ABSTRACT
The STAT3 transcription factor, acting both in the nucleus and mitochondria, is needed to maintain embryonic stem cell pluripotency and promote proliferation. In this work, using zebrafish, we determined in vivo that mitochondrial STAT3 regulates mtDNA transcription in embryonic and larval stem cell niches and that this activity is fundamental in determining proliferation rates. To dissect the molecular requirements for mitoSTAT3 functions, we used drugs and missense mutations to kinase-targeted STAT3 residues. As a result, we demonstrated that STAT3 import inside mitochondria requires Y705 phosphorylation by Jak2, while its mitochondrial transcriptional activity, as well as its replication potential, depends on the MAPK target S727. Moreover, while STAT3-dependent mtDNA transcription is needed and sufficient to induce cell proliferation, it is not required to maintain stem-like phenotype in the tectal niche. Surprisingly, STAT3-dependent increase of mitochondrial transcription seems independent from STAT3 binding to DNA and does not originate from STAT3 regulation of mtDNA replication.
INTRODUCTION
The investigation of the role of Signal Transducer and Activator of Transcription 3 (STAT3) pathway in human diseases represents, to date, one of the most exciting developments in modern medicine (O’Shea et al., 2015). Many of the major human malignancies display elevated levels of constitutively activated STAT3 (Johnston and Grandis, 2011). Most interestingly, recent data report that STAT3 target genes are overexpressed in tumour-initiating cancer stem cells (Fouse and Costello, 2013; Wei et al., 2014; Ghoshal et al., 2016). Notably, being the key mediator of Leukemia Inhibitory Factor (LIF)-dependent Embryonic Stem Cells (ESC) self-renewal in vitro (Burdon et al., 1999; Matsuda et al., 1999), STAT3 promotes the maintenance and induction of ESC naïve pluripotency (Martello et al., 2013).
STAT3 transcriptional activity is regulated by phosphorylation of two separate residues. When Janus kinase 2 (JAK2) phosphorylates its tyrosine 705 (Y705), STAT3 can dimerize, enter the nucleus, and trigger transcription of its target genes (Ni et al., 2004). On the other hand, the function of serine 727 (S727) phosphorylation remains controversial; pS727 has been reported to have both down- and up-regulatory effects on STAT3 transcriptional activity (Quin et al., 2008; Shi et al., 2006). More recently, it has been demonstrated that pY705 is absolutely required for STAT3-mediated mESC self-renewal, while pS727 is dispensable, serving only to promote proliferation and optimal pluripotency (Huang et al., 2014). Notably, zebrafish mutants lacking maternal and zygotic Stat3 expression display transient axis elongation defects due to reduced cell proliferation during embryogenesis (Liu et al., 2017). Additionally, it has been demonstrated that in zebrafish Stat3 is transcriptionally active in stem cells of highly proliferative tissues like tectum opticum, hematopoietic tissue and intestine (Peron et al., 2020).
Besides its canonical nuclear function, a pool of STAT3 has been reported also in the mitochondrion of different cell types, thus including this transcription factor in the large family of dual-targeted proteins with a nuclear and mitochondrial life (Wegrzyn et al., 2009; Mantel et al., 2012). A recently discovered subcellular localization of Stat3 is the Endoplasmatic Reticolum (ER), where it controls the release of Ca2+, with consequences on the mitochondrial Ca2+ levels and on the life-death cell decision. This function is crucial for the maintenance in the tumour niche of apoptosis-resistant cells (Avalle et al.,2019). Although the mechanisms of action of mitoSTAT3 are still debated, approximately one-tenth of cytosolic STAT3 has been shown to be in the mitochondria, (Szczepanek et al., 2011). Several mitochondrial roles for STAT3 have been proposed so far, such as the interaction with OXPHOS complexes I and II, the direct binding to the d-loop regulatory region of mitochondrial DNA (mtDNA), the regulation of mitochondrial permeability transition pore (Wegrzyn et al., 2009; Macias et al., 2014; Meier and Larner, 2014). Carbognin and colleagues (2016) have recently showed in vitro that STAT3 is able to trigger mitochondrial gene expression and cell proliferation, thus suggesting a possible connection between this most prominent effect on ESC and a “non-canonical mitochondrial STAT3 (mitoSTAT3) pathway”. On the other hand, a clear function of mitoSTAT3 and the mechanism leading to its activation and translocation