New Results

RAD50 promotes DNA repair by homologous recombination and restrains antigenic variation in African trypanosomes

Ann-Kathrin Mehnert, Marco Prorocic, Annick Dujeancourt-Henry, Sebastian Hutchinson, Richard McCulloch, Lucy Glover
doi: https://doi.org/10.1101/2020.03.17.994905

ABSTRACT

Homologous recombination dominates as the major form of DNA repair in Trypanosoma brucei, and is especially important for recombination of the subtelomeric variant surface glycoprotein during antigenic variation. RAD50, a component of the MRN complex (MRE11, RAD50, NBS1), is central to homologous recombination through facilitating resection and governing the DNA damage response. The function of RAD50 in trypanosomes is untested. Here we report that RAD50 is required for RAD51-dependent homologous recombination, phosphorylation of histone H2A and controlled resection following a DNA double strand break (DSB). Perhaps surprisingly, DSB resection in the rad50 nulls was not impaired and appeared to peak earlier than in the parental strains. Finally, we show that RAD50 suppresses DNA repair using donors with short stretches of homology at a subtelomeric locus, with null strains producing a greater diversity of expressed VSG variants following DSB repair. We conclude that RAD50 promotes stringent homologous recombination at subtelomeric loci and restrains antigenic variation.

INTRODUCTION

Trypanosoma brucei (T. brucei) is a protozoan parasite and the causative agent of human African trypanosomiasis, or sleeping sickness, and nagana in cattle. Trypanosomes cycle between their insect vector, the tsetse fly, and mammalian hosts, where they colonise the blood, fat1 and skin2 and eventually cross the blood brain barrier in late stage infection. If left untreated, trypanosomiasis is normally fatal3. In the mammalian host, each trypanosome cell is covered in a dense layer of a single species of variant surface glycoprotein (VSG). The highly immunogenic VSG layer4,5 acts as an barrier, concealing other surface components from the host immune response 6. Trypanosomes maintain a persistent infection by continuously escaping the host’s immune response though antigenic variation7. Central to this survival strategy is monoallelic expression of the VSG from a subtelomeric locus, known as an expression site (VSG-ES), and stochastic VSG switching. The ~ 15 VSG-ESs in the trypanosome genome share a high degree of sequence and structure conservation 8, each being an RNA polymerase-I (RNA Pol-I) polycistronic transcription unit with a single VSG gene found adjacent to the telomere, up to 60 kb downstream of the promoter 8. The VSG gene is flanked by two sets of repetitive sequence:downstream is the telomere, and upstream is a block of repetitive sequence, known as the 70-bp repeats, which modulates VSG switching 8,9. Characteristic of a trypanosome infection are recrudescent waves of parasitemia, each of which is composed of a diverse VSG expressing population, with between 7 - 79 VSGs detected in each peak of parasitemia 10–12. VSG diversity arises through altering the single VSG-ES that is transcribed or, more commonly, by recombination of silent VSGs into the active VSG-ES. The seemingly unrestricted use of VSG genes might be expected to result in a rapid exhaustion of the VSG gene repertoire. However, the parasite’s ability to sustain an infection appears to lie in an enormous repertoire of >2000 VSG genes and pseudogenes13–15, mainly found in subtelomeric VSG arrays, and a capacity for generation of novel ‘mosaic’ VSG genes through segmental gene conversion of multiple (pseudo) VSGs, in particular late in infection 10,11,14. Importantly, almost all of the array VSGs are associated with upstream tracts of 70-bp repeats, providing the necessary substrate needed for homologous recombination mediated antigenic variation 16.

A DNA double-strand break (DSB) is an extremely toxic lesion in any cell, which if left unrepaired can lead to cell death. In T. brucei RAD51-dependent homologous recombination (HR) dominates as the major DNA repair and recombination pathway, with microhomology mediated end-joining (MMEJ) playing a minor role17–20. HR is important for VSG switching, and though it is not clear how MMEJ acts in this reaction, repair of induced DSBs can occur by coupled HR and MMEJ, and MMEJ is more frequently used for repair of DSBs induced within the VSG-ES21. Unrepaired DSBs appear to persist throughout the cell cycle without inhibiting the trypanosomes ability to replicate their DNA22, but whether HR or MMEJ are regulated is unknown. In addition, non-homologous end-joining (NHEJ) appears to be absent in trypanosomes21,23,24. These features of trypanosome DSB repair contrast with mammalian cells, where NHEJ is highly active, HR predominates in S and G2 phase cells and MMEJ is considered a minor reaction25. In trypanosomes both transcriptionally active and silent subtelomeres are fragile 26,27, and accumulate natural breaks. Within the active VSG-ES specifically, a DSB between the VSG and 70-bp repeats acts as a potent driver of antigenic variation and precipitates VSG switching27. Several DNA repair and recombination proteins have been shown to be important for antigenic variation in trypanosomes, thus linking VSG switching with this process:loss of RAD5118, the RAD51-3 paralogue28, or the RAD51-interacting protein BRCA2 29,30 results in impaired VSG switching, while loss of RECQ231, TOPO3α or RMI1 increases VSG switching32,33, as does loss of the histone variants H3.V and H4.V15. Loss of ATR, which is involved in DNA damage signalling, impairs monoallelic VSG expression and increases VSG switching through localized DNA damage34. Histone Acetyltransferase (HAT3) is required for recombination repair of a chromosome-internal DSB, but suppresses DSB repair within the VSG-ES which suggests repair is compartmentalised in trypanosomes35.

The DNA damage response (DDR) is an orchestrated cellular response to many different genome lesions, including DSBs, which most commonly form via stalled replication forks 36. Critical to DSB repair is the MRE11 - RAD50 - NBS1 (MRN) complex (in yeast MRE11 – RAD50 – XRS1, MRX), which acts as a DNA damage sensing complex and is responsible for recognizing the free DNA ends, where it is one of the first complexes to bind and initiate HR 37,38. MRE11 – RAD50 forms the core of this complex and is conserved across all domains of life, whereas NBS1 only forms part of the complex in eukaryotes 37. MRN consists of two molecules of each component protein, and diffuses along homoduplex DNA searching for free DNA ends – a process that is driven by RAD50 39. The MRE11 subunit is a nuclease with both 5’ flap endonuclease activity and 3’⟶ 5’ exonuclease activity and catalyses resection through cleaving the 5’ strand, internal to the DSB, which is then resected using its exonuclease function to generate the short 3’ single-strand (ss) DNA overhangs 40. These overhangs are further resected by Exonuclease 1 (EXO1), forming long tracts of 3 ssDNA on either side of the DSB 39. NBS1, the eukaryote specific component, is responsible for binding multiple phosphorylated proteins and recruiting MRE11 and RAD50 to DSB sites 41 through its interaction with MRE11, CtIP, which is also required for initiating resection, and the ATM kinase 42. End recognition and DSB processing by MRN is an ATP dependent process:here, ATP binding to RAD50 acts to switch the complex from an open to a closed conformation 43, which facilitates DSB recognition, tethering and ATM activation 43. In yeast the MRX complex also acts in telomere maintenance by binding the end of short telomeres and recruiting TEL1, which then recruits telomerase to extend the telomere 44. Conversely, in mammalian cells, MRN regulates an ATM dependent response at dysfunctional telomeres 45.

RAD50 (Tb.927.11.8210), MRE11 (Tb927.2.4390) 46,47 and NBS1 (Tb 927.8.5710) homologues are present in the trypanosome genome and previous studies have shown that MRE11 is required for HR but its inactivation did not lead to telomere shortening or changes in VSG switching 46,47, despite the dominance of HR in repair in trypanosomes and requirement for the reaction in antigenic variation. What roles these proteins play in the trypanosome DDR is largely unexplored. In addition, though we know that DSBs accumulate at the subtelomeres 26,27, it is unclear how they are sensed or how they contribute to antigenic variation. Given the central, early role of the MRN complex in DSB recognition and in telomere maintenance we set out to characterise its role in HR and VSG switching in trypanosomes. We found that RAD50, like MRE11, is required for efficient HR, and in its absence MMEJ dominated as the major form of repair. RAD50 also plays a perhaps surprising role in VSG switching, where it restricts HR substrate selection in the VSG repertoire and so may act to preserve the VSG archive during long-term infections.

MATERIALS AND METHODS

Trypanosoma brucei growth and manipulation

Lister 427, MITat1.2 (clone 221a), bloodstream stage cells were cultured in HMI-11 medium 79 at 37.4 °C with 5 % CO2. Cell density was determined using a haemocytometer. For transformation, 2.5 × 107 cells were spun for 10 minutes at 1000g at room temperature and the supernatant discarded. The cell pellet was resuspend in prewarmed cytomix solution 80 with 10 μg linearised DNA and place in a 0.2 cm gap cuvette, and nucleofected (Lonza) using the X-001 program. The transfected cells were placed into one 25 cm2 culture flask per transfection with 36 ml warmed HMI-11 medium only and place in an incubator to allow the cells to recover for approximately 6 hours. After 6 hours, the media distributed into 48-well plates with the appropriate drug selection. Strains expressing TetR and I-SceI with I-SceI recognition-sites at a chromosome-internal locus 17 and an active VSG-ESs 27 have been described previously. G418, and blasticidin were selected at 10 μg.ml−1 and 2 μg.ml−1 respectively. Puromycin, phleomycin, G418, hygromycin and blasticidin and tetracycline were maintained at 1 μg.ml−1. Clonogenic assay were plated out at either 32 cells per plate under both inducing and non-inducting conditions for 1HR and VSGup strains and 480 cells per plate for VSGup strains under inducing conditions. Plates were counted 5-6 days later and subclones selected for further analysis.

