ABSTRACT
Neurospora crassa contains a minimal Polycomb repression system, which provides rich opportunities to explore Polycomb-mediated repression across eukaryotes and enables genetic studies that can be difficult in plant and animal systems. Polycomb Repressive Complex 2 is a multi-subunit complex that deposits mono-, di-, and tri-methyl groups on lysine 27 of histone H3, and tri-methyl H3K27 is a molecular marker of transcriptionally repressed facultative heterochromatin. In mouse embryonic stem cells and multiple plant species, H2A.Z has been found to be co-localized with H3K27 methylation. H2A.Z is required for normal H3K27 methylation in these experimental systems, though the regulatory mechanisms are not well understood. We report here that Neurospora crassa mutants lacking H2A.Z or SWR-1, the ATP-dependent histone variant exchanger, exhibit a striking reduction in levels of H3K27 methylation. RNA-sequencing revealed downregulation of eed, encoding a subunit of PRC2, in an hH2Az mutant compared to wild type and overexpression of EED in a ΔhH2Az;Δeed background restored most H3K27 methylation. Reduced eed expression leads to region-specific losses of H3K27 methylation suggesting that EED-dependent mechanisms are critical for normal H3K27 methylation at certain regions in the genome.
AUTHOR SUMMARY Eukaryotic DNA is packaged with histone proteins to form a DNA-protein complex called chromatin. Inside the nucleus, chromatin can be assembled into a variety of higher-order structures that profoundly impact gene expression. Polycomb Group proteins are important chromatin regulators that control assembly of a highly condensed form of chromatin. The functions of Polycomb Group proteins are critical for maintaining stable gene repression during development of multicellular organisms, and defects in Polycomb proteins are linked to disease. There is significant interest in elucidating the molecular mechanisms that regulate the activities of Polycomb Group proteins and the assembly of transcriptionally repressed chromatin domains. In this study, we used a model fungus to investigate the regulatory relationship between a histone variant, H2A.Z, and a conserved histone modifying enzyme complex, Polycomb Repressive Complex 2 (PRC2). We found that H2A.Z is required for normal expression of a PRC2 component. Mutants that lack H2A.Z have defects in chromatin structure at some parts of the genome, but not others. Identification of PRC2-target domains that are differentially dependent on EED provides insights into the diverse mechanisms that regulate assembly and maintenance of facultative heterochromatin in a simple model system.
Data Reference Numbers GSE146611
INTRODUCTION
In eukaryotes, DNA-dependent processes in the nucleus are regulated by chromatin-based mechanisms (1). One heavily studied group of proteins that are particularly important for maintaining stable gene repression are the Polycomb Group (PcG) proteins. In plants and animal cells, PcG proteins assemble into Polycomb Repressive Complexes 1 and 2 (PRC1 and PRC2), which play key roles in repression of developmental genes, as reviewed in (2-6). PRC2 is a multi-subunit complex that deposits mono-, di-, and tri-methyl groups on lysine 27 of histone H3, and tri-methyl H3K27 is a molecular marker of transcriptionally repressed facultative heterochromatin (7-10). PcG proteins are absent from the model yeasts, Saccharomyces cerevisiae and Schizosaccharomyces pombe, but core PRC2 components have been identified and characterized in several fungi, including Neurospora crassa, Fusarium graminearum, Cryptococcus neoformans, Epichloë festucae, and Fusarium fujikoroi (11-17). In these fungi, PRC2 is required for repression of key fungal genes suggesting that this enzyme complex is functionally conserved between fungi, plants, and animals (13, 14, 18).
In N. crassa, the catalytic subunit of PRC2 is SET-7, a protein with homology to EZH1/EZH2 in humans and curly leaf (CLF), medea (MEA), or swinger (SWN) in Arabidopsis (9, 10, 19-25). N. crassa EED and SUZ12 are respectively homologous to Drosophila Esc and su(z)12, human EED and SUZ12, and Arabidopsis fertilization independent endosperm (FIE; a homolog of EED), and SUZ12 homologs embryonic flower 2 (EMF2), vernalization 2 (VER2), or fertilization independent seed 2 (FIS2) (24, 26, 27). N. crassa CAC-3 (also called NPF) is an accessory subunit homologous to mammalian retinoblastoma binding protein 46/48 (RBAP46/68) in humans, and multicopy suppressor of IRA1-5 (MSI1-5) in Arabidopsis (28-30). In contrast to PRC2, PRC1 components appear to be absent from the fungal kingdom (31).
The presence of a minimal Polycomb repressive system in well studied fungi such as N. crassa provides an opportunity to explore the diversity of Polycomb-mediated repression across eukaryotes and enables genetic studies that can be difficult in plant and animal systems. Indeed, genetic studies have provided insights into PRC2 control in Neurospora. Deletion of CAC-3 causes region-specific losses of H3K27me3 at telomere-proximal domains, and telomere repeat sequences are sufficient to nucleate a new domain of H3K27me3-enriched chromatin (14, 32). In constitutive heterochromatin domains, heterochromatin protein-1 (HP1) prevents accumulaton of H3K27me3 (33, 34). Thus, regulation of H3K27 methylation occurs at multiple levels. Despite recent advances, the mechanisms that regulate PRC2 in fungal systems and eukaryotes in general is poorly understood.