are to date not well-understood. Previous in vitro studies suggested that the S727 phosphorylation by ERK (MAPK) kinases may be required for STAT3 mitochondrial activity (Gough et al., 2013) and it seems necessary to restore complexes I and II activities in Stat3−/− cells (Wegrzin et al., 2009). Moreover, p727 STAT3 targeted to the mitochondria is described to promote Ras-dependent transformation in human bladder carcinoma cells (Gough et al., 2009). Notably, the role of other post-translational modifications on mitoSTAT3 activity have not been investigated yet. Zebrafish is a widely used organism for expression and functional analysis of proteins due to its transparent body and external fertilization. Knowing that Stat3 protein and all its functional domains are highly conserved in zebrafish (Liang et al., 2012, Oates et al., 1999) we used this animal model to study the non-canonical Stat3 pathway in vivo. In this paper we demonstrate the dependence of mitoSTAT3 activities from both Y705 and S727 phosphorylations, hence, that mitoSTAT3 mitochondrial function relies on both ERK and JAK2 kinases activation. On the other hand, our data show that mitoSTAT3 modulates mitochondrial transcription without binding to canonical STAT3 Binding Elements (SBE), consistently with the huge differences between the eucariotic and the procariotic transcriptional machineries operating in the nucleus and mitochondria, respectively. Moreover, we directly linked the STAT3-dependent regulation of tissue stem cells proliferation to mitochondrial transcriptional activity of zebrafish embryos, thus supporting the idea of a role in cancer development for the “non-canonical”, mitoSTAT3 pathway.
RESULTS
mitoSTAT3 regulates cell proliferation in the PML of the TeO through mtDNA transcription
According to recent publications, a portion of STAT3 localizes to mitochondria, where it is supposed to bind to mtDNA and act as a mitochondrial transcription factor able to induce cell proliferation in ESC (Macias et al., 2014; Carbognin et al., 2016). It can be easily assessed that mtDNA-encoded genes, as well as the cellular proliferation marker pcna, are, by default, particularly expressed in regions also labelled by stat3 transcripts, such as the inner retina and the Peripheral Midbrain Layer (PML) of the Tectum Opticum (TeO) (Fig. 1; Fig. 2A), which serves as progenitor source for tectal and torus neurons in the embryo (Galant et al., 2016). Due to the polycistronic nature of mtDNA-encoded genes, that results in stoichiometric mtDNA transcription (Taanman, 1999), we decided to use the mitochondrial gene mt_nd2 as a hallmark of global mitochondrial gene expression, since its expression profile is already described in zebrafish (Thisse et al., 2001). To understand whether Stat3 mitochondrial activity regulates mtDNA transcription and promotes proliferation also in vivo, we injected zebrafish fertilized eggs with mRNA of a mitochondria-targeted murine form of Stat3 provided with a nuclear export domain that makes it unable to localize in the nucleus (MLS_mStat3_NES) (Fig. S1 A). This artificial protein a) efficiently localizes only inside the mitochondrion in transfected mESC, as revealed by its co-expression with the mitochondrial marker ATAD3 on ES cells (Fig. S1 C) as well as in Zebrafish (Fig. S6 A,B),; b) is completely devoid of nuclear functions as assessed by qRT-PCR analysis of the most direct Stat3 target gene, Socs3 (Fig. S1 B).
Thus, when MLS_mStat3_NES mRNA was introduced into zebrafish embryos we could observe, both by in situ hybridization and qRT-PCR, a significant increase of mitochondrial transcription, that reached a peak at 48 hpf (Fig. 2A-A’, C). It is worth noting that, as assayed by pcna analysis, overexpression of MLS_mStat3_NES mRNA also induced a proportional increase of proliferating cells in the same tissues where mitochondrial transcription was stimulated, i.e. the PML (Fig. 2 B-B’, C, D). On the other hand, we did not find any difference in mtDNA content when comparing injected and control embryos, meaning that the effect of mitoSTAT3 on mitochondrial transcription is not due to increased mtDNA replication or mitochondrial biogenesis (Fig. 2E).
Importantly, chemical inhibition of mitochondrial transcription by using Balapiravir (Feng et al., 2015) was able to abolish MLS_Stat3_NES effects on proliferation (Fig 2 A’’, B’’, D), thus providing some evidence, in vivo, that replication of highly proliferating PML cells in the developing TeO of zebrafish embryos depends on mitoSTAT3-driven expression of mitochondrial genes.
