ABSTRACT
The choroid plexus (ChP) produces cerebrospinal fluid and forms a critical barrier between the brain and the circulation. While the ChP forms in each brain ventricle, it adopts a different shape in each one and remarkably little is known about the mechanisms underlying its development. Here, we show that epithelial WNT5A is critical for determining fourth ventricle (4V) ChP morphogenesis and size. Systemic Wnt5a knockout, or forced WNT5A overexpression beginning at E10.5, profoundly reduced the size and development of ChP in all ventricles. However, conditional deletion of Wnt5a expression in Foxj1-expressing epithelial cells affected only the branched, villous morphology of the 4V ChP. We found that WNT5A was enriched in epithelial cells localized to the distal tips of 4V ChP villi, where WNT5A acted locally to activate non-canonical Wnt signaling via Ror1/Ror2 receptors. During 4V ChP development, MEIS1 bound to the proximal Wnt5a promoter, and gain- and loss-of-function approaches demonstrated that MEIS1 regulated Wnt5a expression. Collectively, our findings demonstrate a dual function of WNT5A in ChP development and identify MEIS1 and MEIS2 as upstream regulators of Wnt5a in the 4V ChP epithelium.
INTRODUCTION
The choroid plexus (ChP) is a sheet of predominantly epithelial cells that produces cerebrospinal fluid (CSF), secretes factors important for brain development, and forms a critical blood-brain barrier (Chau et al., 2015; Fame and Lehtinen, 2020; Ghersi-Egea et al., 2018; Lehtinen et al., 2011; Silva-Vargas et al., 2016).
ChP tissue is specified during the early stages of brain development (Hunter and Dymecki, 2007), and forms at, or near, the dorsal midline in each ventricle in the brain (lateral ventricle, LV; third ventricle, 3V; fourth ventricle, 4V; Currle et al., 2005). As progenitor cells proliferate and mature into epithelial cells, the epithelial sheet extends in a conveyor belt-like manner into the ventricles (Dani et al., 2019; Liddelow et al., 2010). Interactions between the maturing epithelial cells and the surrounding cellular network of mesenchymal (Wilting and Christ, 1989) and vascular cells (Nielsen & Dymecki, 2010) transform the growing epithelium to adopt its mature form.
The ChP tissues are regionally patterned, and they harbor distinct transcriptomes resulting in ventricle-specific secretomes (Dani et al., 2019; Lun et al., 2015). These findings raise the possibility that local CSF environments are tailored to instruct development of adjacent brain areas. Indeed, the 4V ChP expresses high levels of WNT5A, which is released into the CSF, associates with lipoprotein particles, and influences hindbrain morphogenesis (Kaiser et al., 2019). In mouse, the ChP also appears morphologically distinct in different ventricles; the LV ChP consists of two nearly flat, leaf-like epithelial sheets, while in the 3V and 4V, the ChP adopts a more complex, frond-like structure (Dani et al., 2019). However, despite a general understanding of the key steps required for ChP formation, surprisingly little is known about the molecular mechanisms underlying differences in ChP morphogenesis in these different ventricles.
Wnt5a signaling represents one compelling candidate signaling pathway for regulating ChP development. Systemic Wnt5a-deficiency was recently reported to impair ChP development in the LV, 3V and 4V ChP (Langford et al., 2020). However, Wnt5a transcription and production is mainly restricted to the epithelium of 4V ChP during development (Kaiser et al., 2019). As such, the molecular mechanisms that regulate the regionalized expression of Wnt5a in the ChP and its time- and cell-type restricted functions remain to be elucidated.
Overall, Wnt signaling encompasses highly conserved signaling pathways involved in the regulation of numerous physiological processes during embryonic development and in adulthood (Saito-Diaz et al., 2013). Wnt proteins (WNTs) represent a large family of lipid-modified glycoproteins acting as extracellular ligands that activate either a canonical cascade, mediated by the active β-catenin, or the non-canonical branches of the WNT pathway, depending on ligand binding to a large repertoire of cogent receptors (Niehrs, 2012). Among the WNTs, WNT5A represents a prototypical non-canonical WNT ligand, predominantly linked to the activation of the planar cell polarity (Wnt/PCP) pathway (Kumawat and Gosens, 2015), where it influences various aspects of tissue patterning and establishment of cell polarity (Humphries and Mlodzik, 2018). Notably, WNT5A mediates conserved roles in the outgrowth of body structures including budding tentacles in Hydra or limbs and distal digits in mouse (Philipp et al., 2009; Yamaguchi et al., 1999). As such, WNT5A, with its expression mainly restricted to the epithelium of 4V ChP, is an ideal candidate factor for regulating the formation of the complex frond-like shape of the 4V ChP.
Here, we elucidate WNT5A’s dual roles in 4V ChP development. First, at early stages of ChP development, Wnt5a temporal expression and dosage are essential for establishing the blueprint for ChP morphogenesis and size. Second, at later stages of ChP development, WNT5A expression and secretion is enriched at the distal tips of 4V ChP epithelium where it acts either locally to activate components of the Wnt/PCP pathway in an autocrine manner or is released into the CSF for long-range signaling. At this later developmental stage, MEIS1 binds to the Wnt5a proximal promoter to regulate Wnt5a expression in the 4V ChP. Collectively, our findings reveal two distinct developmental stages at which WNT5A plays important roles in establishing 4V ChP form and function.
RESULTS
Epithelial WNT5A expression is required for 4V ChP morphogenesis
We previously demonstrated that, during development (E14.5), Wnt5a expression is enriched in the mouse 4V ChP epithelium in contrast to the LV ChP (Kaiser et al., 2019) (Fig. 1A). Wnt5a expression was most prominent at the distal tips of epithelial villi (Fig. 1B, C; arrowheads and empty arrowheads). Upon closer inspection of 4V ChP epithelial cells, we observed segregation of WNT5A signal to the apical cell membrane, denoted by Aquaporin-1 (AQP1) staining (Fig. 1D, arrowhead), and to the basolateral cell membrane (Fig. 1D empty arrowhead), as if poised for local and long-range release. Using a ChP epithelium-based transwell system, we confirmed bi-directional secretion of WNT5A apically and basally by embryonic 4V ChP epithelia (Supp. Fig. 1A). Analysis of human fetal brain specimens (week 9 post conception) confirmed WNT5A expression on the apical and basolateral sides of the 4V ChP epithelium (Fig. 1E, arrowhead and empty arrowhead, respectively) suggesting Wnt5a may have evolutionarily conserved roles in the ChP.