To generate the RAD50 nulls in the 1HR strain we employed multi-step transfection strategy 81 that recycled a Neomycin phosphotransferase gene (NEO) in order to rescue one marker (here Blasticidin - BLA). Briefly, an I-SceI recognition sites was inserted into the pRAD50-BLA knock-out cassette between the 5’UTR and BLA ORF (Figure 1C) in the 2T1 cell line 82 with a tetracycline inducible Sce ORF. Induction of Sce induces a break in the BLA cassette and subsequent repair, using homology in the NEO modified allele, replaces BLA with NEO.

Figure 1:
Figure 1:

RAD50 is essential for DSB response and repair at a chromosome-internal locus. (A) Upper panel:Schematic of TbRAD50 with protein domains. Amino acid position of conserved domains are:ATPase - N, 4 – 170; MRE11 binding site (MBS), 182 – 205; Zn hook, 690 – 693; MRE11 binding site, 1158 – 1181; ATPase - C, 1243 – 1333. Lower panel:The structure of the T. brucei RAD50 was modelled using Phyre2 showing the SMC head domain with a coiled coil. (B) Schematic of the chromosome-internal DSB cell line with the I-SceI recognition site, SceR, highlighted. (C) A clonogenic assay reveals survivors following a DSB at a chromosome-internal locus in the parental and 1HRrad50 cell lines. Cells were plated out into media with or without tetracyline. The proportion of survivors was calculated by dividing the number of induced survivors by uninduced. R:P, red fluorescent protein:puromycin fusion gene. 1HR technical replicates; n=2, and with 1HRrad50 biological replicates for the strains; n=2.

Clonogenic assays were plated out at either 32 cells per plate under both inducing and non-inducing conditions for 1HR and VSGup strains and 480 cells per plate for VSGup strains under inducing conditions. Plates were counted 5-6 days later and subclones selected for further analysis.

Plasmid construction

For native C-terminal epitope tagging of Tb927.5.1700 / RPA2 a 765-bp fragment was amplified using primers RPA28F:GATCAAGCTTATGGAAGGAAGTGGAAGTAA; and RPA28R:GATCTCTAGAAATGCCAAACTTACAATCATG and cloned in pNATxTAG 83 using the HindIII and XbaI sites (underlined). The construct was linearized with XhoI prior to transfection. MRE11F5 (GATCgcggccgcATGGCCGAGAGGGCATC), MRE11R5 (GATCtctagaCAACGAAGATGTATGCCC), MRE11F3 (GATCgggcccCGATGGATAGTGGTAAT) and MRE11R3 (GATCggtaccCTAATAGTTATCTGGCA) were used to clone in target regions to generate pMRE11KOBLA and pMRE11KONEO. For transfection, 20 μg pMRE11KO Blasticidin (BLA) and Neomycin (NEO) plasmids were sequentially digested with Acc65I and NotI and cleaned by phenol-chloroform extraction and ethanol precipitation after each digestion. Strains were validated using MRE11F5 and MRE11R3 in a PCR assay. Heterozygous (+/−) and homozygous (−/−) knockout mutants of RAD50 were generated by deleting most of replacing most of the gene’s open reading frame with either BLA and NEO. The strategy used is as described in 84; briefly, two modified versions of the plasmid pmtl23 were used to allow PCR-amplified 5’ and 3’ flanking untranslated regions of RAD50 to be inserted around BLA and NEO cassettes (where the antibiotic resistance genes’ ORF were flanked by tubulin and actin intergenic regions). The selective drug markers, flanked by RAD50 5’ and 3’ untranslated regions, were then excised using NotI and transfected into T. brucei, and clones selected using 10 μg.ml−1 blasticidin or 5 μg.mL−1 G418.

Immunofluorescence microscopy

Immunofluorescence analysis was carried out using standard protocols as described previously 85. Mouse α-Myc was used at 1:400 and rabbit α-γH2A 55 was used at 1:250. Fluorescein-conjugated goat α-rabbit and goat α-mouse secondary antibodies (Pierce) were used at 1:2000. Samples were mounted in Vectashield (Vector Laboratories) containing 4, 6-diamidino-2-phenylindole (DAPI). In T. brucei, DAPI-stained nuclear and mitochondrial DNA can be used as cytological markers for cell cycle stage 86; one nucleus and one kinetoplast (1N:1K) indicate G1, one nucleus and an elongated kinetoplast (1N:eK) indicate S phase, one nucleus and two kinetoplasts (1N:2K) indicate G2/M and two nuclei and two kinetoplasts (2N:2K) indicate post-mitosis. Images were captured using a ZEISS Imager 72 epifluorescence microscope with an Axiocam 506 mono camera and images were processed and in ImageJ.

DNA analysis

Slot blots for detection of ssDNA were carried as described previously 17. ImageJ was used to generate linear density plots. The VSG probe was a 750 bp fragment VSG2 fragment from a Pst1 digest of pNEG. The RFP probe was a 687-bp HindIII/NotI fragment encompassing the full ORF. Loading control was a 226 – bp product from Tb427.01.570 (Dot1bKOF:TGGTCGGAAGTTGGATGTGA Dot1bKOR:CTTCCATGCATAACACGCGA).

PCR analysis of RAD50 nulls to confirms knock-out were done using standard PCR conditions with the following primers; a 402 bp product for RAD50 using RAD50KOF (CGTGAGAAACAGGAACAGCA) and RAD50KOR (AACACGTTTTTCCAACTCGG); a 399 bp product for Blasticidin ORF using BlaF (GATCGAATTCATGGCCAAGCCTTTGTCT) and BlaR (GATCCCATGGTTAGCCCTCCCACACATAA); and a 795 bp product for Neomycin Phosphotransferase ORF using NPTF (ATGATTGAACAAGATGGATTG) and NPTR (TCAGAAGAACTCGTCAAGAA). Analysis of subclones was previously described21,27,35 and used the following primers VSG221F (CTTCCAATCAGGAGGC), VSG221R (CGGCGACAACTGCAG), RFP (ATGGTGCGCTCCTCCAAGAAC), PAC (TCAGGCACCGGGCTTGC), ESAG1F (AATGGAAGAGCAAACTGATAGGTTGG), ESAG1R (GGCGGCCACTCCATTGTCTG), 2110X (GGGGTGAATGTTGGCTGTG), 2110Y (GGGATTCCCAGACCAATGA)

VSG sequencing analysis

For the RT-PCR, the reaction mix were as following; 1 μg of cDNA, 1 x PCR buffer, 0.2 mM dNTPs, 1 μl each of SL (ACAGTTTCTGTACTATATTG) and SP6-14mer (GATTTAGGTGACACTATAGTGTTAAAATATATC) primers, H2O to 50 μl and 0.5 μl Phusion polymerase (New England Biolabs). For the PCR conditions. Five cycles were carried out at 94 °C for 30s, 50 °C for 30s and 72 °C for 2 min; followed by 18 cycles at 94 °C for 30s, 55 °C for 30s and 72 °C for 2 min. DNA concentration was measured using a Nanodrop. Libraries were prepared from VSG PCR products and sequenced on a BGI-Seq (BGI500) with a 150 bp paired-end read length with BGI Genomics Hong Kong.

Replicate libraries for WT uninduced, WT induced, VSGUP uninduced and VSGUP induced, VSGUPrad50 uninduced and VSGUPrad50 induced were sequenced on the BGIseq500 platform producing 8.03, 9.01, 7.60, 7.22, 6.66, 7.07, 6.90, 6.98 million reads per library, respectively. Reads were aligned to the T. brucei Lister 427 genome 15 with the cohort of minichromosomal VSGs added from the Lister 427 VSGnome 13 using bowtie2 87 with the parameters --very-sensitive and BAM files created with samtools 88, aligning (WT uninduced) 97.76, 98.42, (WT induced) 97.69, (VSGUPrad50 uninduced) 97.57, 98.60, (VSGUPrad50 induced) 97.63, 97.80 percent of reads successfully. Reads counts per transcript were obtained using featureCounts89. Differential expression analysis was performed using EdgeR90on all genes, followed by filtering for VSG genes (1848 VSG sequences in total). An R script (https://github.com/LGloverTMB/DNA-repair-mutant-VSG-seq) was used to perform differential expression analysis, and generate Volcano and genome scale plots. BLAST analysis was performed locally using a database containing significantly up-regulated VSG genes from both conditions, including 2 kb of sequence upstream and downstream of the start and stop codons, respectively (except where sequences in the contigs 5’ or 3’ to the CDS were shorter than 2 kb excluding). For this analysis, minichromosomal VSG genes were excluded as the VSGnome does not contain any sequence beyond the CDS. The resulting database of 131 VSGs was queried using the VSG2 sequence including 2 kb of sequence upstream of the CDS and all sequence between the stop codon and end of contig (1,272 nt). The BLASTn algorithm was used query the database using default parameters except allowing up-to 20 hits per subject sequence, and outputting up to 2,000 alignments. Alignments were filtered to remove overlapping hits from the same subject sequence using Microsoft Excel, retaining the one with the higher alignment score. Non-overlapping alignments were plotted using a custom R script (https://github.com/LGloverTMB/DNA-repair-mutant-VSG-seq). Lengths of average alignments were calculated for cohorts of VSGs up-regulated in both VSGup and VSGuprad50 or VSGuprad50 only.