Since putative STAT3 binding elements (SBE) have been identified in the mitochondrial D-Loop (the mitochondrial transcriptional initiation site) (Macias et al., 2014) and STAT3 was found to immunoprecipitate together with the mitochondrial D-Loop in mouse ES cells (Carbognin et al., 2016), we wondered whether mitoSTAT3 can regulate gene expression in mitochondrion by interacting with these putative mitochondrial SBE. Surprisingly, a form of mitochondrial STAT3 mutated in the DNA binding domain (STAT3 458-466 VVV-AAA) (MLS_mStat3_ΔDNAbd_NES), thus unable to bind SBE (Horvath et al., 1995), retained its ability to activate mt_nd2 transcription at comparable levels with respect to wild type (WT) mitoSTAT3 on zebrafish embryos (Fig. 2F; Fig. S2 A). However, as evidenced on mouse ESC, this form mutated on its DNA binding domain, is still able to co-localize with ATAD3, a mitochondrial nucleoids marker, (Fig. 2G, Fig. S5). This result suggests that, unlike nuclear STAT3, mitoSTAT3 does not regulate mtDNA transcription by direct binding to canonical STAT3 cis-responsive elements, even though it is recruited in proximity of mtDNA.
Finally, to assess the effect of mitochondrial STAT3 on neural progenitor number during zebrafish embryogenesis, we observed the expression levels of sox9b, her4.1 and her5 neural precursor’s markers. Sox9b transcription factor, the functional orthologous of mammalian SOX9 (Kluever et al., 2005), is known to induce and maintain different types of stem cells including mammalian neural stem cells in the Central Nervous System (CNS) (Scott et al., 2010; Martini et al., 2013; Jo et al., 2014).
Furthermore, her4.1 (orthologous to mammalian Hes5) and her5 (orthologous to mammalian Hes7) transcripts, were recently demonstrated to respectively mark neuroepithelial and radial glial precursor cells in the TeO, the two populations of neural precursors in zebrafish (Galant et al., 2016). Interestingly, no significant difference in the expression of any of the three embryonic undifferentiated neural markers was detectable in the TeO of 48-hpf embryos injected with MLS_Stat3_NES with respect to uninjected controls (Fig. 3). This finding leads to the conclusion that mitochondrial STAT3 has a role in regulating proliferation of neural cells in the Tectal Proliferation Zone (TPZ) of the TeO but not in maintaining the undifferentiated state of these neural precursors.
Mitochondrial STAT3 transcriptional activity relies on both S727 and Y705 phosphorylations
STAT3 nuclear activity is known to be controlled by JAK2-mediated phosphorylation of Y705 residue, which also ensures STAT3 monomers stability in the cytoplasm (Becker et al., 1998). On the other hand, phosphorylation on STAT3 S727 by the MAPK/ERK pathway (Ras-Raf-MEK-ERK pathway) is known, from in vitro studies, to enhance the Electron Transport Chain (ETC) (Wegrzyn et al., 2009) as well as to promote cell proliferation and optimal pluripotency (Huang et al., 2014). To verify in vivo the post-translational requirements, and to test whether also mitoSTAT3 activity requires Y705 phosphorylation, we decided to inject 1-cell stage zebrafish embryos with mRNAs encoding variants of murine Stat3. In particular, we compared the activity of WT STAT3 (without the MLS) with two mutated forms, Y705F and S727A, able to prevent phosphorylation of residues 705 and 727, respectively. Interestingly, when embryos were injected with the WT isoform, quantitative analysis of fluorescent in situ hybridization revealed a significant increase of mitochondrial transcription in the PML of the TeO (Fig. 4 A,B), even though qRT-PCR analysis on homogenized embryos did not result in any significant variation of global mt_nd2 gene expression (Fig.4 C,D). Notably, when injecting either Y705F or S727A isoforms of a STAT3 not provided with a constitutive mitochondrial import signal, no significant stimulation of mitochondrial transcription in the PML population was detected, either using in situ hybridization or qRT-PCR (Fig. 4 A-D; Fig. S2 B). In conclusion, both phosphorylations are needed for STAT3-mediated increase of mtDNA transcription in the PML. On the other hand, when the mutated isoforms are forcedly targeted only to the mitochondrion (by using both the MLS and the NES), the S727A mutation prevented mitoSTAT3-mediated activation of mt_nd2 gene expression, while the STAT3-Y705F mutated isoform retained its mitochondrial transcriptional activity (Fig. 4 E,F; Fig. S2 C). This implies that Y705 is essential for precise transport of STAT3 from the cytoplasm to mitochondria.