We analyzed the functional consequences of Wnt5a-deficiency employing several different mouse models. Phenotypic analysis of Wnt5a null mutants (Wnt5aKO) (Yamaguchi et al., 1999) revealed severe impairment of 4V ChP development as demonstrated by decreased size and reduced branching morphology when compared to the wild-type control embryos (Wnt5aWT) (Fig. 1F-I and Supp. Fig. 1B), in agreement with others (Langford et al., 2020). In the most severe Wnt5aKO cases, the 4V ChP lacked its characteristic convoluted structure and resembled instead the simpler sheet-like shape of the LV ChP (Supp. Fig. 1C). We also confirmed the previously reported disruption of LV ChP morphogenesis in Wnt5aKO embryos which was characterized by collapsed growth and impaired protrusion of the tissue into the lumen of the ventricle (Supp. Fig. 1D) accompanied by general shortening of the tissue (Supp. Fig. 1E, F). We investigated whether the observed morphological differences in 4V ChP were due to altered proliferative or apoptotic activity. No differences were observed in the EdU incorporation rate (delivered at E13.5 and analyzed at E16.5) when markers of proliferation (KI67) in mature epithelial cells (AQP1) were examined in the 4V ChP epithelium of Wnt5aKO ChP (Supp. Fig. 1 G-I). Similarly, no changes in apoptotic activity analyzed by cleaved caspase 3 (CASP3) staining were detected in the embryonic 4V ChP between Wnt5aKO and control littermates (Supp. Fig. 1J), suggesting that any contributions in these processes to the phenotypes observed must have occurred earlier in development.
Next, we conditionally knocked out Wnt5a (Wnt5acKO) in ChP epithelial cells during earlier stages of ChP development using an inducible Foxj1 promoter-driven CREERT2 system (Kaiser et al., 2019) (Supp. Fig. 2A, B). In line with the reported properties of the Cre-lox recombination system (Nakamura et al., 2006) we observed the loss of WNT5A protein approximately 24 hours following tamoxifen injection (Supp. Fig. 2C). Tissue-specific ablation of WNT5A in 4V ChP epithelium of Wnt5acKO vs. control embryos persisted at least till E16.5 when tamoxifen is injected at E12.5 (Supp. Fig. 2D). WNT5A was readily detected in the domain adjacent to the 4V ChP where FoxJ1 is not expressed in both E16.5 Wnt5aWT and Wnt5acKO embryos (Supp. Fig. 2E). The concomitant loss of WNT5A immunoreactivity in the stromal compartment of the Wnt5acKO 4V ChP strongly suggested ChP epithelial cells as the primary source of WNT5A for this compartment (Supp. Fig. 2E).
The specific timing of Wnt5a ablation had strikingly different effects on the developing 4V ChP. Induction of Cre recombination by tamoxifen injection at E11.5 profoundly disrupted the overall size and branching morphology of the 4V ChP in Wnt5acKO (Fig. 1J, K), when analyzed at E16.5. In contrast, induction of Cre recombination at E12.5 failed to induce a visible phenotype in the E16.5 4V ChP (Fig. 1L-O). The morphological defects observed following E11.5 Cre-recombination were regionalized within the 4V ChP, being most pronounced in the ventral part of the 4V ChP, located next to the lower rhombic lip (LRL) region as compared to the more lateral region of the ChP adjacent to the upper rhombic lip (URL) region (Supp. Fig. 2F, arrowheads). Consistent with the systemic Wnt5aKO-embryos, no obvious differences in either proliferative (EdU+ and KI67+ cells) or apoptotic cell death (CASP3) markers were again observed at E14.5 (Supp. Fig. 2G, H). In contrast with the findings in the systemic Wnt5aKO embryos (Supp. Fig. 1 D-F), we did not detect any morphological changes in the developing LV ChP in Wnt5acKO embryos (Supp. Fig. 2I-K). Taken together, these data demonstrate that the Wnt5a expression between E11.5 and E12.5 is essential for establishing the blueprint for 4V ChP morphogenesis and size. In turn, Wnt5a-deficiency at this early stage has profound, long-lasting consequences on ChP morphology, and as such, differences in proliferation and apoptotic cell death were not apparent when examined at later ages.
Wnt5a overexpression during late embryogenesis results in defective morphogenesis of embryonic ChPs
Wnt5a dosage, demonstrated by both ablation and ectopic overexpression studies, was previously reported to affect the morphogenesis of the small intestine (Cervantes et al., 2009, van Amerongen et al., 2012), a simple columnar epithelium with similarities to the ChP (Grosse et al., 2011). To determine the consequences of supplemental WNT5A on the 4V ChP, we employed a previously established model for Wnt5a overexpression (van Amerongen et al., 2012) (Wnt5aOE). In this system, global overexpression is driven by the Rosa26 promoter. In these mice, ectopic FLAG-WNT5A expression matched the spatial pattern of endogenous WNT5A distribution we had observed under normal physiological conditions (Fig. 1J and Supp. Fig. 2D)(Kaiser et al., 2019). Higher FLAG-WNT5A was detected in embryonic 4V ChP vs. surrounding regions (Fig. 2A; arrowheads). We also observed FLAG-WNT5A expression in other brain regions that typically express Wnt5a including the cortical hem (Fig.2B and Supp. Fig. 3A; arrowheads). In the 4V ChP, FLAG-WNT5A localized to the cytoplasm of epithelial cells and revealed limited local spreading within the surrounding 4V ChP extracellular space (Fig. 2C, arrowheads and empty arrowheads).
Wnt5a overexpression had detrimental consequences on the formation of the 4V ChP that were characterized by considerable reduction of its overall size and decreased complexity of its branched, villous structure (Fig. 2D-G). This effect probably relates to overactivation of WNT5A signaling early on in epithelial cells where future 4V ChP will arise as evidenced by presence of AQP1+ cells (Supp. Fig. 3B). As with the knockout experiments, we did not observe any changes in Ki67 or CASP3 immunoreactivity in the E14.5 4V ChP of Wnt5aOE embryos as compared to Wnt5aWT littermate controls (Supp. Fig. 3C, D, arrowheads). We also noted increased FLAG-WNT5A expression in LV ChP epithelial cells of Wnt5aOE embryos as compared to controls (Fig. 2H, arrowheads and empty arrowheads). Only minor effects of Wnt5a overexpression on LV ChP size and length were observed (Fig. 2I-K). Taken together, our data demonstrate that ChP morphogenesis relies on tightly regulated WNT5A-dosage, likely stipulated at the earliest stages of ChP development.