RESULTS

RAD50 is required for normal cell growth and DSB repair

RAD50, the largest component of the MRN complex, belongs to the structural maintenance of chromosomes (SMC) family of proteins 48 and has not been examined in T. brucei, though the gene has been reported to be essential in Leishmania infantum 49. The domain architecture of RAD50 is approximately palindromic (Figure 1A) and characterized by the presence of ATP-binding cassette (ABC)-ATPase domains at the N- and C-termini, each followed by an MRE11 binding site (MBS), and then by anti-parallel coiled-coil regions, which form linker structures that enable the MRN complex to act as a tethering scaffold to hold broken chromosomes together for repair 50. Between the antiparallel coiled-coils, a central Zn hook, a CxxC motif, facilitates Zn2+ dependent RAD50-RAD50 subunit interactions and is presumed to be important for tethering 51. A conformational change is invoked through binding of RAD50 to two ATP molecules, which then allows for binding to DNA43. Primary sequence comparison suggested all RAD50 domains are recognisably conserved in the putative T. brucei RAD50 homologue (Tb.927.11.8210; Supplementary Figure 1). Within the ATPase domains, the ABC nucleotide binding domain is defined by the conserved presence of Walker A, Q-loop, Signature, Walker B, D-loop, and H-loop motifs required to form the active ATPase site 52. Furthermore, structure prediction using Phyre2,53 modelled 503 residues (37 % of the sequence) of the T. brucei protein, revealing a SMC head domain and antiparallel coiled coil regions (Figure 1A).

To test the function of RAD50 in DSB repair, we used a previously validated T. brucei cell line, referred to as 1HR (Figure 1B), where a single I-SceI meganuclease DSB can be induced in an RFP-PAC (red fluorescent protein – puromycin N-acetyltransferase) fusion cassette in the core region on chromosome 11 17 (Figure 1B). We generated rad50 null mutants (referred to as 1HRrad50) in these cells by sequentially replacing the two gene alleles with neomycin phosphotransferase (NEO) and blasticidin (BLA) resistance cassettes:PCR analysis of double antibiotic resistant clones confirmed RAD50 loss and replacement (Supplementary Figure 2A and B) and demonstrates RAD50 is not essential in T. brucei. To determine the role RAD50 plays in DNA repair, we set up clonogenic assays. Cells were distributed across 96-wells plates under both I-SceI non-inducing and inducing conditions, and wells with live cells scored after 5 - 7 days. This revealed a significant growth defect in the 1HRrad50 null cells in unperturbed cells (Figure 1C Left panel and Table 1): 95 % of the WT 1HR cells survived compared with ~ 35 % of the 1HRrad50 cells, revealing a 2.6 - fold decrease in cell survival. This growth impairment is likely due to the inability to repair spontaneous DSBs. Induction of the I-SceI meganuclease results in ~ 95 % cutting and repair mainly by homologous recombination 17. Consistent with previous findings, in the WT 1HR strain ~ 48 % of cells are able to repair the DSB and survive (Figure 1C Left panel and 17 and Table 1), whereas in the 1HRrad50 cells, a severe growth defect was seen following a DSB, with less than 3 % survival (a 16 - fold reduction), suggesting a significant defect in DSB repair (Figure 1C Left panel and Table 1). This was recapitulated when assessing the normalised survival efficiency (compared to uninduced survival) following an I-SceI break (Figure 1C right panel and Table 1), indicating that a DSB is more lethal in the null mutant cells. In parallel we also tested the function of MRE11, as it forms a complex with RAD50, by generating null mutants through sequentially replacing the two gene alleles with NEO and BLA resistance cassettes; PCR analysis confirmed MRE11 loss and replacement (Supplementary Figure 2C). The mre11 nulls (referred to as 1HRmre11) also showed a growth defect cells in the unperturbed cells, with only 47 % of cells surviving cloning. Induction of the I-SceI meganuclease resulted in a severe growth defect, with less than 2 % survival, suggesting a significant defect in DSB repair (Supplementary Figure 4A and Table 1) whose magnitude was very similar to 1HRrad50 cells, which is expected given they have been shown to act in complex in other systems37,38.

View this table:
Table 1:

Details of clonogenic assays of strains described in this manuscript following a DSB.

We next asked what effect of the loss of RAD50 had on the mechanisms by which trypanosomes recognize a DSB lesion and initiate a signalling cascade resulting in DNA repair 54. In T. brucei, the DDR after an I-SceI induced DSB has been characterized thus far to include an increase of cells in G2/M 17, phosphorylation of histone H2A 55, break resection and accumulation of RAD51 foci at the site of the DSB 17. The cell cycle distribution of WT 1HR and 1HRrad50 cells was assessed following induction of a DSB. In WT 1HR cells ~ 28% were in G2 12 hours after I-SceI induction and this returned to background levels (~15% of the population) by 24 hours. In contrast, no increase in G2 cells was seen after DSB induction in the 1HRrad50 cells (Figure 2A), suggesting RAD50 is required for eliciting the G2/M checkpoint. In mammals the MRN complex recruits the ATM kinase to a DSB, where it phosphorylates H2AX 37.

Figure 2:
Figure 2:

DNA damage response is compromised in 1HRrad50 cells. (A) The number of cells in G2/M phase cells was counted by DAPI staining at several points following induction of an I-SceI break in. G2 cells contain one nucleus and two kinetoplasts. (B) Immunofluorescence assay to monitoring γH2A foci. The number of positive nuclei were counted in uninduced cells and 12 hours post DSB. Inset showing a nucleus with a γH2A focus. n = 200 for each time point in the 1HR cell line and n= 400 for the 1HRrad50 strain. Error bars, SD, for 1HRrad50 biological replicates for the strains; n=2. (C) Immunofluorescence assay to monitoring RAD51 foci. The number of positive nuclei were counted in uninduced cells and 12 hours post DSB. Inset showing a nucleus, with a single RAD51 focus. n = 200 for each time point in the 1HR cell line and n= 400 for the 1HRrad50 strain. Error bars, SD, for 1HRrad50 biological replicates for the strains; n=2.

Using an antibody specific to the Thr130 phosphorylated form of T. brucei H2A, γH2A 55, we saw the expected background staining of ~15 – 20% of nuclei with foci in unperturbed WT 1HR cells, which increased to ~ 60% at 12 hours post I-SceI induction (Figure 2B). In the 1HRrad50 cells, the background level of γH2A foci was reduced to 5%, and the DSB-induced increase was drastically impaired (Figure 2B), with only 8% of cells containing γH2A foci. Repair at this locus is predominately via RAD51-dependent homologous recombination 17, and so we next assessed RAD51 foci assembly following DSB induction. In the WT 1HR strain, the number of detectable foci increased from 0 to 27% within 9 – 12 hours after I-SceI induction. In contrast, in 1HRrad50 cells the background level of RAD51 foci, before I-SceI induction, was higher at 4%, and only increased to 10 % (~3 fold reduced) in response to a DSB (Figure 2C). Like the 1HRrad50 cells, we detected fewer γH2A foci in 1HRmre11 cells following a DSB (no foci detected, Supplementary Figure 4B) and a significant reduction in the number of RAD51 foci (14% compared with 36% in WT, Supplementary Figure 4B) and a loss of the G2/M checkpoint (8.5% compared with 28% in WT, Supplementary Figure 4B). These results reveal an important role for RAD50 and MRE11 in the DDR to a DSB in trypanosomes at a single copy locus and suggest wider roles in tackling spontaneous DNA damage.

RAD50 restricts resection during allelic recombination

An early step in the DSB repair cycle is the formation of extensive 3’ ssDNA overhangs, initiated by MRE11 3’ – 5’ nuclease activity, which are a substrate for RAD51 nucleoprotein filament formation and act as a template for homology-directed repair 37. In light of the reduced accumulation of RAD51 foci after DSB induction in the absence of RAD50, we sought to determine whether the formation of ssDNA at the I-SceI target locus was compromised, using slot blots. In the WT 1HR cells, ssDNA accumulated up to 12 h after I-SceI induction and declined thereafter (Figure 3A), mirroring the phosphorylation of H2A and accumulation of RAD51 (Figure 2 B and C)17. Processing of the DSB in the 1HRrad50 cells appeared to be accelerated, with ssDNA signal peaking at 9 hours and declining thereafter (Figure 3A and Supplementary Figure 3). We conclude that DNA resection is not lost in the 1HRrad50 cells but the timing is affected, though we cannot say if the extent of resection is changed. Prior to RAD51 loading on to ssDNA, the trimeric RPA (replication protein A) complex binds the ssDNA and is subsequently displaced by RAD51 56. Rescue of the BLA selectable marker in this strain (Supplementary Figure 2) allowed tagging of RPA2 with the myc epitope and subsequent localization. In WT 1HR cells the number of nuclei with RPA foci increased 5-fold (from 10% to 50%) following an I-SceI break (Figure 3B). The 1HRrad50 cells showed a pronounced increase in RPA foci prior to induction of a DSB, and only a marginal increase at 12 hours post DSB (~30% – 55%; Figure 3B). In the WT 1HR cells, a single RPA focus is most commonly seen in response to an I-SceI break 22. However, we observed multiple RPA foci in both induced and uninduced 1HRrad50 null cells (Figure 3C). We therefore tentatively conclude that most RPA signal in the 1HRrad50 cells22 represents persistent, widespread damage, meaning it is unclear if loss of RAD50 alters the accumulation of RPA at the I-SceI induced DSB in chromosome 1.

Figure 3:
Figure 3:

RAD50 directs resection at chromosome-internal locus. (A) Accumulation of ssDNA was monitored using slot-blots. Genomic DNA was extracted as indicated following I-SceI induction. Ninety percent of the sample was ‘native’ (n; ssDNA) and ten percent was denatured (d). Probe RFP and the loading control are described in the materials and methods. (B) Immunofluorescence assay to monitoring RPA foci. The numbers of positive nuclei were counted in uninduced cells and 12 hours post DSB. n = 200 for each time point in the 1HR cell line and n=400 for the 1HRrad50 strain. Error bars, SD, for 1HRrad50 biological replicates for the strains; n=2. (C) Immunofluorescence assay to monitor the number of RPA foci per nucleus. The number of RPA foci was counted in uninduced cells and 12 hours post DSB. n = 200 nuclei for each time point in the 1HR cell line and n= 400 nuclei for the 1HRrad50 cells. Inset showing representative nuclei, with RPA foci. Error bars, SD, for 1HRrad50 biological replicates for the strains; n=2.