To further elucidate the localization of different mutated forms of STAT3, we performed immunofluorescence analysis on mouse stat3−/− ESC transiently transfected with different forms of STAT3. Transient expression of STAT3 Y705F was not enough informative and immunofluorescence was not clear. For this reason we decided to test different approaches to better understand the correct localization of this mutated form of STAT3. As reported in Fig. 5 C, isolation of mitochondria was performed and protein extracts were used for western blot analysis: surprisingly, STAT3 Y705F seemed to precipitate together with mitochondria. Hence, we hypothesised that the mutation at the level of the tyrosine 705 prevents the correct migration of the protein through the outer mitochondrial membrane (OMM). To test this hypothesis, we decided to perform DAB (3,3’-Diaminobenzidine) immunohistochemistry on ESC expressing STAT3 Y705F protein. As shown in Fig. 5 D, WT STAT3 localises both in nuclei and mitochondria, and MLS_STAT3_NES is visible only in mitochondria, however, STAT3 Y705F forms clots in the cytoplasm which surround organelles, but it does not pass through the OMM. These results confirm that Y705 is essential for the correct import of STAT3 inside the mitochondrion.
STAT3 S727 phosphorylation is needed for mitoSTAT3-driven promotion of cell proliferation in the TPZ
As phosphorylation to STAT3 S727 seems necessary for mitoSTAT3-driven mtDNA transcription, we tested whether this post-transcriptional modification is also required for the increase of TPZ proliferation downstream of mitochondrial RNA production in the TPZ.
Indeed, the proliferation rate in the TPZ of 48-hpf embryos injected with MLS_mStat3_NES_S727A mRNA resulted significantly lower to that of embryos injected with the WT form (Fig. 6 A,B). However, a mild although significant increase of pcna was detectable in embryos injected with MLS_mStat3_NES_S727A mRNA when compared to non-injected controls, meaning that part of the mitochondrial functions might be conserved even in the absence of S727 phosphorylation (Fig. 6 B).
In mouse 3T3 fibroblasts the MEK-ERK pathway is known to be responsible for STAT3 S727 phosphorylation (Gough et al., 2013). In order to evaluate in vivo the involvement of MEK-ERK pathway in STAT3 S727 phosphorylation, and the downstream effects for mitoSTAT3-driven cell proliferation, we administered a specific inhibitor of MEK kinases PD98059 (Alessi et al.,1995) commonly used in vitro to prevent specifically S727 phosphorylation on STAT3 (Tian and Al., 2004; Wang et al., 2019). After treatment from 24-48 hpf to WT embryos injected with MLS_Stat3_NES and evaluated the relative cell proliferation rate by immune fluorescence using anti Phospho-Histone H3 (pH3) Antibody (Fig. 6C; Fig. S3). Notably, the increase in the number of proliferating cells in the head after injection with MLS_Stat3_NES was abolished by treatment with PD98059 (Fig. 6 C; Fig. S3). Moreover, while a significant difference in the number of pH3-expressing cells occurred between embryos injected with MLS_Stat3_NES and MLS_mStat3_NES_S727A, such difference was not maintained after PD98059 treatment (Fig. 6 C; Fig. S3). All together these results demonstrate that the MEK-ERK pathway is directly responsible for the phosphorylation of STAT3 on S727 residue, thus enabling mitoSTAT3 induced cell proliferation.
Jak2 kinase maintains normal mtDNA transcription and proliferation in the PML and the intestine
After demonstrating that a) mitoSTAT3 driven mitochondrial transcription relies on both Y705 and S727 post-transcriptional phosphorylation, and b) that the consequential proliferation effect downstream of mitochondrial transcription requires functional ERK(MAPK) kinases, we decided to test the dependence of both mitochondrial transcription and cell proliferation on Jak2 Tyrosine-kinase activity. WT embryos were therefore treated from 24 to 72 hpf with AG490, a specific inhibitor of Jak2 widely used as a JAK/STAT3 inhibitor (Park et al., 2014; Garbuz et al., 2014) and the expression of mt_nd2 was assessed by qRT-PCR. When observed at 72 hpf, AG490-treated larvae displayed a significant reduction of mt_nd2 expression in the PML, the inner retina and the primordium of the intestine (Fig. 7 A (arrowheads)), while no significant decrease was present at 48 hpf. (Fig. 7 B). In addition, proliferation activity was found to be significantly reduced in the TPZ of 72-hpf AG490-treated larvae as assayed by in situ hybridization using anti-pcna probe (Fig. 7 C, D).