WNT5A promotes activation of non-canonical WNT signaling in 4V ChP
At E16.5, WNT5A localizes to the distal tips of the 4V ChP epithelium (Fig. 1B, C) and can be released apically into the CSF for long-range signaling to instruct hindbrain development (Kaiser et al., 2019). In addition, WNT5A can be released basally (Fig.1 D-E and Supp. Fig. 1A) for potential local signaling within the ChP. To address the extent of WNT5A signaling activation we performed biochemical analyses of LV and 4V ChP tissue lysates. The activation leads to phosphorylation of several downstream signaling pathway components - namely WNT5A receptors ROR1 and ROR2 (Grumolato et al., 2010; Ho et al., 2012; Yamamoto et al., 2007) and a key signaling mediator Dishevelled-2 (DVL2) (Bryja et al., 2007).This activation can be detected by Western blotting as a phosphorylation-dependent mobility shift. Using this approach, we discovered considerably strong activation of Wnt signaling in the embryonic 4V ChP compared to LV ChP during late embryogenesis (Fig. 3A and Supp. Fig. 4A). Knock out of WNT5A in HEK293 cells mimicked the differences between 4V and LV ChP suggesting that activation of these readouts depended on WNT5A (Supp. Fig. 4B). Indeed, Wnt5a ablation in both Wnt5aKO and Wnt5acKO ChPs resulted in the loss of induction of non-canonical WNT pathway components, thus demonstrating that their activation was mediated exclusively by 4V ChP epithelium derived WNT5A (Fig. 3B-D). Conversely, we observed that LV ChP, which is normally devoid of endogenous WNT5A-signalling (Kaiser et al., 2019), exhibited increased activation of various markers of canonical Wnt signaling including upregulation of downstream target genes Axin2 (Jho et al., 2002) and Lef1 (Hovanes et al., 2001) or phosphorylation of LRP6 (Tamai et al., 2000) as compared to 4V ChP (Fig. 3E-G and Supp. Fig. 4C-E). We attribute these effects to the capacity of WNT5A to suppress the canonical WNT pathway during development (Topol et al., 2003). In support of this model, ablation of Wnt5a using both Wnt5aKO and Wnt5acKO mouse models resulted in a partial shift in balance of WNT signaling from non-canonical to canonical signaling (Fig. 3H-J). The progressive decrease of canonical Wnt signaling target genes Axin2 and Lef1 expression along the proximal-distal (P-D) axis was correlated with gradually increasing expression levels of Wnt5a within 4V ChP epithelium (Supp. Fig. 4F).
Embryonic ChP epithelium expresses various WNT/PCP components
We analyzed in greater detail the spatial distribution of Wnt pathway signaling components in the ChP. Expression of genes encoding non-canonical WNT pathway components, including Dvl2 and both Ror1 and Ror2, were restricted to the epithelial cell layer and not detected in the stromal compartment of the LV and 4V ChP (Fig. 4A, B and Supp. Fig. 5A-B’). Given WNT5A’s central role in the WNT/PCP pathway, we also inspected the expression pattern of Vangl2, a downstream mediator of WNT5A dependent signaling in the WNT/PCP pathway (Gao et al., 2011). Vangl2 expression exhibited a distinct spatial pattern with higher levels detected in the embryonic LV ChP compared to the 4V ChP (Fig. 4C). In addition, Vangl2 expression was restricted to ChP epithelial cells and was absent from the stroma, in agreement with our observations regarding expression of genes encoding other non-canonical Wnt components (Fig. 4D and Supp. Fig. 5B’’). We validated a VANGL2 antibody using Vangl2-/- knock-out animals (Vangl2KO) (Supp. Fig. 5C) and a Vangl2 knock-out cell line (Mentink et al., 2018). With this antibody, we observed that VANGL2 expression was enriched in epithelial cells in both mouse and human embryonic LV ChP (Fig. 4E-G and Supp. Fig. 5D). In contrast to a recent report (Langford et al., 2020), we found that VANGL2 exhibited a strong basolateral distribution typical for its role in mediating cell-to-cell signaling within the developing epithelium (Sittaramane et al., 2013). We also showed overlap of VANGL2 with the dedicated VANGL2 binding partner Scribble (Kallay et al., 2006), which was specifically restricted to the ChP epithelium during mouse and human embryonic development (Supp. Fig. 5E, F). Taken together, our data support a model in which VANGL2 is involved in the control of the WNT/PCP signaling in embryonic ChP.
Meis1 is expressed in Wnt5a expressing cells
We next sought to identify the mechanisms that control the expression of Wnt5a in the 4V ChP epithelium. The transcriptional co-activator Meis1 emerged as a likely candidate - Meis1 regulates Wnt5a expression in nearby branchial arches (Amin et al., 2015) and is highly expressed in the 4V ChP (Lun et al., 2015). We confirmed Meis1 expression in 4V ChP throughout late embryogenesis (Fig. 5A) with Meis1 transcripts being restricted to ChP epithelial cells marked by Foxj1 (Fig. 5B).
We confirmed the presence of MEIS1 protein in 4V ChP from E14.5 to E17.5 (Fig. 5C, D) using validated antibodies against MEIS1 (Supp. Fig. 6A, B).
We identified the potential Meis1 binding site(s) upstream of Wnt5a by analyzing chromatin immunoprecipitation followed by sequencing (ChIP-seq) on E18.5 4V ChP. MEIS1 binding was enriched at the genomic region containing the proximal Wnt5a promoter (Fig. 5E-G). We confirmed Meis1 binding to the Wnt5a promoter by ChIP-qPCR (Fig. 5H). Consistent with these data, the spatial distribution of Meis1 expression partially overlapped with Wnt5a expression in the 4V ChP (Fig. 5I-J, arrowheads). At the protein level, MEIS1 positive staining cells also displayed strong staining for WNT5A in both embryonic mouse and human 4V ChP epithelium (Fig. 5K, L), particularly at the distal tips of ChP villi (Fig. 5M, N). At later embryonic and early postnatal stages, the expression and protein levels of both MEIS1 and WNT5A progressively decreased in the 4V ChP, indicating a possible correlation between MEIS1 availability and expression level of Wnt5a (Supp. Fig. 6C-E).