RAD50 is crucial for homologous recombination in T. brucei

To explore how trypanosomes repair a DSB in the 1HRrad50 nulls, DSB-survivors from the clonogenic assay were scored for repair by homologous recombination or MMEJ by a PCR assay (Figure 4A) using sets of primers that flanked the RFP-PAC cassette. In the surviving subclones, sensitivity to puromycin is indicative of cleavage by I-SceI 17. All twelve of the surviving subclones were sensitive to puromycin, indicating cleavage by I-SceI 17 and disruption of the RFP:PAC cassette (data not shown). Eleven of these clones showed repair by MMEJ, as seen by the reduction in the size of the PCR product as compared to the controls (Figure 4B, RFP and PAC primer pair17), or loss of the entire cassette (Figure 4C, 2110X and 2110Y primer pair 57). Sequencing revealed repair by MMEJ using the Xcm1 sites that flanked the RFP-PAC cassette in clones 12, 15, 16 and 17 (Figure 4C lower panel). Sequencing of the 2110X-Y product in clone 8 revealed repair using the homologous template, suggesting homologous recombination can still occur, although is significantly impaired. In the mre11 nulls, 14 out of 15 clones repaired by MMEJ (Supplementary Figure 4C, clone 10, 17 and 19 show a PCR product of reduced size and for the remaining clones the 2110XY PCR product was sequenced revealing 11 clones had repaired by MMEJ). These data show a significant shift in the pathway used to repair a DSB in the 1sHRrad50 and 1HRmre11 null cells at a chromosome-internal locus, with repair by MMEJ dominating (Figure 4D), compared with the pronounced predominance of homologous recombination in WT 1HR cells 17.

Figure 4:
Figure 4:

RAD50 is required for homologous recombination. PCR analysis of 1HR repaired subclones. (A) Schematic showing the 2110 locus and position of the Sce recognition site (SceR). Position of primers indicated by arrows. Primer sequence detailed in materials and methods. (B). PCR assay of repaired subclones showing RFP:PAC presence or absence. (C) Upper panel: PCR assay of repaired subclones that were negative for RFP:PAC. Lower panel: Sanger Sequence trace showing XcmI site. (D) Percentage of survivors for each repair pathway choice. n= 12 clones. Arrows indicate position of primers. White box, genes; Grey box, RFP – PAC fusion gene; black box, UTRs.

Loss of RAD50 increases survival following a DSB at the active VSG-ES

Trypanosomes rely on homologous recombination to facilitate antigenic variation. We therefore wanted to test the role of RAD50 in VSG switching. We generated RAD50 nulls in a cell line where the I-SceI recognition site is fused to a puromycin selectable marker and inserted immediately downstream of the major block of 70-bp repeats and upstream of VSG2 in Bloodstream form Expression site 1 (BES1) (on chromosome 6a), the active VSG-ES in this strain (Figure 5A). The resulting cell line is known as VSGup 27. Cell survival following a DSB at this position is contingent upon VSG switching, most commonly using the 70-bp repeats and replacing the active VSG via break-induced replication 26,27. We generated rad50 null VSGup strains (VSGuprad50), by replacing the two gene alleles with NEO and BLA resistance cassettes: PCR analysis of double antibiotic resistant clones confirmed RAD50 loss and replacement (Supplementary Figure 2A and B). Using a clonogenic assay we found that, like in the 1HR strain, there was a growth defect (1.6-fold reduction) in the VSGuprad50 nulls compared with VSGup WT cells in the absence of I-SceI induced damage (Figure 5B; left panel and Table 1). This effect again suggests an impaired ability to repair spontaneous damage within the mutant cell. However, quite differently to 1HR cells, following induction of an I-SceI DSB we observed an increase in survival in the VSGuprad50 nulls compared with induced VSGup WT cells (Figure 5B; left panel and Table 1). These data indicate that RAD50 suppresses DSB repair at a VSG-ES, the opposite of its role at a chromosome-internal DSB. In contrast, survival is reduced in the VSGup mre11 nulls relative to VSGup WT, with only 1.75% able to survive a DSB (Supplementary Figure 6A and Table 1). We then assessed the DDR in the VSGup cell line. As in the 1HR cells, following a DSB, the number of cells that accumulate in G2/M increases to ~ 30 % in the VSGup WT cell line 27, and this cell cycle checkpoint was lost in the VSGuprad50 cells (Figure 5C) and in the VSGupmre11 cells (Supplementary Figure 6B). In the VSGup WT cell line, the number of γH2A foci increased from 20% to 41% after I-SceI induction, as has been previously reported 27. In the VSGuprad50 nulls, γH2A foci were only detected in 3% of uninduced cells, and this increased to 11% following a DSB (Figure 5D). A similar phenotype was seen in the VSGupmre11 cells, with the number of γH2A foci increasing from 1.3% to 7% (Supplementary Figure 6B). Thus, while it appears that loss of RAD50 or MRE11 diminishes the capacity of cells to phosphorylate H2A in response to a DSB at this locus, the increased survival in the VSGuprad50 cells suggests that while it is required for an efficient DDR, in its absence the cells are more adept at repair.

Figure 5:
Figure 5:

RAD50 suppresses repair at a subtelomeric locus. (A) A schematic of the active expression site DSB cell line with the I-SceI recognition site, SceR, highlighted. (B) A clonogenic assay reveals the survivors following a DSB at the active expression site in the parental and VSGUPrad50 cell lines. Cells were plated out into media with or without tetracyline and counted after seven days. Other details as in Figure 1. (C) The number of cells in G2/M phase cells was counted by DAPI staining at 0 hours and 12 hours following induction of an I-SceI break in. G2 cells contain one nucleus and two kinetoplasts. (D) Immunofluorescence assay to monitoring γH2A foci. The nuclei with γH2A foci were counted in uninduced cells and 12 hours post DSB. n = 200 for each time point in the VSGup cell line and n= 400 for the RAD50 null. Error bars, SD, for VSGuprad50 biological replicates for the strains; n=2. Arrow, RNA Pol 1 promoter; box with diagonal lines, 70-bp repeats; vertical lines, telomere.

Using a series of assays (Figure 6A and Supplementary figure 5) we next looked at DNA rearrangements in the VSG-ES to determine how the VSGuprad50 cells repair an induced DSB. 25 subclones were selected from the clonogenic assay and tested for sensitivity to puromycin, asking about the frequency of loss of the puromycin gene from the VSG-ES. 24 out of 25 subclones were sensitive to 1 μg.ml−1 puromycin, indicating that the majority of the population had been subject to a DSB and had deleted the resistance cassette. Immunofluorescence using antibodies against VSG2, the VSG expressed from the modified VSG-ES, showed that 23 out of 24 puromycin sensitive subclones had switched VSG (Figure 6B). This is comparable to what is seen in the VSGup WT strain, suggesting loss of RAD50 does not affect the cell’s ability to undergo VSG switching. The single puromycin resistant clone was VSG2 positive, suggesting I-SeeI did not cut (Supplementary Figure 5, subclone 14).

Figure 6:
Figure 6:

RAD50 is not required for VSG switching. (A) A schematic map shows the primer position at the active expression site. (B) Immunofluorescence assay for VSG2, showing the percentage of switched survivors in the VSGuprad50 cell line. (C) PCR analysis shows the percentage of switched survivors that kept ESAG1 and VSG2. n= 24 clones. Arrows indicate position of primers; box with diagonal lines, 70-bp repeats; vertical lines, telomere. (D) Accumulation of ssDNA was monitored using slot-blots. Genomic DNA was extracted as indicated following I-SceI induction. Ninety percent the sample was ‘native’ (n; ssDNA) and ten percent was denatured (d). Probe VSG2 and the loading control are described in the materials and methods.

We then looked at DNA rearrangements in the ES using primers specific to VSG2 and ESAG1. ESAG1 is found upstream of a block of 70-bp repeats in the active VSG-ES and cells that retain ESAG1 are presumed to have repaired by gene conversion using the 70-bp repeats. Both VSG2 and ESAG1 were retained in five out of five uninduced control subclones (Figure 6C and Supplementary Figure 3). Of the 24 puromycin sensitive subclones (i.e. cleaved by l-Seel), ESAG1 was retained in 23 and VSG2 was lost in 23 (Figure 6C and Supplementary Figure 5).

One subclone was found to be VSG2 negative by immunofluorescence, puromycin sensitive, and ESAG1 positive and VSG2 positive by PCR. This suggests that this single clone had switched by in situ transcriptional activation of another VSG-ES (Figure 6B and C and Supplementary Figure 3), whereas all other clones had undergone VSG switching by recombination. In the VSGupmre11 cells, all the puromycin sensitive subclones had switched VSG and lost the VSG2 gene as seen by PCR analysis (Supplementary Figure 4C). 18 out of the 20 subclones had also retained ESAG1. As with the VSGuprad50 cells, these clones are presumed to have repaired by gene conversion using the 70-bp repeats. We then assessed the formation of ssDNA and found that as in the 1HRrad50 nulls, the formation of ssDNA was not abolished but seemed to accumulate earlier - here at 6 hours post DSB induction (Figure 6D). These data suggest that loss of RAD50 or MRE11 does not impair the cell’s ability to undergo switching by DNA recombination.