We also investigated the effect of Jak2 inhibitor in the intestine, a highly proliferating tissue of zebrafish larvae, where mt_nd2 gene is strongly expressed between 3 and 6 dpf (Fig. 8A). The activity of Stat3 in the intestine of zebrafish is consistent with the facts that a) the proliferative and survival effects of IL-6 in murine IECs (intestinal epithelial cells) is largely mediated by STAT3 (Grivennikov et al., 2009), b) that STAT3 is needed for small-intestine crypt stem cell survival, as revealed by conditional mutant mice (Matthews et al., 2011), and c) that Stat3 positive cells in zebrafish intestine represent a population of intestinal Wnt responsive stem cells (Peron et al., 2020). Administration of 60 μM AG490 between 3 and 6 dpf was able to significantly reduce mitochondrial transcription in the intestine of treated larvae with respect to DMSO treated controls (Fig. 8 A, B). Moreover, the treatment of larvae with AG490 caused a significant decrease in the number of intestinal proliferating cells (revealed by immunohistochemistry with anti-pH3 antibody) (Fig. 8 C, D) and resulted in flattening of the intestinal mucosa (Fig. 8 E, F). Taken all together, these experiments demonstrate for the first time in vivo that phosphorylation of the Stat3 Y705 residue, possibly by enabling import of Stat3 into mitochondria, is required in zebrafish for normal mitochondrial transcription and downstream proliferation in the developing TeO and intestine.
The zebrafish stat3−/− null mutant displays impairment of mitochondrial transcription and cell proliferation in CNS and intestine
To confirm data obtained by endogenous Stat3 chemical treatment with either MEK and Jak2 inhibitors, we used the stat3ia23 mutant (from now on called stat3−/−) (Peron et al., 2020), which is predicted to encode a premature stop codon at amino acid 456, thus lacking all functional domains including the dimerization domain and the transactivation domain, harboring Y705 and S727 phosphorylation sites, respectively. Consistently with our previous results, Stat3 genetic ablation caused a significant and clear reduction of both mt_nd2 and pcna transcripts, endorsing the link between Stat3 mitochondrial functions and its role in regulating cell proliferation in different tissues. Notably, about 70% of stat3−/− larvae display severe defects in the development of intestinal epithelium (Peron et al., 2020): as revealed by pHH3 immunostaining, intestinal mitoses are almost absent (Fig. 8 B-B’) and the intestine fails to fold (Fig. 9 C-C’). These phenotypic alterations are almost identical to those induced by AG490 treatment (Fig. 7 B,C). At 6 dpf stat3−/− larvae also show impaired CNS cell proliferation in the Telencephalon (Tel), the Diencephalon (Di) and the TeO, where Pcna is found to be reduced down to 15% with respect to wild-type, supporting, once again, the requirement of Stat3 to maintain normal proliferation in the brain (Fig. 9 D, E).
Interestingly, no overt structural alteration is present in intestinal or brain mitochondria of 6-dpf stat3−/− larvae analysed by Transmission Electron Microscopy (TEM) (Fig. S4 A). Moreover, in order to evaluate the amount of mitochondria, we crossed stat3 mutants with the Tg(CoxVIII-mls:EGFP) transgenic line that expresses a mitochondria- localized form of enhanced GFP. No clear change in the total mitochondria volume was present in the intestine of stat3−/− larvae with respect to WT (Fig. S4 B,C). Together with previous results, this highlights that mitoSTAT3 is only acting as regulator of mitochondrial transcription, without impacting on mitochondria biogenesis or homeostasis.