In addition to the core histones (H2A, H2B, H3, and H4), eukaryotes also encode non-allelic histone variants. One of the most conserved and extensively studied histone variants is H2A.Z, which is enriched proximal to transcription start sites (TSS) and in vertebrate enhancers (35-42). Functional studies of H2A.Z have linked presence of this variant in nucleosomes to gene activation, gene repression, maintaining chromatin accessibility, and a multitude of other functions (37, 43-50). Notably, H2A.Z has been implicated in the direct regulation of H3K27 methylation in mouse Embryonic Stem Cells (mESCs) and in plants (51-53). In mESCs, there is a strong correlation between the activity of PRC2, enrichment of H3K27me3, and the presence of H2A.Z (54). Colocalization of SUZ12, a subunit of PRC2, and H2A.Z has been found in mESCs at developmentally important genes, such as HOX clusters (39). In addition, H2A.Z is differentially modified its N- and C-terminal tails at bivalent domains that are “poised” for activation or repression upon differentiation (53, 55). N-terminal acetylation (acH2A.Z) or C-terminal ubiquitylation (H2A.Zub) repress or stimulate the action of PRC2 through interactions with the transcriptional activator BRD2 or the PcG protein complex PRC1 (53). It is important to note that functional studies of H2A.Z are challenging because this histone variant is essential for viability in most organisms, including Drosophila, Tetrahymena, mouse, and Xenopus (56-61).
In Arabidopsis thaliana, a genetic interaction between PICKLE (PKL), a chromatin remodeler which promotes H3K27me3, and PIE-1 (homolog to SWR-1), the remodeler which deposits H2A.Z, was recently reported (52). PKL has been found by ChIP-seq at loci enriched for H3K27me3 and is proposed to determine levels of H3K27me3 at repressed genes in Arabidopsis (62). In rice callus and seedlings, H2A.Z is found at the 5’ and 3’ ends of genes that are highly expressed. In repressed genes, H2A.Z is found along the gene body, and this pattern closely mimics the presence of H3K27me3 (51). This is a notable difference between plants and other eukaryotes.
We investigated the relationship between H2A.Z and PRC2 in the filamentous ascomycete Neurospora crassa and report that H2A.Z is required for normal enrichment of H3K27me2/3 across the genome. Our findings show that loss of H2A.Z leads to region-specific depletion of H3K27me2/3 in N. crassa. Expression levels of eed, encoding a PRC2 subunit, are reduced in the absence of H2A.Z and ectopic expression of eed can restore H3K27me2/3 in an H2A.Z-deficient strain. Together, these data suggest that H2A.Z regulates facultative heterochromatin through transcriptional regulation of the PRC2 component EED and points to differential requirements for EED at discrete PRC2-target domains.
RESULTS
Normal patterns of H3K27me2/3 enrichment require the presence of H2A.Z or SWR-1
Normal H3K27me2/3 patterns in plants and in mESCs depend on the histone variant H2A.Z (39, 52), but the underlying mechanism is poorly understood. To determine if H2A.Z also plays a role in Polycomb Group repression in N. crassa, we performed ChIP-seq to examine H3K27me2/3 enrichment in an H2A.Z deletion strain (ΔhH2Az::hph, hereafter ΔhH2Az) and compared this to wild type. Inspection of the data in the IGV genome browser (63) revealed that the ΔhH2Az mutant displayed a significant reduction in H3K27me2/3 (Figure 1A). To quantify the change in H3K27me2/3 patterns, we called peaks of H3K27me2/3 enrichment using Hypergeometric Optimization of Motif EnRichment (HOMER; version 4.8) (64). We identified 325 peaks of H3K27me2/3 in wild type, hereafter referred to as PRC2-target domains (Table S2). Consistent with previous studies, these peaks comprised ∼6% of the N. crassa genome (14, 33). These regions are typically larger than single genes, ranging in size from 500 bp to 108 kb, with an average size of 7.7 kb. We next plotted H3K27me2/3 levels across the 5’ end of all 325 domains for wild type and ΔhH2Az (Figure 1B). Inspection of heatmaps and the genome browser revealed that H3K27me2/3 levels were reduced in many, but not all PRC2-target domains in ΔhH2Az. Using HOMER software to identify PRC2-target domains in ΔhH2Az revealed 239 peaks (Table S3). These were slightly smaller, with an average size of 5.5 kb, and comprised only 3% of the N. crassa genome. To determine if the peaks observed in the ΔhH2Az strain are in wild type locations we only compared peaks from assembled contigs. Using bedtools intersect we found that all peaks in ΔhH2Az overlap with wild type peaks, indicating that ΔhH2Az exhibits significant loss of H3K27me2/3 from normal domains but does not gain H3K27me2/3 in new locations (Table S4).
Since H2A.Z is required for maintaining genome stability in yeast and animals, our findings raised the possibility that a second site mutation could be responsible for the observed phenotype (46, 47, 65, 66). To confirm that loss of H3K27me2/3 was due to the absence of H2A.Z, we first backcrossed the original deletion strain (FGSC 12088) to wild type (67). Four independent ΔhH2Az progeny all displayed similar reduction in H3K27me2/3 levels (Figure S1). In addition, the backcrossed ΔhH2Az strain displayed slow and variable growth (Figure S2) and was hypersensitive to the DNA damaging agent MMS. This is consistent with previous studies that have demonstrated poor growth of ΔhH2Az in S. cerevisiae and in N. crassa (68, 69).
