ABSTRACT
Embryonic aneuploidy is highly complex, often leading to developmental arrest, implantation failure, and/or spontaneous miscarriage in both natural and assisted reproduction. Despite our knowledge of mitotic missegregation in somatic cells, the molecular pathways regulating chromosome fidelity during the error-prone cleavage-stage of mammalian preimplantation development remain largely undefined. Using bovine embryos and live-cell fluorescent imaging, we observed frequent micro-/multi-nucleation of missegregated chromosomes in initial divisions that persisted, re-fused with the primary nucleus, or formed a chromatin bridge with neighboring cells. A correlation between a lack of syngamy, multipolar cytokinesis, and uniparental genome segregation was also revealed and single-cell DNA-seq showed complex genotypes propagated by subsequent divisions. Depletion of the checkpoint protein, BUB1B/BUBR1, resulted in atypical cytokinesis, micro-/multi-nuclei formation, chaotic aneuploidy, and developmental arrest. This demonstrates that embryonic micronuclei sustain multiple fates, provides an explanation for blastomeres with uniparental origins, and substantiates defective BUB1B/BUBR1 signaling as a major contributor to mitotic aneuploidy.
INTRODUCTION
Multiple studies across higher-order mammalian species, including humans, have established that in vitro-derived embryos suffer from remarkably frequent whole chromosomal losses and gains termed aneuploidy (Chavez et al., 2012; Chow et al., 2014; Daughtry et al., 2019; J. Huang et al., 2014; Johnson et al., 2010; Vanneste et al., 2009). Depending on the type and severity of the chromosome segregation error, many aneuploid embryos will undergo developmental arrest and/or result in early pregnancy loss if transferred. Estimates of embryonic aneuploidy in vivo are difficult to ascertain (Miller et al., 1980; Wilcox, Weinberg, & Baird, 1995; Zinaman, Clegg, Brown, O’Connor, & Selevan, 1996), but ~50-70% of spontaneous miscarriages following natural conception in women are diagnosed as karyotypically abnormal (Hassold et al., 1980; Menasha, Levy, Hirschhorn, & Kardon, 2005; Schaeffer et al., 2004). Aneuploidy can arise either meiotically during gametogenesis, or post-zygotically from the mitotic cleavage divisions of preimplantation development. Although significant effort has been put forth to identify specific contributors to meiotic chromosome missegregation, particularly with advanced maternal age (McCoy, 2017; Schneider & Ellenberg, 2019; Webster & Schuh, 2017), much less is known about the molecular mechanisms underlying mitotic aneuploidy generation. This is in spite of findings that mitotic errors are equally or more prevalent than meiotic errors and arise independently of maternal age or fertility status (Chavez et al., 2012; Chow et al., 2014; McCoy, Demko, Ryan, Banjevic, Hill, Sigurjonsson, Rabinowitz, Fraser, et al., 2015; McCoy, Demko, Ryan, Banjevic, Hill, Sigurjonsson, Rabinowitz, & Petrov, 2015; Vanneste et al., 2009). Since the first three mitotic divisions are the most error-prone and activation of the embryonic genome does not occur until the 4- to 8-cell stage in the majority of mammals (Braude, Bolton, & Moore, 1988; Dobson et al., 2004; Plante, Plante, Shepherd, & King, 1994), it was suggested that maternally-inherited signaling factors regulating early mitotic chromosome segregation may be lacking or compromised in mammalian preimplantation embryos (Mantikou, Wong, Repping, & Mastenbroek, 2012; Taylor et al., 2014; Tsuiko et al., 2019).