Meis1 controls expression of WNT5A in the embryonic 4V ChP
Next, we adopted an adeno-associated viral (AAV) approach using a serotype with tropism for ChP epithelial cells (Haddad et al., 2013) to investigate the effect of supplemental Meis1 expression on 4V ChP development (Supp. Fig. 7A, B). We validated efficient intracerebroventricular delivery (at E13.5) and protein induction (by E16.5) by robust induction of EGFP signal in the epithelium of all the ChPs (Supp. Fig. 7C, D). We then successfully applied this approach to overexpress MEIS1 (Supp. Fig. 7E-G). In situ hybridization analysis showed Wnt5a upregulation that was restricted to the 4V ChP epithelial cells overexpressing Meis1 (Fig. 6A) and that cells with the highest MEIS1 expression also exhibited the highest levels of WNT5A staining (Fig. 6A, B and Supp. Fig. 7H) with clear enrichment of overall WNT5A protein level (Fig. 6C, D).
Based on the previously established role of Wnt1 in 4V ChP development (Awatramani et al., 2003), we employed Wnt1-Cre2 mouse line (Lewis et al., 2013) to conditionally delete Meis1 (Meis1cKO) in the 4V ChP epithelium in order to functionally test the link between Meis1 and Wnt5a expression (Supp. Fig. 8A-B).
We confirmed efficient reduction of Meis1 expression in 4V ChP epithelial cells (Supp. Fig. 6B) but not in adjacent regions where Wnt1 was not expressed (Supp. Fig.8A, C, arrowheads). Importantly, immunofluorescence analysis of Meis1cKO embryos revealed a prominent reduction of the WNT5A signal in the embryonic 4V ChP epithelium as compared to Meis1WT littermates (Fig. 6E, F). Unexpectedly, we did not observe any changes in overall 4V ChP morphology (Fig. 6G), which we hypothesized could be explained by having achieved only partial reduction of WNT5A levels and/or the possible redundant effects of other Meis factors including Meis2, which is also expressed in 4V ChP (Lun et al., 2015). To test this possibility, we first confirmed that Meis2 expression was restricted to the developing 4V ChP epithelium similar to Meis1 (Fig. 6H). Next, we conditionally deleted Meis1 and Meis2 (Meis1/2dKO) in the 4V ChP epithelium using Meis1cKO mouse line. Meis1/2dKO embryos were obtained with very low frequency. Comparing the ChP epithelium of two Meis1/2dKO embryos with control littermates showed Meis2-loss further decreased WNT5A protein levels in Meis1/2dKO embryos compared to Meis1 knockout alone (Fig. 6I, J), supporting the model that Meis1 and Meis2 have additive effects on Wnt5 expression. Notably, the two Meis1/2dKO embryos exhibited impaired morphogenesis and decreased overall size of the 4V ChP in comparison to WT and Meis1KO littermates (Fig. 6K). Taken together, these findings demonstrate a direct regulation of Wnt5a expression by MEIS1 in the developing 4V ChP and suggest redundancy of MEIS1 and MEIS2 in this process.
DISCUSSION
Despite large overlap in their cellular architecture and secretory capacity, ChPs adopt dramatically different morphologies during development. Here we report a novel role for the epithelium-derived WNT5A in the regulation of tissue branching morphology within the ChP that is specific for the 4V. WNT5A mediated signaling, established as an important regulator of morphogenesis in various tissues (Yamaguchi et al., 1999), has been recently recognized to play an important role during ChP embryogenesis (Kaiser et al., 2019; Langford et al., 2020). Using temporally controlled conditional deletion of WNT5A directed to the ChP epithelium, we identified two roles of WNT5A, separated in time and space. Our data agree and expand upon recently published findings showing a crucial role of WNT5A in the development of embryonic ChPs (Langford et al., 2020).
By integrating information about WNT5A expression domains and functional data from various WNT5A mouse mutants, we propose a model in which WNT5A has two distinct roles in mouse ChP formation (Figure 7). Early on, WNT5A is expressed in the precursor domains that are directly adjacent to and feed the growth of 4V, 3V and LV ChP epithelium (Langford et al., 2020, Dani et al., 2019). Later on, Wnt5a is expressed in the maturing ChP epithelium in a spatially restricted fashion limited to the 4V ChP (Kaiser et al., 2019). Systemic Wnt5a deletion impairs development of all ChPs (Langford et al., 2020). In contrast, conditional deletion of WNT5A in time and space within FoxJ1-expressing epithelial cells (Wnt5acKO) restricts the growth phenotype to the 4V ChP. The effect is age-dependent – strong when recombination is induced at E11.5 and non-detectable when induced at later stages. Our data show that the tamoxifen injection at E11.5 results in the loss of WNT5A protein at E12.5. Thus, WNT5A appears to be critical during this developmental period when branching of the 4V ChP begins. A similar temporal requirements for Otx2 expression has also been described (Johansson et al., 2013).
We identify MEIS1 as one transcription factor that participates in the control of Wnt5a expression in the 4V ChP epithelium. Our data further suggest that MEIS1 and MEIS2 together regulate Wnt5a expression and 4V ChP development. Regionalized and conserved expression of Wnt5a, Meis1, and Meis2 has previously been reported to occur during both human and mouse ChP embryogenesis (Kaiser et al., 2019, Lun et al., 2015). Nevertheless, despite our identification of this MEIS-WNT5A axis, the full transcriptional factor network that defines 4V ChP epithelium cell fate remains elusive. Potential co-regulation with HoxA2, which is also enriched in the 4V ChP epithelium (Awatramani et al., 2003; Lun et al., 2015), may be possible. HoxA2 binds the Wnt5a promoter (Donaldson et al., 2012), and in the branchial arches, Meis1 and HoxA2 synergize to positively regulate Wnt5a expression (Amin et al., 2015). Future studies may reveal if a similar evolutionary conserved mechanism contributes to the development of the ChP.
WNT5A controls cell polarity (Humphries and Mlodzik, 2018) as well as branching morphogenesis and tissue outgrowth in many developing tissues including mammary gland (Kessenbrock et al., 2017), kidney (Pietilä et al., 2016), lung (Li et al., 2005) and prostate gland (Huang et al., 2009). Similar effects have been described also in the developing midbrain (Andersson et al., 2008), and basolateral secretion of WNT5A by epithelial cells has been shown to participate in the process of lumen formation in kidney epithelium (Yamamoto et al., 2015). These findings point to a more universal role of epithelial WNT5A in the regulation of branching and outgrowth of epithelial sheets. Consistent with this model, we detected regionally restricted activation of non-canonical Wnt/PCP signaling in the ChP, with higher activity in the 4V ChP compared to the LV ChP. Importantly, WNT5A appears to be necessary for the initial stages of ChP development, but it is not essential after E14 despite continuing 4V ChP tissue growth and folding that progresses with development.