We next introduced a wild type copy of the hH2Az gene with its native promoter into ΔhH2Az (Figure S3A). This complemented defects in growth and MMS-sensitivity, and fully restored H3K27 methylation, suggesting loss of H2A.Z was responsible for all observed phenotypes in the deletion mutant (Figure 1C and 1D, S2). Because a specific chromatin remodeling complex, SWR1, exchanges H2A.Z for H2A in plants, yeast and animals (69-73), we next examined H3K27me2/3 in a deletion strain lacking the N. crassa homolog of the SWR1 ATPase (Δswr-1). The swr-1 mutant displayed a similar reduction in H3K27me2/3 (Figure 1C and D). Together, these data demonstrate that H2A.Z is required for normal H3K27me2/3 in N. crassa.
Deletion of hH2Az results in region-specific loss of H3K27me2/3
Visual inspection of the ChIP-seq data revealed losses of H3K27me2/3 from PRC2-target domains located at internal (i.e., non-subtelomeric regions >200kb from the telomere repeats) chromosome sites, but not at telomere-proximal sites (i.e., <200kb from the telomere repeats) (Figure 2A). To quantify this, we inspected ChIP-seq results for H3K27me2/3 for both classes and found retention of H3K27 methylation in telomere-proximal regions with progressive loss in domains farther from chromosome ends. Previously published work showed that a cac-3 deficient strain has H3K27me2/3 loss which was primarily observed in the telomere-proximal regions (14); cac-3 encodes an accessory subunit of PRC2 in N. crassa homologous to the conserved PRC2 components Msl1-5, NURF55, Rpbp46/48, found in plants, Drosophila, and humans, respectively. The phenotype reported here for ΔhH2Az appears to be the inverse of the Δcac-3 phenotype (Figure 2A).
To better visualize which regions of the genome in the Δcac-3 or ΔhH2Az strains lose enrichment of H3K27me2/3, we again divided all 325 H3K27me2/3 peaks in the wild type strain into telomere-proximal sites (123 peaks, average size 8,261 bp) (Figure 2B, top) and internal sites (186 peaks, average size 7,509 bp) (Figure 2B, bottom). The loss was again most dramatic at the internal regions in the hH2Az deletion strain, where most PRC2-target domains showed significant reduction of H3K27me2/3 levels. In contrast, we found that telomere-proximal regions show normal levels of H3K27me2/3.
Previous work demonstrated that the placement of repetitive telomere repeat sequences (5’-TTAGGG-3’) in a euchromatic locus can induce de novo H3K27 methylation across large regions (32). Together, these data demonstrate that the absence of H2A.Z is more detrimental for the establishment and/or maintenance of internal domains of H3K27me2/3 in N. crassa.
Neurospora H2A.Z localizes to promoter regions but not to PRC2-target domains
We next asked if H2A.Z co-localizes with H3K27 methylation, as has been reported for plants and mESCs (39, 51, 52). We used a strain expressing a C-terminal H2A.Z-GFP fusion protein to perform ChIP-seq with antibodies against H3K27me2/3 and GFP. Visual inspection of the enrichment profiles in a genome browser revealed a mostly mutually exclusive localization pattern (Figure 3A). There are some small H2A.Z peaks that are found in PRC2 target domains, such as in Figure 3A; however, these were rare (Figure 3B). The genomic locations with the highest enrichment for H2A.Z-GFP are the regions immediately before and after the TSS of most genes, with low enrichment in gene bodies and 3’ ends (Figure 3C). On average we find little enrichment of H2A.Z-GFP in the promoters and gene bodies of H3K27me2/3 enriched genes or at the center of H3K27me2/3 peaks, confirming that H3K27me2/3 and H2A.Z are largely mutually exclusive (Figure 3D and 3E).
To validate H2A.Z enrichment, we also performed ChIP-seq on wild type using an antibody raised against the native N. crassa H2A.Z protein (69). These H2A.Z ChIP-seq experiments show the same localization as the H2A.Z-GFP ChIP-seq experiments (Figure S4). The localization of H2A.Z at the TSS of 5,704 genes (over half of all genes) is similar to findings in multiple other organisms (35-42).
H2A.Z is crucial for proper regulation of one third of the genes in N. crassa, including eed
Previous studies have implicated H2A.Z in multiple roles related to transcription including gene activation and repression (39, 47, 50, 53, 70, 71). We therefore asked if H2A.Z regulates H3K27me2/3 by regulating expression of one or more PRC2 components. We performed RNA sequencing of wild type, ΔhH2Az, Δset-7, and the double mutant ΔhH2Az;Δset-7 to determine which genes exhibit differential expression in the absence of H2A.Z. Deletion of histone variant H2A.Z causes both positive and negative mis-regulation of a large number of genes (Figure 4A). After Benjamini-Hochberg correction (72), there are 3,308 genes with differential transcription (adjusted p value < 0.05). Of these 3,308 genes, there are similar numbers of genes up- and downregulated in the absence of H2A.Z (1,665 genes upregulated and 1,643 downregulated) (Figure 4A, Table S6).
We next examined expression levels of genes encoding individual PRC2 components (Figure 4B). We found that expression of eed is significantly reduced in ΔhH2Az by more than 9-fold (FDR-corrected p value = 2.70 x 1010), whereas cac-3, suz-12, and set-7 were expressed at similar levels in both wild type and ΔhH2Az (Figures 4A and 4B).