DISCUSSION
Using zebrafish and taking advantage of a STAT3 harbouring both a mitochondrial localization sequence and a nuclear export signal, we tried to figure out how mitoSTAT3 may act inside the mitochondrion. Interestingly, since mitochondrial mRNAs a) are reduced in stat3ia23/ia23 zebrafish null mutants b) are decreased in embryos treated with the Jak2 kinase inhibitor AG490 and c) the effect of MLS_Stat3_NES in promoting mitochondrial gene expression is abolished by Balapiravir (a mtRNApol inhibitor), our data strongly support, in vivo, a direct link between mitoSTAT3 activity and mitochondrial transcription. This is consistent with the mitochondrial transcriptional role of mitoSTAT3 found in vitro in murine ESC by Carbognin and colleagues (Carbognin et al., 2016). On the other hand, quite surprisingly for a transcription factor, MLS_Stat3_NES mutated in its DNA-binding domain is still able to increase mitochondrial transcription. This result suggests that STAT3, differently from what hypothesized in Macias et al. (2014), does not regulate mtDNA transcription by binding STAT3 responsive elements located in the mtDNA. One of the most fascinating aspects of mitochondria evolution is their progressive incorporation in the machinery of cell regulatory activities such as cell proliferation and apoptosis (Antico Arciuch et al., 2012). By showing that mitoSTAT3-driven mitochondrial transcription controls cell proliferation, at least in intestinal and tectal udifferentiated progenitor cells, our data partially answer the open questions about the mechanisms that synchronize mitochondrial and nuclear activities during cell proliferation.
Canonical STAT3 activation depends on different modifications, such as the phosphorylation at tyrosine 705 (Y705), that induces dimerization and translocation to the nucleus, and at serine 727 (S727), whose function has been reported to have controversial effects on STAT3 nuclear transcriptional activity (Decker et al., 2000; Huang et al., 2014). On the other hand, the post-translational modifications required for mitoSTAT3 import and activity in mitochondria have not been clearly dissected so far, although phosphorylation at S727 has been found to both activate OXPHOS complexes I and II, and suppress ROS production and cytochrome c release following ischemic injury (Meier & Larner, 2014). More recently STAT3 phosphorylation at S727 was also found to be required for STAT3-mediated regulation of ER Ca2+ fluxes and apoptosis through the regulation of the mitochondrial Ca2+ uptake (Avalle et al., 2019). We provide here in vivo evidence that phosphorylation of STAT3 Y705, being required for precise mitochondrial import of STAT3, is needed for STAT3-mediated mitochondrial gene expression. In addition, in accordance with Wegrzyn et al. (2009), we show that mitochondrial STAT3 transcriptional activity in vivo is totally dependent on phosphorylation of the ERK target S727. Notably, it has been shown that loss of S727 phosphorylation causes a significant reduction of neuronal differentiation potential, demonstrating the role of this post-translational modification in determining cell pluripotency and proliferation (Huang et al., 2014). In agreement, while we see no effect in the expression of neural progenitor cells markers upon mitoSTAT3 overexpression, our results show that both mitoSTAT3-mediated mtDNA transcription and cell proliferation can be repressed by targeting S727 with the MEK (kinase of ERK1/2 protein kinase) specific inhibitor PD98059. All in all, our results add new knowledge about the role of mitochondrial STAT3 in the regulation of cellular processes previously thought to be dependent exclusively on canonical STAT3. Together with the fact that mitochondrial STAT3 has been identified as a contributor to RAS-dependent cellular transformation (Gough et al., 2009), we support the idea of ERK-mitoSTAT3-mediated mitochondrial transcription might be a key process in cancer development. Considering that, to date, the vast majority of STAT3-targeted cancer therapeutic approaches focus only on its canonical functions, our findings imply mitochondrial STAT3-specific transcriptional activity as a significant molecular mechanism to be targeted.
MATERIALS AND METHODS
Animal husbandry and lines
Animals were staged and fed as described by Kimmel et al. (1995) and maintained in large scale aquaria systems.
Embryos were obtained by natural mating, raised at 28 °C in Petri dishes containing fish water (50X: 25 g Instant Ocean, 39.25 g CaSO4 and 5 g NaHCO3 for 1 L) and kept in a 12:12 light-dark (LD) cycle. All experimental procedures complied with European Legislation for the Protection of Animals used for Scientific Purposes (Directive 2010/63/EU).
stat3ia23 mutants are described in Peron et al. (2020). Tg(CoxVIII-mls:EGFP) transgenic zebrafish line is described in Martorano et al. (2019).