The function of WNT5A in the 4V ChP is analogous to its function in the intestinal epithelium, which also develops in a conveyor belt-like mechanism. Recent findings show a link between altered levels of WNT5A and perturbed development of the small intestine, largely resembling effects observed in the developing 4V ChP upon WNT5A deletion. Notably, either WNT5A deficiency or overexpression leads to similar phenotypes in both tissues (van Amerongen et al., 2012, Cervantes et al., 2009). Tightly controlled WNT5A levels thus seem to be essential for proper epithelial folding of both the 4V ChP and intestine and may represent a universal mechanism of epithelial development.
WNT5A is known to contribute to the balance between Wnt/β-catenin (canonical) and non-canonical Wnt signaling that is essential for proper tissue morphogenesis and homeostasis (Alexander et al., 2012). Crosstalk between WNT5A and other Wnts may differ for the two expression domains of Wnt5a in the developing ChP (see Figure 7). As Wnt5a expression domains are located adjacent to all embryonic ChPs (Langford et al., 2020) and overlap with the expression domains of Wnt ligands that activate β-catenin pathway, it is possible that Wnt5a acts in concert with other Wnt genes. For example, with the typical canonical ligand WNT2b, that is known to be an important patterning factor orchestrating proper development of ChPs in the cortical hem (Grove et al., 1998). Importantly, the Wnt5a domain also overlaps with an R-spondin (R-SPO)-positive progenitor domain (Dani et al., 2019). R-SPO acts as the amplifier of the Wnt/ β-catenin signaling which suggests that in the progenitor domain WNT5A can synergize or coordinate with Wnt/β-catenin signals. In contrast, in the 4V in the ChP epithelium WNT5A seems to be a signaling factor suppressing canonical WNT signaling as reported in mammary gland development (Roarty et al., 2009). Higher WNT/β-catenin signaling (as shown by upregulation of target genes Axin2 or Lef1 or phosphorylation of LRP6) was detected in the embryonic LV ChP epithelium with low/undetectable Wnt5a expression or upon deletion of Wnt5a in the 4V ChP. Notably, in comparison to Wnt5a, both Axin2 or Lef1 show a reverse pattern of expression along the P-D axis in the embryonic 4V ChP. This observation suggests that the spatial control of WNT/β-catenin signaling is achieved by increasing levels of WNT5A within the ChP epithelium (Sato et al., 2010).
In summary, our data reveal the complex functions of WNT5A in regulating ChP development. From a clinical perspective, rare neoplasms of the ChP have higher incidence in children and display regional specificity (Sun et al., 2014). Thus, elucidating the regionalized signaling pathways underlying ChP development may expose molecular mechanisms that lend one ventricle more or less susceptible to cancer. Because the ChP represents a tissue amenable to genetic manipulation (Chen et al., 2020), and it adopts distinct, ventricle-specific morphologies due to inherent differences in activation of WNT5A-driven PCP signaling, the ChP provides a tractable model for future research investigating the mechanistic basis of WNT5A signaling in tissue morphogenesis.
SUPPLEMENTARY FIGURES
METHODS
Mouse strains
Conditional Meis1fl/fl mice were generated from the embryonic stem cell clone HEPD0632_4_H07 purchased from EUCOMM. The Frt-flanked LacZ/neo cassette was removed by ACTFLPe (strain #005703). LoxP sites flank exon ENSMUSE00000655363 encoding the homeobox region of the Meis1 gene. Genotyping primers: CTGCGCTTCCTACATCACTG and CACTTCAGCGTCACTTGGAA produce 227-bp fragment for the wild-type allele and 262-bp band for the floxed allele.
Conditional Meis2 fl/fl strain with loxP sites around exons 2-6 was described earlier (Machon et al., 2015). Genotyping primers: GCAAGGGTGCTGAGGTTAAA and TCAGACCCAGGAATTTGAGG produce 235-bp in the wild type allele and 324-bp fragment in the floxed allele.
The Wnt1-Cre2 mouse strain was purchased from The Jackson Laboratory (strain #022137) and it was used for specific deletion of the Meis1 fl/fl gene in 4V ChP (referred to as Meis1KO strain in this article). Genotyping primers GCATTTCTGGGGATTGCTTA and CCCGGCAAAACAGGTAGTTA amplify 241-bp Cre fragment.
The reporter line mT/mG was purchased from The Jackson Laboratory (strain #007676).
Mouse strain Wnt5atm1.1Krvl/J (referred to Wnt5aflox/flox in this article) (Ryu et al., 2013) was purchased from Jackson laboratories; Foxj1tm1.1(cre/ERT2/GFP)Htg (referred to Foxj1-creERT2 in this article) (Muthusamy et al., 2014) and Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (referred to as tdTomato in this article)(Madisen et al., 2010) were shared with the Karolinska Institutet, Sweden through a collaboration agreement. All mice strains were housed, bred and treated in Czech Centre for Phenogenomics (Institute of Molecular Genetics, CAS) in accordance with protocols approved by the animal work committee of the Institute of Molecular Genetics, CAS and Central Commission for Animal Welfare of Ministry of Agriculture Czech Republic (PP-90-2015, PP-64-2018). Induction of conditional knock-out or the tdTomato reporter was induced by single dose of tamoxifen (Sigma) intra-peritoneal injection of pregnant female mice at a concentration of 4.5 mg of tamoxifen dissolved in sterile sunflower oil per 20g weight of mouse.
Overexpression of Wnt5a (Wnt5aOE) was induced in embryos carrying both an inducible Wnt5a transgene and a Rosa26rtTA driver as described earlier (van Amerongen et al., 2012, strains available via Jackson labs: FVB/N-Tg(tetO-Wnt5a) 17Rva/J, stock number 022938; B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae/J, stock number 006965). Wnt5aOE was induced by administrating doxycycline to pregnant mice from E10.5 onwards through dissolving doxycycline in the drinking water (1-2 mg/ml) ad libitum. Ror2; Vangl2 were obtain from Dr. Yingzi Yang (Gao et al., 2011). Mice were crossed as double heterozygotes (Ror2+/-; Vangl2+/-) due to homozygote lethality. All mice were used according to the rules and regulations of the local ethical committee (Stockholm Norra Djurförsöksetisks Nämd: N273/11, N326/12, N158/15) and (Animal Welfare Committee of the University of Amsterdam).