The eed gene showed the most dramatic change in expression compared to wild type in either ΔhH2Az or ΔhH2Az;Δset-7, but is expressed normally in the single mutant Δset-7. This indicated that deletion of H2A.Z is likely responsible for its downregulation. As an essential component of PRC2, EED is required for catalytic activity. EED is also important for recognition of the H3K27me2/3 mark and has been implicated in maintenance and/or spreading of H3K27me3 from nucleation sites (73, 74). Since H2A.Z is localized proximal to the promoters of a little over half the genes (5,704) in the N. crassa genome, we examined the H2A.Z localization at the eed gene. There is a large peak of H2A.Z enrichment at the promoter of eed (Figure 4B), which appears to be crucial for normal eed expression. Promoters of other PRC2 components are also enriched for H2A.Z, but apparently are not dependent on H2A.Z for their expression. Together, these data suggest that H2A.Z is required for the proper expression of eed.
Overexpression of EED rescues H3K27 methylation levels in the absence of H2A.Z
To determine if downregulation of eed is responsible for the depletion of H3K27me2/3 observed in ΔhH2Az, we constructed a strain which lacks both eed and hH2Az, and we introduced a 3xflag-eed construct into the his-3 locus driven by the strong constitutive clock controlled gene-1/glucose-repressible gene-1 (ccg-1/grg-1) promoter (his-3::Pccg1-3xflag-eed).
We calculated expected expression levels of this construct using native ccg-1 levels, and we expect eed to be expressed at approximately 100 times the native level. To confirm this construct was being expressed at the same level in both the Δeed and Δeed;ΔhH2Az backgrounds, we performed an anti-FLAG western blot (Figure S3B). Our results confirm that the deletion of H2A.Z does not alter 3xFLAG-EED expression driven by the ccg-1 promoter. After performing H3K27me2/3 ChIP-seq in this strain, we find that the majority of H3K27me2/3 peaks are recovered in the genome (Figure 5A), but the growth rate of the ΔhH2Az strain is not rescued.
There are some qualitative differences in peak shape and not all peaks are fully restored (Figure 5B), which could indicate that H2A.Z contributes to normal H3K27me2/3 via additional mechanisms. Nevertheless, the significant restoration of H3K27me2/3 suggests that reduced eed expression is the major contributor to the loss of H3K27me2/3 in the ΔhH2Az strain.
DISCUSSION
H2A.Z is a highly conserved histone variant that has been linked to gene activation and repression, and control of H3K27 methylation. We report here that N. crassa H2A.Z is required for normal methylation of H3K27 in facultative heterochromatin domains. In contrast to the situation in plants and animals, we find that N. crassa H2A.Z does not colocalize with H3K27me2/3. In undifferentiated mammalian cells and in plant cells, H2A.Z colocalized with PRC2 components, H3K27me3, SUZ12 or both (39, 51-55). In mESCs, H2A.Z is found at developmentally important loci where SUZ12 is also enriched (39, 55). In addition, this histone variant is proposed to regulate lineage commitment by functioning as a “molecular rheostat” to drive either activation or repression of genes (51, 53, 75). This colocalization of PRC2 and H2A.Z is not seen in differentiated murine cells, and ubiquitylated residues on the C-terminal tail of H2A.Z have been hypothesized as integral for cells to maintain undifferentiated status (53, 55). In plants, H2A.Z displays significant co-localization with H3K27me3 in the gene bodies of PcG-repressed genes even in differentiated tissues (51). Our work highlights an important structural difference between facultative heterochromatin in plants and filamentous fungi. Although we did not observe co-localization of H2A.Z and H3K27me2/3 in N. crassa, it remains possible that these two chromatin features overlap in specific developmental cell types (e.g. during sexual development or meiosis). Future work is needed to test this possibility.
In N. crassa we generally find histone H2A.Z at the promoters of a large number of genes in the genome. When viewing the localization using a metaplot, which averages the enrichment of all H2A.Z marked nucleosomes, it appears that H2A.Z flanks the TSS. Genome-wide localization of H2A.Z has been performed in a variety of organisms including Arabidopsis, C. elegans, S. cerevisiae, mouse, and Drosophila. H2A.Z is generally found in the promoters of active and inactive genes, as well as at in vertebrate enhancers (35, 37-42). The +1 nucleosome, first nucleosome after the TSS, containing H2A.Z has been postulated as a lower energy barrier to transcription elongation in Drosophila and Arabidopsis (35, 36). Our data are consistent with an important promoter-specific role for N. crassa H2A.Z.
Indeed, in N. crassa we find that the eed gene contains a large peak of H2A.Z in the +1 nucleosome, and we find that H2A.Z is required for the proper expression of eed. To our knowledge this is the first report of H2A.Z specifically regulating the eed gene. Previous studies in mESCs demonstrate that appropriate binding of multiple factors to the eed promoter are required for the normal expression of eed (76, 77). It is possible that there are N. crassa transcription factors that bind to DNA sequences associated with the H2A.Z-containing nucleosome. Nucleosomes that contain H2A.Z protect approximately 120 bp of DNA from MNase digestion as opposed to nucleosomes with canonical H2A that protect 147 bp (78). This may leave more sequence available for transcription factor binding between H2A.Z-containing nucleosomes.