RAD50 promotes recombination using long stretches of homology

Increased survival of the VSGuprad50 nulls after induction of a DSB suggested a hyper-recombinogenic mechanism in this locus, through which the cells are able to repair and switch at a higher rate than in the parental cell line. One explanation for such enhanced repair could be through greater access to the silent VSG repertoire. In the T. brucei genome there are in excess of 2000 VSG genes found at the subtelomeric arrays16,13,15,58, 90% of which are associated with a stretch of 70-bp repeat sequence14 that can be used for homology during repair9. To ask if differences in VSG repertoire access explains increased survival of VSGuprad50 cells after DSB induction, we used VSG-seq 10. In the VSGup WT cell line, 83 VSG gene transcripts were significantly enriched in the induced cells compared with uninduced (Figure 7A) (greater than 2 log2 fold change and p value of less than 0.05). In the VSGuprad50 cell line, a greater number of VSGs were detected: here 225 VSG transcripts were significantly enriched after I-SceI induction (Figure 7A). To understand this increase, we then looked at the genomic position of the VSG cohorts. In the VSGup cells, we found that approximately equal numbers of enriched VSGs mapped to the VSG-ES and minichromosomes relative the megabase arrays, despite the much greater number of genes in the latter component of the archive (Figure 7B, Supplementary Figure 7A). These data appear consistent with VSG switching having followed a loose hierarchy, as previously published 59, with telomeric VSG preferred as donors. In the VSGuprad50 cell line, enriched VSG genes also mapped to the VSG-ESs, minichromosomes and megabase arrays, but a significantly higher proportion (67% compared with 34% in WT) were from subtelomeric arrays (Figure 7B, Supplementary Figure 7A). This suggests that the VSGuprad50 cells are able to access a greater proportion of the silent VSG archive for repair and VSG switching. To ask if increased VSG switching in the absence of RAD50 could be explained by changes in the mechanism of recombination, we looked at the length of homology used for repair. Using BLAST analysis, we queried the significantly enriched VSGs against the telomeric end of BES1, searching for regions of homology (Figure 7C and Supplementary Figure 7B). This analysis revealed that, compared with the VSGup WT cells, VSG genes activated in the VSGuprad50 cells shared shorter stretches of homology with the active VSG2 locus.

Figure 7:
Figure 7:

RAD50 restricts antigenic variation. (A) Volcano plots of VSG-seq showing log2 fold change vs. log10 P value for VSGup and VSGuprad50 strains. Red genes are significantly up-regulated (P value < 0.05 and log2 FC > 2. (B) T. brucei 427 Genome map showing all 11 megabase chromosomes in black lines and all genes in grey. Significantly up-regulated VSG genes from either VSGup (blue) or VSGuprad50 (red). Inset box shows all 13 BES with significantly up-regulated VSG genes from either VSGup (blue) or VSGuprad50 (red). (C) Chromosome 6 map showing all genes in grey and significantly up-regulated VSG genes from either VSGup (blue) or VSGuprad50 (red). (C) Percentage usage for the length of the BLAST hits from either VSGup (blue) or VSGupRAD50 (red).Box with diagonal lines, 70-bp repeats; vertical lines, telomere; grey box, 3’UTR

The most commonly used length of homology in the VSGuprad50 cells was 100 bp (40% of survivors), whereas the VSGup WT cells most frequently used >400 bp (51% of survivors) (Figure 7C). Thus, increased survival in the absence of RAD50 is due to increased access to archival VSGs due to more frequent DSB repair using short stretches of homology.

DISCUSSION

Central to the DDR and subsequent repair is the MRN complex, within which the MRE11 – RAD50 heterodimer forms the catalytic core. In fact, this core complex is so fundamental to repair that it is conserved across bacteriophages, bacteria, archaea and eukaryotes 60. Kinetoplastids rely on homology-based recombination as the major form of repair, since no data has suggested the use of non-homologous end-joining after I-SceI induction of a DSB at both at chromosome-internal17 and telomeric loci in T. brucei, or after CRISPR-Cas9 DSB formation in Leishmania, T. cruzi or T. brucei 61–63. At least in T. brucei, HR predominates over MMEJ after induction of a DSB17, and all evidence suggests RAD51-dependent HR dominates as the major form of repair reaction during VSG switching at the VSG-ES 19. What dictates the preference of HR over MMEJ in these reactions in T. brucei and related kinetoplastids is unknown. Here, we have shown that T. brucei RAD50 is critical for normal cell growth and efficient homology-based DNA repair after induction of a DSB, which is consistent with a conserved role in DSB recognition and repair. We demonstrate that in the absence of RAD50 the DDR is severely compromised, as evidenced by the loss of γH2A accumulation and the G2/M cell-cycle checkpoint at both subtelomeric and chromosome-internal DSBs, and the RPA focal accumulation. We also show that HR is dependent on RAD50, as null mutants displayed compromised RAD51 foci formation and switched repair pathway choice from HR to MMEJ at a chromosome-internal DSB. In contrast, at a VSG-ES we demonstrate that RAD50 restrains the DDR, since in its absence break processing dynamics were altered, cell survival improved and a greater diversity of VSGs were activated following a DSB. Thus, this work provides insight into DSB repair pathway choice, compartmentalization of repair with specific relevance for understanding trypanosome antigenic variation and genome maintenance in all kinetoplastids.

In T. brucei RAD51-dependent HR accounts for approximately 95% of DSB repair at a chromosome-internal locus, and a DSB triggers a conventional DDR17. The data shown here indicate that the role of T. brucei RAD50 in recognizing a DSB and initiating the DDR appears consistent with its role in other eukaryotes64,65. Previous characterization of MRE11 has revealed a role in HR and genomic stability in both T. brucei 46,47 and Leishmania 49,66, suggesting RAD50 and MRE11 act together. Here we show that that MRE11 is essential for the DDR and HR and, in its absence, repair is predominantly achieved by MMEJ. We expect that the reduced survival of 1HRrad50 and VSGuprad50 cells is due to unrepaired DNA damage that results in cell death, which is also seen in mre11 mutants 46,47. The persistence of RPA foci in the 1HRrad50 cells is further evidence of defective repair in these cells, explained by RPA remaining associated with ssDNA at sites of damage. This observation may also reflect a damage tolerance strategy employed by T. brucei 22, but in these circumstances γH2A and RAD51 are not recruited to the break after replication, unlike what is seen in T. cruzi where ionizing radiation tolerance is dependent on RAD5167. DNA resection following a DSB is one of the early steps in the DDR. MRN is an early acting complex in DSB processing, initiating resection39,68 and recruiting the SGS2 nuclease and DNA2 and EXO1 for long-range resection thereafter39,69. The lack of resection defect in the 1HRrad50 mutants, coupled with the altered dynamics of the formation and resolution of ssDNA, suggests that in trypanosomes there is flexibility in the nucleases able to initiate and resect across a DSB and, in the absence of MRN, unknown nucleases can act in an unrestricted manner that exceeds the resection rate of WT cells.

Loss of RAD50 in T. brucei reveals a striking difference in the response to a DSB at a chromosome-internal location and in the active VSG-ES, with dramatically impaired survival at the former and improved survival at the latter. This locus-specific effect of rad50 nulls was not reproduced in the mre11 nulls. It is possible that this difference arises from a shared change in DSB repair reaction mechanism due to loss of the MRN complex. After DSB induction, loss of RAD50 results in lower levels of yH2A and RAD51 foci, allied to more rapid formation and resolution of ssDNA at a chromosome-internal site, with the result that DSB repair no longer favours HR but instead mainly uses MMEJ. An explanation for these effects could be that loss of RAD50 leads to impaired DSB processing by MRE11, allowing altered resection that leads to lowered levels of RAD51 nucleoprotein filament formation and increased recruitment of the unknown T. brucei machinery for MMEJ. If the MMEJ reaction was more efficient than HR, the more rapid resolution of ssDNA would be explained. If this same redirection of DSB repair occurred in the VSG-ES, why might the difference in survival occur? A simple explanation might be that MMEJ repair is more error-prone (such as by mutation or translocation) than HR70, and the use of error-prone MMEJ has a greater impact in the chromosome core, where it would affect housekeeping genes, than in the subtelomeres, where there is a huge abundance of silent VSG substrates. Because the machinery that directs MMEJ in T. brucei or any kinetoplastid has not been characterised, directs tests of this suggestion are not yet possible. In addition, it remains to be shown that MMEJ directs the activation of silent array VSGs after a DSB in the VSG-ES, since the length of homologies we describe here (predominantly ~100 bp) appear longer than the ~5-15 bp microhomologies so far detailed in experimental characterization of T. brucei MMEJ21,71. Nonetheless, previous work has shown considerable flexibility in the substrate requirements of recombination in T. brucei71, and linked MMEJ and HR-mediated repair of a DSB has been detailed21. Thus, it remains possible that MRN is pivotal in determining the routing of DNA repair throughout the T. brucei genome.

DNA DSBs are a potent trigger for T. brucei antigenic variation and it has been shown that the subtelomeric VSG-ES are fragile and prone to DSBs 27. A DSB upstream of the active VSG triggers antigenic variation, and subsequent repair by recombination is facilitated by stretches of 70-bp repeat that provide homology9,26,27, via either a RAD51-dependent or independent pathway27. Given this, it remains perplexing that mutation of MRE11 was not previously shown to alter the rate of VSG switching46, unlike the clear alteration in survival and repair pathway seen here after loss of RAD50 and induction of a VSG-ES DSB. These data may suggest an unconventional signalling pathway following a DSB at the active VSG-ES that allows the cells to bypass the conventional MRN / ATM pathway. One way that might occur is that the DSBs in the VSG-ES do not arise directly, but are generated by routes such as clashes between replication and transcription 31, or the formation of RNA-DNA hybrids72–74, which might not elicit recruitment of MRN or ATM75,76. Our data reveals that increased survival in the VSGuprad50 cells is due to their ability to access more of the genomic VSG archive for repair, and the repair reaction occurs as a result of recombination using shorter stretches of homology. RAD50, therefore, appears to suppress antigenic variation by committing T. brucei to RAD51-dependent repair pathway that is reliant on long stretches of donor homology. We also note that we observe a striking number of donor VSG genes used for repair on Chromosome 6 – BES1, which contains the I-SceI site is found on Chromosome 6a. Indeed, several other factors have also been shown to suppress antigenic variation: HAT335, TOPO3α32 and the telomere-interacting factor TIF277. Antigenic variation following a DSB is driven by break-induced repair26,27 and, in yeast, RAD51-independent BIR has been shown require as little as 30 bp of homology for repair 78. Thus, loss of RAD50 may allow T. brucei to enlist RAD51-independent BIR to respond to a DSB in the VSG-ES, using shorter stretches of homology, rather than MMEJ. Irrespective, the question arises as to why T. brucei might limit the range of VSGs that can be used in antigenic variation, since this appears counter to the observed diversity of VSGs seen during infections10,11. It is possible that RAD50-mediated restraint of VSG recombination is needed to preserve the VSG archive, saving genes for use in prolonged infections. A more radical possibility is that RAD50/MRN control underlies the hierarchy of VSG expression, directing DSB repair to telomeric VSG substrates early an infection and then giving way to a distinctly signalled reaction, such as MMEJ, that allows access to the whole VSG archive later.