Reagents used are listed in the Supplementary table 1.
In utero injection
All AAV injection in utero experiments were performed under protocols approved by the IACUC of Boston Children’s Hospital (BCH). Timed pregnant CD-1 dams were obtained from Charles River Laboratories. E13.5 CD-1 dams were anaesthetized with isoflurane inhalation and the uterine horns were exposed. 1μl of AAV-GFP or AAV-Meis1 containing 1∼5X1012 gc/ml was injected into a lateral ventricle using a pulled glass pipette (Drummond Scientific Company). Analgesic medication (Meloxicam 5mg/kg) was injected subcutaneously following surgery. E16.5 embryos were harvested and drop fixed in 4% PFA before tissue processing or snap freezing for qPCR analysis.
The murine Meis1 gene was obtained from the MEIS1A-MIY (Addgene) by EcoRI digestion and ligated into a AAV-CMV-IRES-hrGFP (Agilent) vector digested with EcoRI. AAV5-GFP and AAV5-Meis1 were produced by the viral core at Boston Children’s Hospital (BCH).
Reagents used are listed in the Supplementary table 1. Constructs used are listed in the Supplementary table 2.
ChIP-sequencing assays
ChIP-seq protocol was adapted from (Laurent et al., 2015). Briefly, 4V ChP from E18.5 embryos were dissected into cold HBSS. Tissues were crosslinked in 1% formaldehyde at room temperature for 10 minutes while rotating. Glycine (Sigma) was added to a final concentration of 125mM and incubated at room temperature for 5 minutes. Tissues were centrifuged at 4°C at 2000xg and washed twice with 1x PBS with protease inhibitors (Thermo Fisher Scientific). Tissues were snap frozen in liquid nitrogen and stored at −80°C.
Frozen tissues were resuspended in lysis buffer with protease inhibitors (50mM Tris pH 8.1, 10mM EDTA pH 8.0, 1% SDS). Tissues were homogenized using an insulin syringe and then fragmented with an ultrasonic sonicator (Qsonica). After sonication, dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2mM EDTA, 16.7mM Tris-HCl pH 8.0 and 167mM NaCl) with protease inhibitors were added to give a final SDS concentration of 0.1%.
Chromatin samples were pre-cleared with Protein A beads (Thermo Fisher Scientific) under rotation at 4°C for 1hour prior to incubation overnight with anti-Meis1 and anti-IgG antibody overnight (15 ug of antibody per sample). Protein A beads were added to precipitate antibody complexes and rotated for 1hour at 4°C and then washed with low salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl pH 8.0, 150mM NaCl), high salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl pH 8.0, 500mM NaCl), LiCl buffer (0.25M LiCl, 1% IGEPAL-CA630, 1% deoxycholic acid, 1mM EDTA, 10mM Tris pH 8.0), and TE buffer (10mM Tris-HCl, 1mM EDTA). Antibody complexes were eluted with 1% SDS in 100mM NaHCO3, and crosslinks were reversed with NaCl and proteinase K (NEB). DNA was recovered by phenol-chloroform extraction and ethanol precipitation and quantified with Qubit (Invitrogen).
ChIP-seq libraries were prepared using NEBNext DNA library preparation reagents (E6000) as described in the Illumina Multiplex ChIP-seq DNA sample Prep Kit. Libraries were indexed using a single indexed PCR primer. Libraries were quantified by Qubit (Invitrogen) and sequenced using a HiSeq 2500 (Illumina) to generate 50 bp single-end reads.
Reagents used are listed in Supplementary table 1.
ChIP-Sequencing analysis
ChIP-Seq samples were sequenced in single-end on the Illumina HiSeq2500 platform. Raw reads were mapped to mouse reference genomes (mm9) that were downloaded from the UCSC website (www.genome.ucsc.edu). Bowtie (v1.0.0) (Langmead et al., 2009) was used for alignment with “–m 1” and other default parameters. The “-m 1” allows reads uniquely aligned to the genome. MACS (v2.0.10) (Zhang et al., 2008) was used to identify the enriched regions with default parameters. These enriched regions were annotated with an R package, ChIPpeakAnno (v3.6.5) (Zhu et al., 2010) in Bioconductor. The promoters were defined as 2kb from up-to down-stream of transcriptional start sites (TSS).
Reagents used are listed in the Supplementary table 1.
ChIP-qPCR
ChIP-qPCR was performed on immunoprecipitated DNA after amplification with NEB Next DNA library preparation. qPCR was performed with SYBR green (Roche) for detection on a LightCycler 480 system (Roche) according to the manufacturer’s instructions. The results were calculated as relative fold enrichment over the input.
Reagents used are listed in the Supplementary table 1. Primers are listed in the Supplementary table 5.
Choroid plexus epithelial cell primary culture
ChP tissue was collected from E14.5 embryos isolated from sacrificed pregnant CD1 mice and choroid plexus epithelial cells (CPEC) were isolated from LV ChP and 4V ChP. During isolation, extracted tissue was kept at room temperature (RT) in HBSS solution (Sigma). After isolation, extracted tissue was briefly centrifuged (200g, 10s at RT). Following aspiration of supernatant, 500µl of 2 mg/ml solution of Pronase (Sigma) was added to the extracted tissue and incubated for 5 minutes at 37°C. The solution was then transferred to DMEM/F-12 medium containing 10% FBS (Thermo Fisher Scientific) and centrifuged (300g, 2min at RT). Tissue was transferred to complete culture medium consisting of DMEM/F-12 supplemented with 10% FBS, 10ng/ml EGF (Invitrogen), 20 µM cytosine arabinoside (Sigma) 50U/ml penicillin, and 50U/ml streptomycin. Cells were mechanically dissociated through a 21-gauge needle using 6-8 times forced passages, followed by gentle repeated resuspension with a 200µl pipette. Finally, cells were seeded onto Transwell-0,4μm thick clear filter inserts (Sigma). Inserts were pre-coated on their upper side with laminin (Sigma) as described by the manufacturer. To achieve higher purity of epithelial cells, an adhering-off method was applied to reduce fibroblast contamination. After the initial seeding, supernatant containing unadhered cells was transferred to new laminin coated well thus removing from culture, fibroblasts characterized by a higher adherence affinity.
In order to produce CM, CPEC primary cultures were maintained in complete culture medium. CM was collected every 48 hours up to 10 days after seeding. Supernatant was subjected to sequential centrifugation steps of 200g for 5 min (to remove viable cells), 1500g for 10 minutes (to remove death cells) and 6000g for 15 minutes (to remove cell debris).