We observed that reduced eed expression levels leads to region-specific losses of H3K27me2/3, rather than a more general, or global, reduction. In contrast to our work, reduced Eed is reported to cause a global decrease in H3K27me3 in mESCs. In these cells, reduced expression of Eed was observed following downregulation of Oct3/4, which in turn led to a global reduction of H3K27me3, though these studies did not examine genome-wide patterns of H3K27me3 by ChIP-seq as reported here (76, 77). In N. crassa, repetitive sequences (e.g., the canonical telomere repeats) are sufficient to induce an artificial H3K27me3 domain when inserted into a locus normally devoid of H3K27me3 (32). It is interesting that even though we also observe the loss of H3K27 methylation throughout much of the genome, regions proximal to the telomeres retained H3K27me2/3. This might suggest that PRC2 is being recruited to the telomeric region and the downregulation of eed causes a defect in the propagation of the H3K27me2/3 modification into topologically associated, nearby regions. Another possibility is that the internal domains have a special requirement for EED in spreading, or for the maintenance of H3K27 methylation following DNA replication. Alternatively, EED may interact directly with transcription factors that control assembly of facultative heterochromatin at certain internal domains, while other PRC2-associated proteins may be more important for targeting PRC2 to telomeres. Future studies are needed to distinguish between these possible working models.
MATERIALS AND METHODS
Strains and growth media
Strains used in this study are listed in (Table S1). Strains were grown at 32°C in Vogel’s Minimal Medium (VMM) with 1.5% sucrose or glucose for DNA based protocols, and RNA based protocols, respectively (79). Liquid cultures were shaken at 180 rpm. Crosses were performed on Synthetic Crossing (SC) medium in the dark at room temperature (79). Ascospores were collected 14 days after fertilization. To isolate cross progeny, spores were spread on solid VMM plates containing FGS (1X Vogel’s salts, 2% sorbose, 0.1% glucose, 0.1% fructose, and 1.5% agar) and incubated at 65°C for 1 hour as previously described (79), after which spores were picked using a sterile inoculating needle and transferred to agar slants with appropriate medium (typically VMM). To test for sensitivity to DNA damaging agents, 5 µL of a conidial suspension was spotted on VMM containing FGS (1X Vogel’s salts, 2% sorbose, 0.1% glucose, 0.1% fructose, and 1.5% agar) plates containing concentrations of methyl methanesulfonate (Sigma Aldrich cat. # 129925-5g) between 0.010% and 0.03% (w/v).
To construct the N-terminal FLAG-tagged eed allele, we amplified the eed region with primers, MK #51: GGCGGAGGCGGCGCGATGCAAATTTGTCGGGACCG and MK #52: TTAATTAATGGCGCGTTACTTCCCCCACCGCTGAA (Table S5), from wild type genomic DNA (FGSC 4200). The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain. Primary transformants were selected on VMM plates, and then back-crossed to wild type to isolate homokaryons (his-3::Pccg-1-3xflag-eed). We next crossed the homokaryon (his-3::Pccg-1-3xflag-eed) to Δeed::hph (FGSC 14852) to obtain Δeed;his-3::Pccg-1-3xflag-eed. 3xFLAG-EED expression and deletion of eed deletion were confirmed by western blots probed with anti-FLAG antibody (Sigma Aldrich, cat. # F1804) and genotyped by PCR with primers, LL #155: TCGCCTCGCTCCAGTCAATGACC and LL #466: TGTGGGCGATTTGAGCGTGC, respectively. The Δeed;his-3::Pccg-1-3xflag-eed strain was then crossed to the ΔhH2Az::hph (FGSC 12088) strain to obtain ΔhH2Az;Δeed;his-3::Pccg-1-3xflag-eed. 3xFLAG-EED expression and deletion of eed were confirmed by western blots with anti-FLAG antibody (Sigma Aldrich, cat. # F1804) and genotyping with eed deletion primers (see above). Deletion of hH2Az was confirmed by PCR with primers AC #24: GAACAAGCCGATTGCTGTCC and AC #23: TGTATAGAACGCTGCCAAGGA.
For the H2AZ-GFP gene replacement construct, a 1-kb segment including the end of the hH2Az coding region was amplified by PCR with primers #1577: CGGAAAGGGCAAGTCGTCTG and #1578: CCTCCGCCTCCGCCTCCGCCGCCTCCGCCAGCCTCCTGAGCCTTGGCCT and a 500-bp segment of the 3’ flanking region was amplified with primers #1579: TGCTATACGAAGTTATGGATCCGAGCTCGCTGCACCGAAAAACTCGACG and #1580: GTGACGAGGGGAGATTGCTC. The cassettes containing the GFP segment and the hph gene were amplified using M13 forward and reverse primers from pGFP::hph::loxP (80). The three fragments were mixed and then assembled by overlapping PCR with primers #1577 and #1580 above. The cassette was transformed into the Δmus-52 strain (FGSC 15968) by electroporation.
