardial infarction. Curr. Ther. Res. - Clin. Exp.
  50. ↵
    Sinha, B., Köster, D., Ruez, R., Gonnord, P., Bastiani, M., Abankwa, D., Stan, R. V., Butler-Browne, G., Vedie, B., Johannes, L., et al.(2011). Cells respond to mechanical stress by rapid disassembly of caveolae. Cell.
  51. ↵
    Susaki, E. A., Tainaka, K., Perrin, D., Kishino, F., Tawara, T., Watanabe, T. M., Yokoyama, C., Onoe, H., Eguchi, M., Yamaguchi, S., et al.(2014). Whole-brain imaging with single-cell resolution using chemical cocktails and computational analysis. Cell.
  52. Wang, J., Panáková, D., Kikuchi, K., Holdway, J. E., Gemberling, M., Burris, J. S., Singh, S. P., Dickson, A. L., Lin, Y.-F., Sabeh, M. K., et al.(2011). The regenerative capacity of zebrafish reverses cardiac failure caused by genetic cardiomyocyte depletion. Development.
  53. ↵
    Wunderlich, C., Schober, K., Lange, S. A., Drab, M., Braun-Dullaeus, R. C., Kasper, M., Schwencke, C., Schmeisser, A. and Strasser, R. H.(2006). Disruption of caveolin-1 leads to enhanced nitrosative stress and severe systolic and diastolic heart failure. Biochem. Biophys. Res. Commun.
  54. ↵
    Zhao, Y.-Y., Liu, Y., Stan, R.-V., Fan, L., Gu, Y., Dalton, N., Chu, P.-H., Peterson, K., Ross, J. and Chien, K. R. (2002). Defects in caveolin-1 cause dilated cardiomyopathy and pulmonary hypertension in knockout mice. Proc. Natl. Acad. Sci.
Back to top
Posted January 16, 2020.
Download PDF
Email
Loss of Caveolin-1 and caveolae leads to increased cardiac cell stiffness and functional decline of the adult zebrafish heart
Dimitrios Grivas, Álvaro González-Rajal, Carlos Guerrero Rodríguez, Ricardo Garcia, José Luis de la Pompa
bioRxiv 2020.01.16.909267; doi: https://doi.org/10.1101/2020.01.16.909267
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools

Subject Area