Drug treatments
The following chemical compounds were used: AG490 (T3434, Sigma Aldrich); PD98059 (PHZ1164, Thermo Fisher Scientific); Balapiravir (HY-10443, DBA). Before drug administration, a hole was made in the chorion of 8 hpf embryos, while 24 hpf embryos were dechorionated. All drugs were dissolved in DMSO and stored in small aliquots at −20°C. 100 μM AG490 treatment was performed from 24 to 48 hpf or from 24 to 72 hpf. 60 μM AG490 was administrated in 3-6 dpf treatments. 12.5 μM PD98059 treatment was administrated from 24 to 48 hpf. 50 μM Balapiravir solution was administrated from 8 to 48 hpf. After treatments, embryos were either anesthetized and fixed in 4% paraformaldehyde (PFA)(158127, Sigma) in PBS for ISH, FISH and IHC or in TRI Reagent® (T9424, Sigma) for qRT-PCR analysis.
mRNAs synthesis and injection
mStat3, mStat3_Y705F and mStat3_S727A CDSs were obtained from pCEP4-Stat3-WT, pCEP4-Stat3-Y705F, pCEP4-Stat3-S727A plasmids (a kind gift of the Poli Lab; Department of Molecular Biotechnology and Health Sciences, Molecular Biotechnology Center, University of Turin) and sub-cloned into a pCS2+ backbone using the In-Fusion® HD Cloning Kit (Clonetech). MLS_mStat3_NES CDS, containing the murine Stat3 cDNA flanked by a Mitochondrial Localization Sequence (MLS) and a Nuclear Export Sequence (NES), was subcloned into a pCS2+ plasmid from a 70_pPB-CAG+MLS+Stat3+NES-pA-pgk-hph-2-2 plasmid by digestion with XbaI and BamHI. Mutated forms of MLS_mStat3_NES mRNA were obtained from pCS2+MLS_mStat3_NES by site directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (NEB); primers are indicated in Table 1.
mRNAs were in vitro transcribed using the mMESSAGE mMACHINE® SP6 Transcription Kit (Thermo Fisher Scientific) and purified using the RNA Clean and Concentrator kit (Zymo Research). A mix containing mRNA (30 ng/μL for Stat3-WT, Stat3-Y705F, Stat3-S727A; 50 ng/μL for MLS_Stat3_NES), Danieu injection Buffer and Phenol Red injection dye, was injected into 1-cell stage embryos.
mRNA isolation and quantitative real time reverse transcription PCR (qRT-PCR)
For expression analysis, total RNA was extracted from pools of 15 7-dpf larvae or 35 48-hpf embryos with TRIzol reagent (Thermo Fisher Scientific, 15596018). mRNA was treated with RQ1 RNase-Free DNase (Promega, M6101) and then used for cDNA synthesis with Superscript III Reverse Transcriptase (Invitrogen, 18080-044) according to the manufacturer’s protocol. qPCRs were performed in triplicate with EvaGreen method using a Rotor-gene Q (Qiagen) and the 5x HOT FIREPol ® EvaGreen® qPCR Mix Plus (Solis BioDyne, 08-36-00001) following the manufacturer’s protocol. The cycling parameters were: 95 °C for 14 min, followed by 45 cycles at 95 °C for 15 s, 60 °C for 35 s, and 72°C for 25 s. Threshold cycles (Ct) and dissociation curves were generated automatically by Rotor-Gene Q series software. Sequences of specific primers used in this work for qRT-PCR and RT-PCR are listed in Table 2. Primers were designed using the software Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/input.htm). Sample Ct values were normalized with Ct values from zebrafish gapdh.
Immunoblotting and mitochondria isolation
Immunoblotting was performed as previously described in Carbognin et al. (2016). Following antobodies were used: anti-STAT3 mouse monoclonal (Cell Signalling, 9139) (1:1000), anti-GAPDH mouse monoclonal (Millipore, MAB374) (1:1000), anti-VDAC1 rabbit polyclonal (abcam, ab15895) (1:1000), anti-Lamin () (1:1000), anti-bActin mouse monoclonal (Invitrogen, MA1-744) (1:10000). Mitochondria from mouse ESCs were isolated using Mitochondria isolation kit (Thermo Scientific, 89874).