Transformation and complementation assays
Transformations were performed as previously described (81). To carry out ectopic complementation of the ΔhH2Az::hph strain, two linear gene fragments were electroporated into the mutant strain. Specifically, the bar (confers Basta resistance) was amplified with primers LL #148 CCGTCGACAGAAGATGATATTGAAGGAGC and LL #149 AATTAACCCTCACTAAAGGGAACAAAAGC (82) and the wild type hH2Az gene fragment including its native promoter (genomic coordinate 1390154-1393398 of GCA_000182925.2 assembly accession) was amplified with primers AC #27 CCCAATCCTAGAATCCCGTCG and AC #21 TAAAAGAGCTGCTGTCGCACG, and fragments were co-integrated into the ΔhH2Az::hph strain, followed by selection of transformants on Basta-containing plates (VMM with 2% sorbose, 0.1% glucose, 0.1% fructose, 1.5% agar, and 200 ug/mL Basta). Transformants were transferred to agar slants and then screened by PCR, and Southern blots with the North2South Biotin Random Prime Labeling and Detection Kit (ThermoFisher cat. #17175) and the wild type hH2Az gene fragment used as a probe.
Race tube assay
Race tubes were prepared with 15 mL of VMM plus 1.5% sucrose and 1.5% agar. Strains were grown on VMM plates with 1.5% sucrose and 1.5% agar for 16 hours before using a 6mm cork borer to extract mycelial agar plugs from the edge of growing hyphae. This plug was used for inoculating each tube at one end. Strains were inoculated in triplicate. Measurements were taken at 9, 23, 47 and 60 hours to determine linear growth rates.
Protein extraction and western blotting
Strains were grown at 32°C shaken in 18×150mm glass test tubes at 180rpm in 5 mL VMM with 1.5% sucrose. After 16 hours, tissue was harvested using filtration, washed once in phosphate buffered saline (PBS), and suspended in 1 mL of ice-cold protein extraction buffer (50mM HEPES pH 7.5, 150mM NaCl, 0.02% NP-40, 1mM EDTA, 1mM phenylmethylsulfonyl fluoride [PMSF; Sigma, P7626], one tablet Roche cOmplete mini EDTA-free Protease Inhibitor Cocktail [Roche, cat. # 11836170001]). Tissue was subjected to sonication by Diagenode Bioruptor UCD-200 to deliver 22.5 30 second pulses at 4°C. After two rounds of centrifugation at 13,200 rpm for 10 minutes, supernatant was mixed with 2x Laemmli buffer and boiled for 5 minutes. Samples were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes in Tris-Glycine transfer buffer (25mM Tris, 200mM glycine) containing 20% methanol at constant 100V for 1 hour at 4°C. Membranes were blocked with Tris-buffered saline (TBS; 10 mM Tris, pH 7.5, 150mM NaCl) including 3% milk powder for 1 hour and incubated overnight with anti-FLAG antibody (Sigma Aldrich, cat. # F1804) in TBS plus 3% milk. Detection was performed with horseradish peroxidase-conjugated secondary antibodies and SuperSignal West Femto chemiluminescent substrate (ThermoFisher, cat. # 34094).
Chromatin immunoprecipitation (ChIP)
To carry out ChIP, conidia were inoculated in 5 mL of liquid VMM plus 1.5% sucrose and grown for 18 hours for wild type and other strains with typical growth rates. Slow growing ΔhH2Az::hph strains were grown for 24 hours to isolate cultures at a similar developmental stage. ChIP was performed as described previously (83-85). In brief, mycelia were harvested using filtration and were washed once in PBS prior to cross-linking for 10 minutes in PBS containing 1% formaldehyde on a rotating platform at room temperature. After 10 minutes, the reaction was quenched using 125mM glycine and placed back on the rotating platform for five minutes. Mycelia were harvested again using filtration, washed once with PBS, then resuspended in 600 µl of ChIP lysis buffer (50mM HEPES, pH 7.5, 140mM NaCl, 1mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, one tablet Roche cOmplete mini EDTA-free Protease Inhibitor Cocktail (Roche, cat. # 11836170001) in 15 mL conical tubes. Chromatin was sheared by sonication after lysing cell walls with the QSONICA Misonix S-4000 ultrasonic processor (amplitude 10, 30 second processing, one second on, one second off), using the Diagenode Bioruptor UCD-200 (Intensity level: Medium, three rounds of 15 minutes (30 seconds on, 30 seconds off) to deliver 22.5 30 second pulses at 4°C. Water temperature was kept at a constant 4°C by using a Biorad cooling module (cat. # 170-3654) with variable speed pump to circulate 4°C water while processing samples. Lysates were centrifuged at 13,000 rpm in an Eppendorf 5415D microcentrifuge for five minutes at 4°C. For ChIP reactions with antibodies against N. crassa H2A.Z, 1 µl, 2.5 µl, or 5 µl of antibody was used (antibody supplied by Dr. Qun He, China Agricultural University). For detection of H3K27 di- and tri-methylation (H3K27me2me3; Active Motif 39535), and GFP-tagged H2A.Z (GFP; Rockland 600-301-215) 1 µl of the relevant antibody was used. Protein A/G beads (20 µl) (Santa Cruz, cat. # sc-2003) were added to each sample. Following overnight incubation, beads were washed twice with 1 mL lysis buffer without protease inhibitors, once with lysis buffer containing 500mM NaCl, once with lysis buffer containing 50mM LiCl, and finally with TE (10mM Tris-HCl, 1mM EDTA). Bound chromatin was eluted in TES (50mM Tris pH 8.0, 10mM EDTA, 10% SDS) at 65°C for 10 minutes. Chromatin was de-crosslinked overnight at 65°C. The DNA was treated with RNase A for two hours at 50°C, then with proteinase K for two hours at 50°C and extracted using phenol-chloroform-isoamyl alcohol (25:24:1) followed by chloroform extraction. DNA pellets were washed with 70% ethanol and resuspended in TE buffer. Samples were then prepared for Illumina sequencing.