Reagents used are listed in the Supplementary table 1.
Fetal tissue section
Ethical approval allowing human fetal tissue acquisition and analysis was provided by the National Research Ethics Service Committee East of England—Cambridge Central, UK (ethics number 96/085).
Cell culture and transfection
HEK293T cells were seeded in complete DMEM medium containing 10% FBS, 2mM L-glutamine, 50U/ml penicillin, and 50U/ml streptomycin (Thermo Fisher Scientific) on 10cm dishes 24 hours prior transfection. The cells were transfected with a total of 5µg of DNA at ∼40% confluency in DMEM medium only. The transfection reaction mixture was prepared using OptiMEM (Thermo Fisher Scientific) and Lipofectamine 2000 (Thermo Fisher Scientific), with a ratio of 1µg DNA: 2µl Lipofectamine 2000, followed by incubation with cells for 4-6 hours. Afterwards the transfection medium was exchanged for the complete medium.
Reagents used are listed in the Supplementary table 1.
CRISPR/Cas9 generation of WNT5A-only HEK293 T-REx cells
Plasmid encoding guide RNA targeting the human WNT5A gene was used. gRNA sequence was cloned into plasmids pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid, 41815) or pU6-(BbsI) CBh-Cas9-T2A-mCherry (Addgene plasmid, 64324). T-REx-293 cells (Invitrogen) were cultured according to the manufacturer’s instructions and transfected by Lipofectamine® 2000 DNA Transfection Reagent (Thermo Fisher Scientific) with plasmids encoding guide RNAs targeting human WNT5A gene. Next day, transfected cells were single cell sorted and grown as single colonies. Selection of WNT5A knock-out (KO) clones was done by PCR. Genomic DNA was isolated by DirectPCR Lysis Reagent (Viagen Biotech) and then
the fragment of genomic DNA was amplified by PCR using DreamTaq DNA Polymerase (Thermo Fisher Scientific). Then, the PCR product was cut by TaqI (Thermo Fisher Scientific). WNT5A ablation efficiency was assessed by Western Blot analysis using antibodies: WNT5A antibody (R&D). All cell lines were verified and sequenced.
Reagents used are listed in the Supplementary table 1. Constructs used are listed in the Supplementary table 2. Primers are listed in the Supplementary table 5.
Western blotting
Samples were subjected to SDS-PAGE, electrotransferred onto a Hybond-P membrane (GE Healthcare), immunodetected using appropriate primary and secondary antibodies and visualized by ECL (Millipore) or Supersignal Femto solution (Thermo Fisher). Signal intensities were calculated using ImageJ. Briefly, the area of the peak intensity for the protein of interest was divided by the corresponding values of peak intensity obtained for the control protein.
Reagents used are listed in the Supplementary table 1. Antibodies used are listed in the Supplementary table 3.
Micro CT
Embryos were fixed for 1 week in 4% PFA and stained with Lugol’s Iodine solution for 2 weeks or longer. Stock solution (10g KI and 5g I2 in 100ml H2O) was diluted to 25% working solution in H2O. Stained specimens were removed from contrast agent, rinsed with PBS and embedded in 2.5% low gelling temperature agarose dissolved in water. Scan was performed on SkyScan 1272 high-resolution microCT (Bruker, Belgium), with voxel size set up for 3µm.
Immunofluorescence and EdU staining
For mouse embryo immunofluorescent analysis and in situ hybridization, WT CD1 mice, Wnt5a-/- mice were dissected and isolated embryos were transferred into ice-cold PBS, fixed in 4% paraformaldehyde (PFA, Millipore) in PBS for several hours followed by several washes in ice-cold PBS and finally cryoprotected by sequential incubation in 15% and then 30% sucrose solutions. Embryos were next frozen in optimum cutting temperature (OCT) compound (Sakura FineTek) on dry ice. Serial 14µm coronal sections were used for immunofluorescence analysis. Human fetal tissue for cryosectioning was immersion-fixed overnight in 4% PFA at 4°C, then cryoprotected in sucrose before embedding in the OCT compound and then 14 µm sections were cut using a Leica cryostat. Human fetal tissue samples were then processed using an identical immunofluorescence protocol as for the mouse samples.
For immunofluorescent analysis, all the sections underwent antigen retrieval by direct boiling for 1 minute at 550W in the microwave followed by 10 minutes incubation at 85°C in water bath, using antigen retrieval solution (DAKO). Sections were washed in PBT (PBS with 0.5% Tween-20) and blocked in PBTA (PBS, 5% donkey serum, 0.3% Triton X-100, 1% BSA). Samples were incubated overnight at 4°C with primary antibodies diluted in PBTA. Following washes in PBT, samples were incubated with corresponding Alexa Fluor secondary antibodies (Invitrogen, Abcam) for 1h at RT, followed by 5 minutes incubation at RT with DAPI (Thermo Fisher). Finally, samples were mounted in DAKO mounting solution (DAKO).
EdU (Life Technologies) was injected 72 hours before the embryos were harvested at a concentration of 65 mg/g. Cells with incorporated EdU were visualized using a Click-iT EdU Alexa Fluor 555 Imaging Kit (Life Technologies).
For immunocytofluorescent analysis of ChP primary culture, cells grown on laminin coated cover slips were first washed several times in ice-cold PBS, followed by fixation for 15 minutes in ice-cold 4% PFA. Later, cells were washed several times in PBT, blocked with PBTA for 30 minutes and incubated overnight at 4°C with primary antibodies. Following repeated washing in PBT, cells were incubated for 1 hour at RT with appropriate secondary antibodies, DAPI for 5 minutes and mounted in DAKO mounting medium (DAKO).
Reagents used are listed in the Supplementary table 1. Antibodies used are listed in the Supplementary table 3.
In situ analysis
In situ analysis of the gene expression was performed on 14-µm cryosections of embryos at various stages of embryonic development isolated from CD1 mice. After isolation, embryos were immediately transferred and kept in fresh 4% PFA for 2 hours, washed briefly in ice cold PBS, incubated for 6 hours in 30% sucrose solution at 4°C, and frozen at −80°C. Transcripts were detected using an adapted protocol for the RNAscope 2.0 assay for fixed frozen tissue (Advanced Cell Diagnostics). Staining was performed using the RNAscope Fluorescent Multiplex Reagent Kit (Advanced Cell Diagnostics).