3,3’-Diaminobenzidine staining
Cells were fixed in a 24 wells plate with 4% Paraformaldehyde in PBS (pH 7,4) for 30 minutes at RT (room temperature). After fixation cells were washed 5 times with PBS (5 minutes each), blocked and permeabilized with 5% normal goat serum and 0,1% saponin in PBS for 30 min, and then incubated with primary antibody anti-STAT3 mouse monoclonal (Cell Signalling, 9139) ON at 4°C in PBS 5% normal goat serum and 0,05% saponin. After 5 washes with PBS (5 minutes each), cells were incubated with HRP-conjugated Fab fragments of the secondary antibody for 2 hours at RT. After 5 washes, cells were incubated in the DAB solution (0.01gr DAB in 20ml TRIS-HCl buffer plus 30% H2O2 solution just before use). Subsequently the samples ware postfixed with 1% osmium tetroxide plus potassium ferrocyanide 1% in 0.1M sodium cacodylate buffer for 1 hour at 4°C. After three water washes, samples were dehydrated in a graded ethanol series and embedded in an epoxy resin (Sigma-Aldrich). Ultrathin sections (60-70 nm) were obtained with an Ultrotome V (LKB) ultramicrotome, counterstained with uranyl acetate and lead citrate and viewed with a Tecnai G2 (FEI) transmission electron microscope operating at 100 kV. Images were captured with a Veleta (Olympus Soft Imaging System) digital camera.
Immunofluorescence
ES cells were grown and transfected as described by Carbognin et al. (2016). For IF ESCs were fixed for 10 min in cold methanol at −20 °C, washed in TBS, permeabilized for 10 min with TBST + 0.3% Triton X-100 at RT, and blocked for 45 min in TBS + 3% goat serum at RT. The cells were incubated overnight at 4 °C with primary antibodies (anti-STAT3 mouse monoclonal (Cell Signalling, 9139) (1:100); anti-ATAD3A rabbit monoclonal (AB-Biotechnologies, 224485) (1:100). After washing with TBS, the cells were incubated with secondary antibodies (Alexa, Life Technologies) for 30 min at RT. Cells were mounted with ProLong® Gold Antifade Mountant with DAPI (Life Technologies, cat. P36941) or HOECHST 33342 (Thermo Fisher cat. 62249) where specifield. Images were acquired with a Leica SP2 confocal microscope equipped with a CCD camera.
In situ hybridization
Whole mount RNA in situ hybridization on zebrafish embryos was performed as previously described (Thisse et al., 1993). It is worth mentioning that treated and control embryos were hybridized together. stat3 probe was obtained by PCR amplification from embryos cDNA using stat3_probe-fw (TGCCACCAACATCCTAGTGT) and stat3_probe-rv (GCTTGTTTGCACTTTTGACTGA) primers. mt_nd2 probe was obtained by PCR amplification from embryos cDNA using mt_nd2-fw (GCAGTAGAAGCCACCACAAA) and mt_nd2-rv (GGAATGCCGCGGATGTTATA) primers. pcna probe was obtained as described by Baumgart et al. (2014). sox9b probe was obtained as described by Chiang et al. (2001). her5 probe was obtained as described by Bally-Cuif, et al. (2000). her4 probe was obtained as described by Takke et al. (1999). Fluorescence in situ hybridization was performed with FastBlue or TSA-amplification kit (Invitrogen) as described by Lauter et al. (2011).
Transmission Electron Microscopy analysis
Larvae were anesthetised and fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer. After that, samples were dehydrated, embedded in epoxy resin, and prepared according standard protocols by the Trasmission Electron Microscopy facility at the Department of Biology (University of Padova).
Statistical analysis
Statistical analysis was performed with Graph Pad Prism V6.0. Data are presented as the means ± SEM and statistical analysis was determined by unpaired two tailed Student’s t-test. The p-values are indicated with the following symbols: *, P<0.05; **, P<0.01; ***, P< 0.001; ****, P<0.0001. For quantitative analysis, the sample size for each experiment was calculated assuming a Confidence Level of 95% (z-score 1,96), a standard deviation of 0.5 and a Confidence Interval (margin of error) of 5%.
Competing interests
The authors declare no competing or financial interests.
SUPPLEMENTARY FIGURES
Acknowledgments
We would like to thank Dr Luigi Pivotti, Dr Martina Milanetto, Dr Carlo Zatti, Dr Ludovico Scenna, and Shkendy Iljazi for their professional help in managing Padua Zebrafish Facility and Andrea Vettori for his technical support. We are also grateful to Valeria Poli and Annalisa Camporeale for their kind gift of murine STAT3 encoding plasmids and their criticisms.
The work is supported by the AIRC grant IG 2017 19928.