RNA extraction
Conidia were inoculated into 100 x 15mm plates containing 25 mL of VMM + 1.5% glucose and grown for 36-48 hours to generate mycelial mats. Using a 9mm cork borer, 5-7 disks were cut out of the mycelial mat and transferred to 125 mL flasks with 50 mL of VMM + 1.5% glucose and allowed to grow for 12 hours at 29°C in constant light while agitating at ∼90-100 rpm. Disks were harvested using filtration and flash frozen with liquid nitrogen. Frozen tissue was transferred to 1.5 mL RNase-free tubes with 100 µl sterile RNase-free glass beads and vortexed to lyse tissue in phenol:chloroform (5:1) pH 4.5. Three sequential acid phenol:chloroform extractions were performed followed by ethanol precipitation using two volumes of ethanol and 1/10 volume of 3M NaOAc pH 5.2, incubated overnight at −20°C. Samples were centrifuged at 13,2000 rpm in 4°C for 30 minutes and pellets were then washed in RNase-free 70% ethanol, and resuspended in RNase-free water. Samples were quantified using the Invitrogen Qubit 2.0 fluorometer (cat. # Q32866) and RNA quality was checked on a denaturing agarose gel. After quality was verified 10 µg of RNA for each sample was subjected to Turbo DNase treatment (Invitrogen, cat. # AM2238) at 37°C for 30 minutes and then another acid phenol:chloroform extraction was performed to inactivate enzyme and purify the RNA. Samples were subjected to another ethanol precipitation as described above, this time with the addition of 1 µL of RNase-free glycogen (5 mg/mL). Samples were centrifuged at 13,200 rpm in 4°C for 30 minutes and the pellets were washed with RNase-free 70% ethanol, then resuspended in RNase-free water. Quality and quantity were again checked with denaturing gel and with the Invitrogen Qubit 2.0 fluorometer. Samples were then prepared for Illumina sequencing.
ChIP library preparation
Libraries were constructed as described (83-85). In brief, the NEBNext Ultra II End Repair/dA-tailing Module (cat. # E7546S), NEBNext Ultra II Ligation Module (cat. # E7546) were used to clean and A-tail DNA after which Illumina adapters were ligated. The ligation products were amplified to generate dual-indexed libraries using NEBNext Ultra II Q5 Hot Start HiFi PCR Master Mix (cat. # M0543S). Size selection with magnetic beads was performed after the adapter ligation and PCR steps with Sera-Mag SpeedBeads (cat. # 65152105050250) suspended in a solution of (20mM PEG 8000, 1mM NaCl, 10mM Tris-HCl, 1mM EDTA) (86).
RNA library preparation
Libraries were prepared according to the Illumina TruSeq mRNA stranded Library Kit (cat. # RS-122-2101). In brief, mRNA selection via polyA tails was performed using RNA purification beads and washed with bead washing buffer. Fragmentation and cleanup were performed enzymatically using the Fragment, Prime, Finish Mix and incubated at 94°C for eight minutes. First strand synthesis using the SuperScript II RT enzyme and First Strand Synthesis Act D Mix was incubated as described and second strand synthesis used the Second Strand Marking Mix with resuspension buffer was incubated for one hour to generate cDNA. The final steps in the library preparation are the same as the above ChIP-seq library preparation with exception of two extra bead cleanup steps: one prior to A-tailing and adapter ligation, two after adapter ligation.
Libraries were pooled and sequenced on a NextSeq500 instrument at the Georgia Genomics and Bioinformatics Core to generate single or paired-end reads.
Data Analysis
For ChIP-seq data, short reads (<20 bp) and adaptor sequences were removed using TrimGalore (version 0.4.4), cutadapt version 1.14 (87), and Python 2.7.8, with fastqc command (version 0.11.3). Trimmed Illumina reads were aligned to the current N. crassa NC12 genome assembly available from NCBI (accession # GCA_000182925.2) using the BWA (version 0.7.15) (88), mem algorithm, which randomly assign multi-mapped reads to a single location. Files were sorted and indexed using SAMtools (version 1.9) (89). To plot the relative distribution of mapped reads, read counts were determined for each 50 bp window across the genome using DeepTools to generate bigwigs (version 3.3.1) (90) with the parameters –normalizeUsing CPM (counts per million) and data were displayed using the Integrated Genome Viewer (63). The Hypergeometric Optimization of Motif EnRichment (HOMER) software package (version 4.8) (64) was used to identify H3K27me3 peaks in wild type and ΔhH2Az against input using “findPeaks.pl” with the following parameters: -style histone. Bedtools (version 2.27.1) “intersect” (version 2.26.0) was used to determine the number of peaks that intersect with other peak files. Heatmaps, Spearman correlation matrix (Figure S5) and line plots were constructed with DeepTools (version 3.3.1) (90).