There are several known contributors to aneuploidy and tumorigenesis in somatic cells, such as loss or prolonged chromosome cohesion, defective spindle attachments, abnormal centrosome number, and relaxed cell cycle checkpoints (Ganem, Godinho, & Pellman, 2009; Soto, Raaijmakers, & Medema, 2019). Regardless of the mechanism, chromosomes that are missegregated during meiosis or mitosis will become encapsulated into micronuclei and can contribute to aneuploidy in subsequent divisions. In embryos, research has primarily focused on the spindle assembly checkpoint (SAC) and mostly with mice that normally exhibit a low incidence of micronucleation and aneuploidy (Lightfoot, Kouznetsova, Mahdy, Wilbertz, & Hoog, 2006; Macaulay et al., 2015; Treff et al., 2016; Vazquez-Diez, Yamagata, Trivedi, Haverfield, & FitzHarris, 2016). Thus, murine embryos are often treated with chemicals that inhibit spindle formation or SAC function to induce chromosome missegregation (Bolton et al., 2016; Singla, Iwamoto-Stohl, Zhu, & Zernicka-Goetz, 2020; Vazquez-Diez, Paim, & FitzHarris, 2019b; Wei et al., 2011), which target multiple genes and can have variable or off-target effects (S. Chen et al., 2007; Gascoigne & Taylor, 2008; Miyazawa, 2011). By monitoring bipolar attachment of spindle microtubules to kinetochores during mitosis, the mitotic checkpoint complex (MCC) prevents activation of the anaphase promoting complex/cyclosome (APC/C) and delays mitotic progression in the absence of stable bipolar kinetochore-microtubule attachments (Fogarty et al., 2017). This delay, however, is only temporary and cells with an unsatisfied checkpoint will eventually arrest or exit mitosis prematurely. The core components of the MCC are evolutionarily conserved and include CDC20, as well as the serine/threonine kinases, BUB1B, BUB3, and MAD2. BUB1B (also known as BUBR1), the largest of the MCC proteins, is normally present throughout the cell cycle and proposed to have both SAC-dependent and independent functions (Elowe et al., 2010). Besides being directly associated with unattached or incorrectly attached kinetochores, BUB1B also has a role in stabilizing kinetochore–microtubule attachments and chromosome alignment via BUB3 binding (Meraldi & Sorger, 2005; G. Zhang, Mendez, Sedgwick, & Nilsson, 2016). Without BUB1B, the MCC no longer localizes to unattached kinetochores to prevent incorrect or deficient spindle attachments, resulting in the generation of aneuploid daughter cells (Homer, Gui, & Carroll, 2009; Lampson & Kapoor, 2005). Whether the MCC is functional in the initial mitotic divisions of mammalian embryogenesis is currently unclear (Vazquez-Diez et al., 2019b; Wei et al., 2011) and remains to be studied in a mammal that undergoes a high incidence of mitotic aneuploidy in the absence of chemical induction.
Cattle typically ovulate only one mature oocyte-containing follicle per month and share other key characteristics of preimplantation development with humans, including the timing of the first mitotic divisions, stage at which the major wave of embryonic genome activation (EGA) occurs, and approximate percentage of embryos that typically reach the blastocyst stage (Alper, Brinsden, Fischer, & Wikland, 2001; Sugimura et al., 2012; Wong et al., 2010). Furthermore, single-nucleotide polymorphism (SNP) genotyping and next generation sequencing (NGS) revealed that the frequency of aneuploidy (~32-85%) in cattle is likely similar to humans (Destouni et al., 2016; Hornak et al., 2016; Tsuiko et al., 2017). Destouni et al. also demonstrated that bovine zygotes can segregate parental genomes into different blastomeres during the first cleavage division, but the mechanism by which this occurs has not yet been determined (Destouni et al., 2016). Thus, with the ethical and technical limitations of human embryo research, bovine embryos represent a suitable model for studying the dynamics of micronuclei formation and aneuploidy generation during preimplantation development. In this study, we used a combination of time-lapse and live-cell fluorescent imaging with single-cell DNA-seq (scDNA-seq) for copy number variation (CNV) analysis, to assess mitotic divisions in bovine embryos from the zygote to 12-cell stage and visualize chromosome segregation in real-time. We also evaluated the lack of MCC function on cytokinesis, micronucleation, mitotic aneuploidy, and developmental arrest, characteristics commonly observed during early embryogenesis in higher-order mammals.
RESULTS
Micronuclei formation is relatively common in early cleavage-stage bovine embryos
Although micronuclei-like structures have been detected in bovine embryos previously (Yao et al., 2018), their prevalence or whether they were associated with a particular stage of preimplantation development was not determined. To address this, we generated a large number (N=53) of bovine embryos by in vitro fertilization (IVF) and fixed them at the zygote to blastocyst stage to evaluate DNA integrity with DAPI and nuclear structure by immunostaining for the nuclear envelope marker, LAMIN-B1 (LMNB1; Fig. 1A). Immunofluorescent labeling revealed the presence of micronuclei as early as the zygote stage that were distinct from the maternal and paternal pronuclei (Fig. 1B). Several micronuclei, as well as multiple nuclei (multinuclei) of similar size, were also detected at the 2- to 4-cell stage (Fig. 1C). Overall, ~37.7% (N=20/53) of early cleavage-stage bovine embryos exhibited micro-/multi-nuclei formation in one or more blastomeres. This suggests that unlike mice, which rarely exhibit micronucleation during initial mitotic divisions (Vazquez-Diez et al., 2019b), encapsulation of missegregated chromosomes into micronuclei prior to EGA is conserved between cattle and primates (Chavez et al., 2012; Daughtry et al., 2019). A similar examination of bovine blastocysts also immunostained for the trophoblast marker, Caudal Type Homeobox 2 (CDX2), demonstrated that micronuclei often reside in the trophectoderm (TE; Fig. 1D), but can also be contained within the inner cell mass (ICM) of the embryo (Fig. 1E).