Indicated in situ images were adopted from Allen Institute for Brain Science: Allen Developing Mouse Brain Atlas (Lein et al., 2006) (Available from: http://developingmouse.brain-map.org) or from eurexpress.org (Diez-Roux et al., 2011) (Available from: http://www.eurexpress.org/ee/).
Reagents used are listed in the Supplementary table 1. Probes used are listed in the Supplementary table 4.
Real time qPCR
RNA was isolated using from 3 different litters of WT CD1 embryos collected at different developmental stages using RNAeasy kit (Qiagen). Samples were treated with DNase (Qiagen) to prevent contamination with genomic DNA. The specificity of primers was determined by BLAST run of the primer sequences. Annealing temperature was 57°C for all used primers.
qPCR reactions were performed once for every gene / sample in triplicate. PCR was done according to the manufacturer’s protocol using Lightcycler 480 SYBR Green 1 Master Mix (Roche). The following thermo cycling program parameters were used for qPCR analysis: Incubation step at 95°C for 5min, then 45 cycles 95°C for 10 seconds, 57°C for 10 seconds and 72°C for 10 seconds. qPCR analysis was carried out using LightCycler© 480 Instrument II (Roche).
ΔCp values were calculated in every sample for each gene of interest with β-Actin as the reporter gene. Relative change of expression level for analyzed gene (ΔCp) was performed by subtraction of the gene expression levels in the LV ChP or 4VChP from the gene expression level of housekeeping gene (β-actin). Next, the ratio of the gene expression level between β-actin and gene of interest in either 4V ChP or LV ChP was calculated using the following formula: 2^-ΔCp.
Reagents used are listed in the Supplementary table 1. Primers are listed in the Supplementary table 5.
Statistics
Gene expression data - Replicates represent independent experiments. Data in Fig. 3F, Fig. 4C, Fig. 5A and Supplementary Fig. 4D are represented in columns showing the mean with standard deviation (s.d.). Significance was measured using a paired two-tailed Student’s t-test with unequal sample variance. Biological replicates per condition are indicated in the corresponding graphs. Data in Fig. 5G are represented as columns showing the standard error of the mean (s.e.m).
Confocal images - Data in Fig. 1G-I, Fig. 1M-O, Fig. 2E-G, Fig. 2J-K, Fig. 6C, Fig. 6F-G, Fig. 6J-K, Supplementary Fig. 1E-F, Supplementary Fig. 1H and Supplementary. Fig. 2J-K are expressed as columns showing the mean with s.d. Significance was measured using unpaired or paired two-tailed Student’s t-test with unequal sample variance. Biological replicates used per condition are indicated in the corresponding graphs.
Immunoblot images - Images used for quantitative analysis reported Supplementary Fig. 4A, C and Supplementary Fig. 5D are expressed as columns showing the mean with s.d. Significance was measured using unpaired two-tailed Student’s t-test with unequal sample variance. Biological replicates per condition are indicated in the corresponding graph.
Except for Fig.6 J-K, Supplementary Fig. 1I-J, Supplementary Fig. 2C and Supplementary Fig. 2G all the displayed immunostaining images and western blots are representative of at least 3 independent experiments.
AUTHOR CONTRIBUTIONS
KK designed and performed most of the experiments, analyzed data, prepared all figures, and wrote the manuscript; AJ and MPL prepared the AAV constructs, performed in utero injections, qPCR and immunoblotting; MPL; ML and BL performed chromatin immunoprecipitation and analyzed the data with FW; JP, MP, IU and RS produced Wnt5acKO strain; OM and ZK produced the Meis1KO strain; RvA provided the Wnt5aOE embryos, DG and EA provided the Wnt5aKO and Vangl2KO embryos, PK performed immunostaining analysis; RLG and RAB contributed the human fetal samples; VB and ML designed experiments, supervised the work, analyzed data and wrote the manuscript.
COMPETING INTERESTS
The authors declare no competing interests.
ACKNOWLEDGEMENTS
We thank members of Bryja and Lehtinen labs for their help and suggestions, Dr. Marcela Buchtová and Mgr. Marie Šulcová (Masaryk University) for their valuable assistance with RNAscope hybridization, Dr. Sean Li (Boston Children’s Hospital) for sharing Wnt5a knockout mice with the Lehtinen lab, and Chen Wu at the BCH Viral Core. We are also thankful to Nikodém Zezula (Masaryk University) for his assistance with the figure graphic design and Mgr. Monika Novákova (Masaryk University) for help with the animal work. We thank MEYS CR for support to the following core facilities: CELLIM of CEITEC supported by the Czech-BioImaging large RI project (LM2018129 funded by MEYS CR), Czech Centre for Phenogenomics (LM2015040), Higher quality and capacity of transgenic model breeding (by MEYS and ERDF, OP RDI CZ.1.05/2.1.00/19.0395), Czech Centre for Phenogenomics: developing towards translation research (by MEYS and ESIF, OP RDE CZ.02.1.01/0.0/0.0/16_013/0001789), BCH viral core for AAV production. The collaboration between Masaryk University and Karolinska Institutet (KI-MU program), was co-financed by the European Social Fund and the state budget of the Czech Republic (CZ.1.07/2.3.00/20.0180). Funding to the VB lab was obtained from Neuron Fund for Support of Science (23/2016), and Czech Science Foundation (GA17-16680S). Work in the EA lab was supported by the Swedish Research Council (VR projects: DBRM, 2011-3116, 2011-3318 and 2016-01526), Swedish Foundation for Strategic Research (SRL program and SLA SB16-0065), European Commission (NeuroStemcellRepair), Karolinska Institutet (SFO Strat Regen, Senior grant 2018), Hjärnfonden (FO2015:0202 and FO2017-0059) and Cancerfonden (CAN 2016/572) foundations. KK was supported by Masaryk University (MUNI/E/0965/2016). RvA acknowledges funding support from the University of Amsterdam (MacGillavry fellowship), KWF Kankerbestrijding (Dutch Cancer Society, career development award ANW 2013-6057) and NWO (Netherlands Science Foundation, VIDI 864.13.002).Work in the OM lab is supported by the Czech Science Foundation (18-00514S). ZK acknowledges funding support from GACR 18-20759S. RA Barker is supported by an NIHR funded Biomedical Research Centre at Cambridge University Hospital and the WT-MRC Cambridge Stem Cell Institute. The Lehtinen laboratory was supported by NIH R01 NS088566 (MKL), the New York Stem Cell Foundation (MKL); and BCH IDDRC 1U54HD090255. MK Lehtinen is a New York Stem Cell Foundation – Robertson Investigator.