For RNA-seq data, short reads (<20 bp) and adaptor sequences were removed using TrimGalore (version 0.4.4), cutadapt version 1.14 (87), and Python 2.7.8, with fastqc command (version 0.11.3). Trimmed Illumina single-end reads were mapped to the current N. crassa NC12 genome assembly using the Hierarchical Indexing for Spliced Alignment of Transcripts 2 (HISAT2: version 2.1.0) (91) with parameters –RNA-strandness R then sorted and indexed using SAMtools (version 1.9) (89). FeatureCounts from Subread (version 1.6.2) (92) was used to generate gene level counts for all RNA bam files. Raw counts were imported into R and differential gene expression analysis was conducted using Bioconductor: DeSeq2 (93). Volcano plot and box plots were generated in R using DeSeq2 and ggplot2 (94).
Data Deposition
Raw sequence data associated with this paper are available through the NCBI GEO database (accession # GSE146611).
SUPPLEMENTAL FIGURE LEGENDS
Figure S1: ΔhH2Az replicates demonstrating depletion of H3K27me2/3
Genome browser images of two wild type progeny (top two tracks), and initial four backcrossed sibling hH2Az deletion strains on chromosome V. Segment shown at higher resolution to visualize loss of H3K27me2/3.
Figure S2: ΔhH2Az exhibits a slow growth phenotype and is hypersensitive to MMS
A) MMS Spot test with increasing concentrations of MMS (5 and 10x more hH2Az (S532) conidia was used for growth comparable to wild type on sorbose) and decreasing concentrations of conidia.
B) Linear growth rate from race tubes from ΔhH2Az+hH2Azwt (ACt9-3), Δswr-1, ΔhH2Az (S532), and wild type in triplicate.
C) Image of race tubes growing strain in (B) in triplicate.
Figure S3: Southern Blot confirming ectoptic integration of hH2Az gene fragment into N. crassa
A) Southern blot of wild type, ΔhH2Az, and two ectopic complemented strains (ΔhH2Az+hH2Azwt). Distinct bands in wild type (left arrow) and ΔhH2Az. Band corresponding to ΔhH2Az and larger band seen in ectopic complemented strains (right arrows). hH2A.z integration was also confirmed by PCR.
B) FLAG western blot displaying the same expression level of 3xFLAG-EED in both Δeed and Δeed;ΔhH2Az background. 3xFLAG-EED indicated by black arrow (expected size 77.5kD).
Figure S4: Increasing N. crassa H2A.Z antibody concentration improves ChIP-seq resolution
A) Genome browser image of increasing amount of H2A.Z antibody (1 µL, 2.5 µL, 5 µL).
B) H2A.Z antibody ChIPs in wild type with increasing amounts of H2A.Z antibody. 5 µL is the optimal amount of the H2A.Z antibody to use for the highest resolution of H2A.Z enriched regions.
Figure S5: Correlation matrix for ChIP-seq replicates
Spearman correlation matrix for ChIP-seq replicates used in this study
SUPPLEMENTAL TABLES
Table S1: Strains used in this study
Table S2: H3K27me2/3 domains determined with HOMER for wild type
Table S3: H3K27me2/3 domains determined with HOMER for ΔhH2Az
Table S4: H3K27me2/3 domains in common between ΔhH2Az and wild type
Table S5: Oligonucleotides used in this study
Table S6: Misregulated genes in ΔhH2Az
Acknowledgements
This work was supported by grants from the American Cancer Society (RSG-14-184-01-DMC) and the NIH (R01GM132644) to Z.A.L and the National Science Foundation Graduate Research Fellowship Program Grant (DGE-1443117) to A.J.C. We thank the undergraduate students who contributed to this work JongIn Hwang, Vlad Sirbu, Jacqueline Nutter, and Preston Trevor Neal. We are grateful to Robert J. Schmitz and Christina Ethridge for RNA-seq library support and the Georgia Genomic and Bioinformatics Core for sequencing.
References
- 1.↵
- 2.↵
- 3.
- 4.
- 5.↵
- 6.↵
- 7.↵
- 8.
- 9.↵
- 10.↵
- 11.↵
- 12.
- 13.↵
- 14.↵
- 15.
- 16.
- 17.↵
- 18.↵
- 19.↵
- 20.
- 21.
- 22.
- 23.
- 24.↵
- 25.↵
- 26.↵
- 27.↵
- 28.↵
- 29.
- 30.↵
- 31.↵
- 32.↵
- 33.↵
- 34.↵
- 35.↵
- 36.↵
- 37.↵
- 38.
- 39.↵
- 40.
- 41.
- 42.↵
- 43.↵
- 44.
- 45.
- 46.↵
- 47.↵
- 48.
- 49.
- 50.↵
- 51.↵
- 52.↵
- 53.↵
- 54.↵
- 55.↵
- 56.↵
- 57.
- 58.
- 59.
- 60.
- 61.↵
- 62.↵
- 63.↵
- 64.↵
- 65.↵
- 66.↵
- 67.↵
- 68.↵
- 69.↵
- 70.↵
- 71.↵
- 72.↵
- 73.↵
- 74.↵
- 75.↵
- 76.↵
- 77.↵
- 78.↵
- 79.↵
- 80.↵
- 81.↵
- 82.↵
- 83.↵
- 84.
- 85.↵
- 86.↵
- 87.↵
- 88.↵
- 89.↵
- 90.↵
- 91.↵
- 92.↵
- 93.↵
- 94.↵