Live-cell fluorescent imaging reveals micronuclei fate and the origin of uniparental cells
To confirm the frequency of micro- and multi-nuclei in cleavage-stage embryos and determine the fate of these nuclear structures in real-time, we microinjected bovine zygotes (N=90) with fluorescently labeled modified mRNAs and monitored the first three mitotic divisions by live-cell confocal microscopy (Fig. 1A). While Histone H2B and/or LMNB1 were used to visualize DNA and nuclear envelope, respectively, Factin was injected to distinguish blastomeres (Supplemental Movie S1). Of the microinjected embryos, ~18.9% (N=17/90) failed to complete cytokinesis during microscopic evaluation, while ~53.3% (N=49/90) exhibited normal bipolar divisions and ~27.8% (N=25/90) underwent multipolar divisions from 1- to 3-cells or more (Fig. 2A). In accordance with our immunostaining findings, ~31.1% (N=28/90) of the embryos contained micro- and/or multi-nuclei and anaphase lagging of chromosomes was detected prior to their formation in three of these embryos at the zygote (Fig. 2B) or 2-cell stage (Fig. 2C). Micro- and multi-nucleation was more frequently associated with bi-polar divisions (Fig. 2A) and an examination of micronuclei fate demonstrated an equal incidence of unilateral inheritance (Fig. 2D) or fusion back with the primary nucleus (Fig. 2E), while a smaller percentage appeared to form a chromatin bridge between blastomeres (Fig. 2F, Supplemental Fig. S2 and Supplemental Movie S1). Interestingly, the majority of multipolar embryos (76%; N=19/25) underwent the abnormal division after bypassing syngamy, or the fusion of maternal and paternal pronuclei (Fig. 2G), and/or produced daughter cells that did not contain any apparent nuclear structure (Fig. 2H). These results helped explain previous findings of blastomeres with uniparental origins and those that completely lacked nuclear DNA when assessed by SNP genotyping and/or NGS (Daughtry et al., 2019; Destouni et al., 2016; Middelkamp et al., 2020).
Non-reciprocal mitotic errors and chaotic aneuploidy are propagated by subsequent divisions
Although SNP arrays or NGS have been used previously to assess aneuploidy in cleavage-stage bovine embryos, these studies were limited as they reported a large range in aneuploidy frequency (~32-85%), examined a single stage of development, and/or evaluated only a portion of the embryo (Destouni et al., 2016; Hornak et al., 2016; Tsuiko et al., 2017). Therefore, our next objective was to determine the precise frequency of aneuploidy in a large number of bovine embryos (N=38) disassembled into individual cells at multiple cleavage stages (Fig. 1A and Supplemental Table 1). All cells from the 38 embryos were assessed to ensure an accurate representation of the overall embryo, resulting in a total of 133 blastomeres analyzed from the 2- to 12-cell stage (Fig. 3A). Based on previously described criteria (Daughtry et al., 2019), we classified 25.6% (N=34/133) of blastomeres as euploid, 35.3% (N=47/133) as aneuploid, 3% (N=4/133) solely containing segmental errors, and 17.3% (N=23/133) exhibiting chaotic aneuploidy, with the remaining cells either failing WGA (10.5%; N=14/133) or identified as empty due to the amplification and detection of only mitochondrial DNA (8.3%; N=11/133). After reconstructing each embryo, we determined that ~16% (N=6/38) were entirely euploid, whereas ~55% (N=21/38) were comprised of only aneuploid cells (Fig. 3B). An additional ~29% (N=11/38) were categorized as mosaic since they contained a combination of both euploid and aneuploid blastomeres, of which ~18% (N=2/11) had incurred segmental errors only, or DNA breaks of 15 Mb in length or larger that did not affect the whole chromosome. The X chromosome was by far the most frequently impacted by whole chromosomal losses and gains, whereas chromosome 5 (human chromosomes 12 and 22), 7 (human chromosomes 5 and 19), 11 (human chromosomes 3 and 9), and 29 (human chromosome 11) were commonly subjected to DNA breakage (Fig. 3C). While meiotic missegregation was identified in ~16% (N=6/38) of the embryos (Fig. 3D), mitotic aneuploidy accounted for the majority (~66%; N=25/38) of errors, with the remaining ~18% (N=7/38) exhibiting the genotypic complexity characteristic of chaotic aneuploidy (Fig. 3E). Of the embryos with meiotic errors, many (~67%; N=4/6) also experienced mitotic missegregation of different chromosomes than those originally affected during meiosis (Fig. 3F). Moreover, reciprocal losses and gains, whereby chromosomes lost from one blastomere were found in a sister blastomere, accounted for only ~25% (N=8/29) of the mitotic errors (Fig. 3D and 3F).