DATA AVAILABILITY

All script is hosted on GitHub: https://github.com/LGloverTMB/DNA-repair-mutant-VSG-seq All data has been deposited onto the ENA under study accession number: PRJEB37290 and unique study name: ena-STUDY-INSTITUT PASTEUR-15-03-2020-20:11:26:661-115

FUNDING

AK. M. was supported by the Erasmus + program of the European Union. Work in the L.G. laboratory has received financial support from the Institut Pasteur and the National Research Agency (ANR – VSGREG). Aspects of the work in this grant was support by the Wellcome Trust (089172, 206815). Further work in RM’s lab was supported by the BBSRC (BB/K006495/1, BB/N016165/1), and the Wellcome Centre for Integrative Parasitology is supported by core funds from the Wellcome Trust (104111). S.H. is a Marie Curie fellow, this project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No 794979

TABLE AND SUPPLEMENTARY FIGURE LEGENDS

Supplementary figure 1:
Supplementary figure 1:

Sequence alignment of the T. brucei RAD50 (TbRAD50) with Homo sapiens (HsRAD50; UNIPROT: Q92878). Conserved domains are highlighted in bold and the ABC/ATPase domains highlighted with grey bar. Highly conserved residues are highlighted with a * and residues with conserved properties with ‘:’ or ‘.’.

Supplementary figure 2:
Supplementary figure 2:

Generation of rad50 and mre11 null strains. (A) Upper panel: Schematic showing the knockout strategy to generate the chromosome-internal 1HRrad50 null cell line. (B) PCR assay confirming RAD50 double allele replacement. (C) PCR assay confirming MRE11 double allele replacement. * background band. NEO, Neomycin Phosphotransferase; BLA, Blasticidin deaminase. C1, control plasmid for BLA; C2, control plasmid for NEO.

Supplementary figure 3:
Supplementary figure 3:

Resection is compromised in the 1HRrad50 nulls Left panel: Biological replicate showing accumulation of ssDNA was monitored using slot-blots, n=2 for biological replicates. Right panel: Quantitative analysis the amount of ssDNA. Error bars, SD for biological replicates for the rad50 null strains; n=2.

Supplementary figure 4:
Supplementary figure 4:

MRE11 is essential for DSB response and repair at a chromosome-internal locus. (A) Clonogenic assay reveals survivors following a DSB at a chromosome-internal locus in the parental and 1HRmre11 null cell lines. Details as in Figure 1 1HR technical replicates; n=2, and with 1HRmre11 biological replicates for the strains; n=2. (B) Upper panel: Immunofluorescence assay to monitoring γH2A foci. The number of positive nuclei were counted in uninduced cells and 12 hours post DSB. Middle panel: Immunofluorescence assay to monitoring RAD51 foci. The number of positive nuclei were counted in uninduced cells and 12 hours post DSB. Lower panel: The number of cells in G2/M phase cells was counted by DAPI staining at several points following induction of an I-SceI break in. G2 cells contain one nucleus and two kinetoplasts. Error bars, SD, for 1HRmre11 biological replicates for the strains; n=2. (C) PCR analysis of repaired subclones. Upper panel: Schematic showing the 2110 locus and position of the Sce recognition site (SceR). Position of primers indicated by arrows. Primer sequence detailed in materials and methods. Middle panel: PCR assay of repaired subclones showing RFP:PAC presence or absence. Lower panel: PCR assay of repaired subclones that were negative for RFP:PAC. Arrows indicate position of primers. White box, genes; Grey box, RFP:PAC fusion gene; black box, UTRs.

Supplementary figure 5:
Supplementary figure 5:

Analysis of VSGupRAD50 strains. (A) Schematic showing the telomeric end of the VSG2 BES. (B) Presence or absence of ESAG1 in the repaired subclones. (C) Presence or absence of VSG2 in the repaired subclones. Arrows indicate position of primers; box with diagonal lines, 70-bp repeats; white boxes, genes; ψ, VSG pseudo gene; vertical lines, telomere.

Supplementary figure 6:
Supplementary figure 6:

MRE11 is essential for DSB response and repair at an expression site. (A) Clonogenic assay reveals survivors following a DSB in the VSGup strain in the parental and VSGUPmre11 cell lines. Details as in Figure 1 (B) Upper panel: Immunofluorescence assay to monitoring γH2A foci. The number of positive nuclei were counted in uninduced cells and 12 hours post DSB. Lower panel: The number of cells in G2/M phase cells was counted by DAPI staining at several points following induction of an I-SceI break in. G2 cells contain one nucleus and two kinetoplasts. Error bars, SD, for VSGupmre11 biological replicates for the strains; n=2. (C) PCR analysis of repaired subclones. Upper panel: Schematic showing BES1. Position of primers indicated by arrows. Primer sequence detailed in materials and methods. Middle panel: PCR assay of repaired subclones showing ESAG1 presence or absence. Lower panel: PCR assay of repaired subclones that were negative for VSG2 by immunofluorescence. Arrows indicate position of primers. White box, genes;; ψ, pseudo gene; lined box, 70 bp repeats; black box, UTRs. VSGuprmre11 biological replicates for the strains; n=2.

Supplementary figure 7:
Supplementary figure 7:

(A) Table showing position of the VSG genes used for recombination (C) Proportion of VSG2 in the populations before and after induction of a DSB. (D) Schematic represents the telomeric end of the VSG2 ES. BLAST analysis of significantly up-regulated genes. BLAST hits are represented as lines showing their position on the VSG2 query sequence. Black lines – VSG genes significantly enriched in both VSGup and VSGuprad50, blue bars – VSGup only, red bars – VSGuprad50 only.

ACKNOWLEDGEMENTS

A-K.M, M.P, A.D-H and L.G performed the experiments, S.H performed the VSG-Seq data analysis, R.M and L.G discussed the results and wrote the manuscript. A-K.M, S.H, R. M and L.G edited the manuscript. We would also like to that David Horn for discussions and support.

References

  1. ↵
    Trindade, S. et al. Trypanosoma brucei Parasites Occupy and Functionally Adapt to the Adipose Tissue in Mice. Cell Host Microbe 19, 837–848, doi:10.1016/j.chom.2016.05.002 (2016).
    OpenUrlCrossRef
  2. ↵
    Capewell, P. et al. The skin is a significant but overlooked anatomical reservoir for vector-borne African trypanosomes. Elife 5, doi:10.7554/eLife.17716 (2016).
    OpenUrlCrossRef
  3. ↵
    Jamonneau, V. et al. Untreated human infections by Trypanosoma brucei gambiense are not 100% fatal. PLoS Negl Trop Dis 6, e1691, doi:10.1371/journal.pntd.0001691 (2012).
    OpenUrlCrossRefPubMed
  4. ↵
    Baltz, T. et al. Chemical and immunological characterization of specific glycoproteins from Trypanosoma equiperdum variants. FEBS Lett 82, 93–96, doi:10.1016/0014-5793(77)80893-4 (1977).
    OpenUrlCrossRefPubMedWeb of Science
  5. ↵
    Diffley, P. Trypanosoma brucei: immunogenicity of the variant surface coat glycoprotein of virulent and avirulent subspecies. Exp Parasitol 59, 98–107, doi:10.1016/0014-4894(85)90062-1 (1985).
    OpenUrlCrossRefPubMed
  6. ↵
    Schwede, A., Jones, N., Engstler, M. & Carrington, M. The VSG C-terminal domain is inaccessible to antibodies on live trypanosomes. Mol Biochem Parasitol 175, 201–204, doi:10.1016/j.molbiopara.2010.11.004 (2011).
    OpenUrlCrossRefPubMed
  7. ↵
    Sima, N., McLaughlin, E. J., Hutchinson, S. & Glover, L. Escaping the immune system by DNA repair and recombination in African trypanosomes. Open Biol 9, 190182, doi:10.1098/rsob.190182 (2019).
    OpenUrlCrossRef
  8. ↵
    Hertz-Fowler, C. et al. Telomeric expression sites are highly conserved in Trypanosoma brucei. PLoS One 3, e3527, doi:10.1371/journal.pone.0003527 (2008).
    OpenUrlCrossRefPubMed
  9. ↵
    Hovel-Miner, G., Mugnier, M. R., Goldwater, B., Cross, G. A. & Papavasiliou, F. N. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive. PLoS Genet 12, e1005994, doi:10.1371/journal.pgen.1005994 (2016).
    OpenUrlCrossRef
  10. ↵
    Mugnier, M. R., Cross, G. A. & Papavasiliou, F. N. The in vivo dynamics of antigenic variation in Trypanosoma brucei. Science 347, 1470–1473, doi:10.1126/science.aaa4502 (2015).
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Hall, J. P., Wang, H. & Barry, J. D. Mosaic VSGs and the scale of Trypanosoma brucei antigenic variation. PLoS Pathog 9, e1003502, doi:10.1371/journal.ppat.1003502 (2013).
    OpenUrlCrossRefPubMed
  12. ↵
    Jayaraman, S. et al. Application of long read sequencing to determine expressed antigen diversity in Trypanosoma brucei infections. PLoS Negl Trop Dis 13, e0007262, doi:10.1371/journal.pntd.0007262 (2019).
    OpenUrlCrossRef
  13. ↵
    Cross, G. A., Kim, H. S. & Wickstead, B. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427. Mol Biochem Parasitol 195, 59–73, doi:10.1016/j.molbiopara.2014.06.004 (2014).
    OpenUrlCrossRefPubMed
  14. ↵
    Marcello, L. & Barry, J. D. Analysis of the VSG gene silent archive in Trypanosoma brucei reveals that mosaic gene expression is prominent in antigenic variation and is favored by archive substructure. Genome Res 17, 1344–1352, doi:10.1101/gr.6421207 (2007).
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Muller, L. S. M. et al. Genome organization and DNA accessibility control antigenic variation in trypanosomes. Nature 563, 121–125, doi:10.1038/s41586-018-0619-8 (2018).
    OpenUrlCrossRef
  16. ↵
    Berriman, M. et al. The genome of the African trypanosome Trypanosoma brucei. Science 309, 416–422, doi:10.1126/science.1112642 (2005).
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Glover, L., McCulloch, R. & Horn, D. Sequence homology and microhomology dominate chromosomal double-strand break repair in African trypanosomes. Nucleic Acids Res 36, 2608–2618, doi:10.1093/nar/gkn104 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  18. ↵
    McCulloch, R. & Barry, J. D. A role for RAD51 and homologous recombination in Trypanosoma brucei antigenic variation. Genes Dev 13, 2875–2888 (1999).
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Robinson, N. P., Burman, N., Melville, S. E. & Barry, J. D. Predominance of duplicative VSG gene conversion in antigenic variation in African trypanosomes. Mol Cell Biol 19, 5839–5846 (1999).
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Conway, C., Proudfoot, C., Burton, P., Barry, J. D. & McCulloch, R. Two pathways of homologous recombination in Trypanosoma brucei. Mol Microbiol 45, 1687–1700, doi:10.1046/j.1365-2958.2002.03122.x (2002).
    OpenUrlCrossRefPubMedWeb of Science
  21. ↵
    Glover, L., Jun, J. & Horn, D. Microhomology-mediated deletion and gene conversion in African trypanosomes. Nucleic Acids Res 39, 1372–1380, doi:10.1093/nar/gkq981 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Glover, L., Marques, C. A., Suska, O. & Horn, D. Persistent DNA Damage Foci and DNA Replication with a Broken Chromosome in the African Trypanosome. MBio 10, doi:10.1128/mBio.01252-19 (2019).
    OpenUrlCrossRef
  23. ↵
    Burton, P., McBride, D. J., Wilkes, J. M., Barry, J. D. & McCulloch, R. Ku heterodimer-independent end joining in Trypanosoma brucei cell extracts relies upon sequence microhomology. Eukaryot Cell 6, 1773–1781, doi:10.1128/EC.00212-07 (2007).
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Nenarokova, A. et al. Causes and Effects of Loss of Classical Nonhomologous End Joining Pathway in Parasitic Eukaryotes. MBio 10, doi:10.1128/mBio.01541-19 (2019).
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Shibata, A. Regulation of repair pathway choice at two-ended DNA double-strand breaks. Mutat Res 803–805, 51–55, doi:10.1016/j.mrfmmm.2017.07.011 (2017).
    OpenUrlCrossRef
  26. ↵
    Boothroyd, C. E. et al. A yeast-endonuclease-generated DNA break induces antigenic switching in Trypanosoma brucei. Nature 459, 278–281, doi:10.1038/nature07982 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    Glover, L., Alsford, S. & Horn, D. DNA break site at fragile subtelomeres determines probability and mechanism of antigenic variation in African trypanosomes. PLoS Pathog 9, e1003260, doi:10.1371/journal.ppat.1003260 (2013).
    OpenUrlCrossRefPubMed
  28. ↵
    Proudfoot, C. & McCulloch, R. Distinct roles for two RAD51-related genes in Trypanosoma brucei antigenic variation. Nucleic Acids Res 33, 6906–6919, doi:10.1093/nar/gki996 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  29. ↵
    Trenaman, A. et al. Trypanosoma brucei BRCA2 acts in a life cycle-specific genome stability process and dictates BRC repeat number-dependent RAD51 subnuclear dynamics. Nucleic Acids Res 41, 943–960, doi:10.1093/nar/gks1192 (2013).
    OpenUrlCrossRefPubMed
  30. ↵
    Hartley, C. L. & McCulloch, R. Trypanosoma brucei BRCA2 acts in antigenic variation and has undergone a recent expansion in BRC repeat number that is important during homologous recombination. Mol Microbiol 68, 1237–1251, doi:10.1111/j.1365-2958.2008.06230.x (2008).
    OpenUrlCrossRefPubMed
  31. ↵
    Devlin, R. et al. Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation. Elife 5, doi:10.7554/eLife.12765 (2016).
    OpenUrlCrossRef
  32. ↵
    Kim, H. S. & Cross, G. A. TOPO3alpha influences antigenic variation by monitoring expression-site-associated VSG switching in Trypanosoma brucei. PLoS Pathog 6, e1000992, doi:10.1371/journal.ppat.1000992 (2010).
    OpenUrlCrossRefPubMed
  33. ↵
    Kim, H. S. & Cross, G. A. Identification of Trypanosoma brucei RMI1/BLAP75 homologue and its roles in antigenic variation. PLoS One 6, e25313, doi:10.1371/journal.pone.0025313 (2011).
    OpenUrlCrossRefPubMed
  34. ↵
    Black, J. A. et al. Trypanosoma brucei ATR Links DNA Damage Signaling during Antigenic Variation with Regulation of RNA Polymerase I-Transcribed Surface Antigens. Cell Rep 30, 836–851 e835, doi:10.1016/j.celrep.2019.12.049 (2020).
    OpenUrlCrossRef
  35. ↵
    Glover, L. & Horn, D. Locus-specific control of DNA resection and suppression of subtelomeric VSG recombination by HAT3 in the African trypanosome. Nucleic Acids Res 42, 12600–12613, doi:10.1093/nar/gku900 (2014).
    OpenUrlCrossRefPubMed
  36. ↵
    Ciccia, A. & Elledge, S. J. The DNA damage response: making it safe to play with knives. Mol Cell 40, 179–204, doi:10.1016/j.molcel.2010.09.019 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  37. ↵
    Syed, A. & Tainer, J. A. The MRE11-RAD50-NBS1 Complex Conducts the Orchestration of Damage Signaling and Outcomes to Stress in DNA Replication and Repair. Annu Rev Biochem 87, 263–294, doi:10.1146/annurev-biochem-062917-012415 (2018).
    OpenUrlCrossRef
  38. ↵
    Lisby, M., Barlow, J. H., Burgess, R. C. & Rothstein, R. Choreography of the DNA damage response: spatiotemporal relationships among checkpoint and repair proteins. Cell 118, 699–713, doi:10.1016/j.cell.2004.08.015 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  39. ↵
    Myler, L. R. et al. Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair. Mol Cell 67, 891–898 e894, doi:10.1016/j.molcel.2017.08.002 (2017).
    OpenUrlCrossRefPubMed
  40. ↵
    Paull, T. T. & Gellert, M. The 3’ to 5’ exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol Cell 1, 969–979 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  41. ↵
    Zhang, Y., Zhou, J. & Lim, C. U. The role of NBS1 in DNA double strand break repair, telomere stability, and cell cycle checkpoint control. Cell Res 16, 45–54, doi:10.1038/sj.cr.7310007 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Paudyal, S. C. & You, Z. Sharpening the ends for repair: mechanisms and regulation of DNA resection. Acta Biochim Biophys Sin (Shanghai) 48, 647–657, doi:10.1093/abbs/gmw043 (2016).
    OpenUrlCrossRefPubMed
  43. ↵
    Hopfner, K. P. et al. Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily. Cell 101, 789–800, doi:10.1016/s0092-8674(00)80890-9 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  44. ↵
    Oh, J. & Symington, L. S. Role of the Mre11 Complex in Preserving Genome Integrity. Genes (Basel) 9, doi:10.3390/genes9120589 (2018).
    OpenUrlCrossRefPubMed
  45. ↵
    Longhese, M. P. DNA damage response at functional and dysfunctional telomeres. Genes Dev 22, 125–140, doi:10.1101/gad.1626908 (2008).
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Robinson, N. P., McCulloch, R., Conway, C., Browitt, A. & Barry, J. D. Inactivation of Mre11 does not affect VSG gene duplication mediated by homologous recombination in Trypanosoma brucei. J Biol Chem 277, 26185–26193, doi:10.1074/jbc.M203205200 (2002).
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Tan, K. S., Leal, S. T. & Cross, G. A. Trypanosoma brucei MRE11 is non-essential but influences growth, homologous recombination and DNA double-strand break repair. Mol Biochem Parasitol 125, 11–21 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  48. ↵
    Hopfner, K. P. et al. Structural biochemistry and interaction architecture of the DNA double-strand break repair Mre11 nuclease and Rad50-ATPase. Cell 105, 473–485 (2001).
    OpenUrlCrossRefPubMedWeb of Science
  49. ↵
    Laffitte, M. C. et al. Chromosomal Translocations in the Parasite Leishmania by a MRE11/RAD50-Independent Microhomology-Mediated End Joining Mechanism. PLoS Genet 12, e1006117, doi:10.1371/journal.pgen.1006117 (2016).
    OpenUrlCrossRef
  50. ↵
    Hopfner, K. P. et al. The Rad50 zinc-hook is a structure joining Mre11 complexes in DNA recombination and repair. Nature 418, 562–566, doi:10.1038/nature00922 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  51. ↵
    Williams, R. S., Williams, J. S. & Tainer, J. A. Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Biochem Cell Biol 85, 509–520, doi:10.1139/O07-069 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  52. ↵
    De la Rosa, M. B. & Nelson, S. W. An interaction between the Walker A and D-loop motifs is critical to ATP hydrolysis and cooperativity in bacteriophage T4 Rad50. J Biol Chem 286, 26258–26266, doi:10.1074/jbc.M111.256305 (2011).
    OpenUrlAbstract/FREE Full Text
  53. ↵
    Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N. & Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10, 845–858, doi:10.1038/nprot.2015.053 (2015).
    OpenUrlCrossRefPubMed
  54. ↵
    Jackson, S. P. & Bartek, J. The DNA-damage response in human biology and disease. Nature 461, 1071–1078, doi:10.1038/nature08467 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  55. ↵
    Glover, L. & Horn, D. Trypanosomal histone gammaH2A and the DNA damage response. Mol Biochem Parasitol 183, 78–83, doi:10.1016/j.molbiopara.2012.01.008 (2012).
    OpenUrlCrossRefPubMed
  56. ↵
    Stauffer, M. E. & Chazin, W. J. Physical interaction between replication protein A and Rad51 promotes exchange on single-stranded DNA. J Biol Chem 279, 25638–25645, doi:10.1074/jbc.M400029200 (2004).
    OpenUrlAbstract/FREE Full Text
  57. ↵
    Ingram, A. K., Cross, G. A. & Horn, D. Genetic manipulation indicates that ARD1 is an essential N(alpha)-acetyltransferase in Trypanosoma brucei. Mol Biochem Parasitol 111, 309–317 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  58. ↵
    Glover, L. et al. Antigenic variation in African trypanosomes: the importance of chromosomal and nuclear context in VSG expression control. Cell Microbiol 15, 1984–1993, doi:10.1111/cmi.12215 (2013).
    OpenUrlCrossRefPubMed
  59. ↵
    Stockdale, C., Swiderski, M. R., Barry, J. D. & McCulloch, R. Antigenic variation in Trypanosoma brucei: joining the DOTs. PLoS Biol 6, e185, doi:10.1371/journal.pbio.0060185 (2008).
    OpenUrlCrossRefPubMed
  60. ↵
    Connelly, J. C. & Leach, D. R. Tethering on the brink: the evolutionarily conserved Mre11-Rad50 complex. Trends Biochem Sci 27, 410–418 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  61. ↵
    Rico, E., Jeacock, L., Kovarova, J. & Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Sci Rep 8, 7960, doi:10.1038/s41598-018-26303-w (2018).
    OpenUrlCrossRef
  62. Waldrip, Z. J. et al. A CRISPR-based approach for proteomic analysis of a single genomic locus. Epigenetics 9, 1207–1211, doi:10.4161/epi.29919 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  63. ↵
    Zhang, W. W. & Matlashewski, G. CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. MBio 6, doi:10.1128/mBio.00861-15 (2015).
    OpenUrlAbstract/FREE Full Text
  64. ↵
    Grenon, M., Gilbert, C. & Lowndes, N. F. Checkpoint activation in response to double-strand breaks requires the Mre11/Rad50/Xrs2 complex. Nat Cell Biol 3, 844–847, doi:10.1038/ncb0901-844 (2001).
    OpenUrlCrossRefPubMedWeb of Science
  65. ↵
    Marechal, A. & Zou, L. DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb Perspect Biol 5, doi:10.1101/cshperspect.a012716 (2013).
    OpenUrlAbstract/FREE Full Text
  66. ↵
    Laffitte, M. C. et al. Formation of linear amplicons with inverted duplications in Leishmania requires the MRE11 nuclease. PLoS Genet 10, e1004805, doi:10.1371/journal.pgen.1004805 (2014).
    OpenUrlCrossRef
  67. ↵
    Gomes Passos Silva, D. et al. The in vivo and in vitro roles of Trypanosoma cruzi Rad51 in the repair of DNA double strand breaks and oxidative lesions. PLoS Negl Trop Dis 12, e0006875, doi:10.1371/journal.pntd.0006875 (2018).
    OpenUrlCrossRefPubMed
  68. ↵
    Westmoreland, J. et al. RAD50 is required for efficient initiation of resection and recombinational repair at random, gamma-induced double-strand break ends. PLoS Genet 5, e1000656, doi:10.1371/journal.pgen.1000656 (2009).
    OpenUrlCrossRefPubMed
  69. ↵
    Zhu, Z., Chung, W. H., Shim, E. Y., Lee, S. E. & Ira, G. Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double-strand break ends. Cell 134, 981–994, doi:10.1016/j.cell.2008.08.037 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  70. ↵
    Seol, J. H., Shim, E. Y. & Lee, S. E. Microhomology-mediated end joining: Good, bad and ugly. Mutat Res 809, 81–87, doi:10.1016/j.mrfmmm.2017.07.002 (2018).
    OpenUrlCrossRef
  71. ↵
    Barnes, R. L. & McCulloch, R. Trypanosoma brucei homologous recombination is dependent on substrate length and homology, though displays a differential dependence on mismatch repair as substrate length decreases. Nucleic Acids Res 35, 3478–3493, doi:10.1093/nar/gkm249 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  72. ↵
    Briggs, E., Crouch, K., Lemgruber, L., Lapsley, C. & McCulloch, R. Ribonuclease H1-targeted R-loops in surface antigen gene expression sites can direct trypanosome immune evasion. PLoS Genet 14, e1007729, doi:10.1371/journal.pgen.1007729 (2018).
    OpenUrlCrossRef
  73. Briggs, E. et al. Trypanosoma brucei ribonuclease H2A is an essential R-loop processing enzyme whose loss causes DNA damage during transcription initiation and antigenic variation. Nucleic Acids Res, doi:10.1093/nar/gkz644 (2019).
    OpenUrlCrossRef
  74. ↵
    Chang, E. Y. et al. MRE11-RAD50-NBS1 promotes Fanconi Anemia R-loop suppression at transcription-replication conflicts. Nat Commun 10, 4265, doi:10.1038/s41467-019-12271-w (2019).
    OpenUrlCrossRef
  75. ↵
    Balestrini, A. et al. Defining ATM-Independent Functions of the Mre11 Complex with a Novel Mouse Model. Mol Cancer Res 14, 185–195, doi:10.1158/1541-7786.MCR-15-0281 (2016).
    OpenUrlAbstract/FREE Full Text
  76. ↵
    Schlacher, K. et al. Double-strand break repair-independent role for BRCA2 in blocking stalled replication fork degradation by MRE11. Cell 145, 529–542, doi:10.1016/j.cell.2011.03.041 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  77. ↵
    Jehi, S. E., Nanavaty, V. & Li, B. Trypanosoma brucei TIF2 and TRF Suppress VSG Switching Using Overlapping and Independent Mechanisms. PLoS One 11, e0156746, doi:10.1371/journal.pone.0156746 (2016).
    OpenUrlCrossRef
  78. ↵
    Ira, G. & Haber, J. E. Characterization of RAD51-independent break-induced replication that acts preferentially with short homologous sequences. Mol Cell Biol 22, 6384–6392, doi:10.1128/mcb.22.18.6384-6392.2002 (2002).
    OpenUrlAbstract/FREE Full Text
  79. ↵
    Hirumi, H. & Hirumi, K. Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J Parasitol 75, 985–989 (1989).
    OpenUrlCrossRefPubMedWeb of Science
  80. ↵
    van den Hoff, M. J., Moorman, A. F. & Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Res 20, 2902 (1992).
    OpenUrlCrossRefPubMedWeb of Science
  81. ↵
    Jeacock, L., Baker, N., Wiedemar, N., Maser, P. & Horn, D. Aquaglyceroporin-null trypanosomes display glycerol transport defects and respiratory-inhibitor sensitivity. PLoS Pathog 13, e1006307, doi:10.1371/journal.ppat.1006307 (2017).
    OpenUrlCrossRef
  82. ↵
    Alsford, S. & Horn, D. Single-locus targeting constructs for reliable regulated RNAi and transgene expression in Trypanosoma brucei. Mol Biochem Parasitol 161, 76–79, doi:10.1016/j.molbiopara.2008.05.006 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  83. ↵
    Alsford, S. & Horn, D. Single-locus targeting constructs for reliable regulated RNAi and transgene expression in Trypanosoma brucei. Mol Biochem Parasitol 161, 76–79, doi:10.1016/j.molbiopara.2008.05.006 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  84. ↵
    Devlin, R. et al. Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation. eLife 5, e12765, doi:10.7554/eLife.12765 (2016).
    OpenUrlCrossRef
  85. ↵
    Gong, F. & Miller, K. M. Mammalian DNA repair: HATs and HDACs make their mark through histone acetylation. Mutation research 750, 23–30, doi:10.1016/j.mrfmmm.2013.07.002 (2013).
    OpenUrlCrossRefPubMedWeb of Science
  86. ↵
    Woodward, R. & Gull, K. Timing of nuclear and kinetoplast DNA replication and early morphological events in the cell cycle of Trypanosoma brucei. J Cell Sci 95 (Pt 1), 49–57 (1990).
    OpenUrlAbstract/FREE Full Text
  87. ↵
    Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359, doi:10.1038/nmeth.1923 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  88. ↵
    Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079, doi:10.1093/bioinformatics/btp352 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  89. ↵
    Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930, doi:10.1093/bioinformatics/btt656 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  90. ↵
    Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140, doi:10.1093/bioinformatics/btp616 (2010).
    OpenUrlCrossRefPubMedWeb of Science
Back to top
Posted March 17, 2020.
Download PDF
Data/Code
Email
RAD50 promotes DNA repair by homologous recombination and restrains antigenic variation in African trypanosomes
Ann-Kathrin Mehnert, Marco Prorocic, Annick Dujeancourt-Henry, Sebastian Hutchinson, Richard McCulloch, Lucy Glover
bioRxiv 2020.03.17.994905; doi: https://doi.org/10.1101/2020.03.17.994905
Reddit logo Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area