BUB1B deficiency induces multipolar divisions, blastomere asymmetry and mitotic arrest
Since the chromosome constitution and division dynamics observed in certain bovine embryos suggested a lack of adequate cell cycle checkpoints, our next objective was to determine whether the loss of MCC function was associated with micronuclei formation and aneuploidy at the early cleavage stage (Fig. 1A). We focused our attention on BUB1B, the largest of the MCC proteins present throughout the cell cycle that helps ensure that inhibition of anaphase until the kinetochores of all chromosomes are correctly attached to the mitotic spindle (Elowe et al., 2010). Two non-overlapping morpholino antisense oligonucleotides (MAOs) were designed to specifically inhibit the translation of BUB1B mRNA by targeting the ATG translation start site (BUB1B MAO #1) or a sequence upstream within the 5’ UTR (BUB1B MAO #2) and tested before use in embryos (Supplemental Fig. S2). Bovine zygotes were microinjected with either BUB1B MAO #1 (N=48), BUB1B MAO #2 (N=36), or Std Control MAO (N=81) and cultured under a time-lapse imaging microscope to monitor developmental dynamics. Each embryo was morphologically assessed and categorized as having either normal or abnormal divisions for comparison to untreated (non-injected) embryos (N=180). In the BUB1B MAO #1 treatment group, a large percentage (37.5%; N=18/48) of the zygotes failed to undergo the first cleavage division (Table 1) and a subset (8.3%; N=4/48) of these embryos attempted to divide by forming cleavage furrows multiple times (Fig. 4A), but never successfully completed cytokinesis (Supplemental Movie S2). Of those BUB1B MAO #1 zygotes that did divide, only a small proportion (18.8%; N=9/48) were normal bipolar divisions. Instead, many embryos (63.0%; N=17/27) exhibited abnormal cleavage, including multipolar divisions and/or blastomere asymmetry (Supplemental Movie S3 and Supplemental Movie S4, respectively), with similar results obtained following injection with the BUB1B MAO #2 (Table 1 and Fig. 4B). Despite the phenotypic similarities between the two non-overlapping MAOs, we further assessed BUB1B MAO specificity by conducting embryo rescue experiments with modified BUB1B mRNA that would not be directly targeted by the MAO. BUB1B mRNA with a mutated MAO binding sequence was microinjected into bovine zygotes, along with BUB1B MAO #1 (N=85), and embryos cultured up to the blastocyst stage (Fig. 4C). While no embryos formed blastocysts following injection of either the BUB1B MAO #1 or #2, 45% (N=23/51) of the BUB1B MAO #1+mRNA co-injected embryos underwent cleavage divisions and reached the blastocyst stage (Fig. 4D). This percentage was similar to that obtained from the non-injected embryos and following injection with the Std Control MAO, confirming that the knockdown of BUB1B expression and rescue of BUB1B-induced mitotic defects were specific.
BUB1B-deficient embryos exhibit chaotic aneuploidy and asymmetric genome distribution
Because BUB1B MAO-injected embryos exhibited atypical cytokinesis and mitotic arrest, we examined nuclear structure and CNV in BUB1B-deficient embryos by immunofluorescence and scDNA-seq, respectively (Fig. 1A). LMNB1 immunostaining of BUB1B MAO #1 and #2 treated bovine embryos revealed both micro- and multi-nuclei in embryos that did not attempt division or were unable to complete the first cytokinesis (Fig. 4E). Similar abnormal nuclear structures, as well as empty blastomeres, were also observed in BUB1B MAO-injected embryos that successfully divided. Moreover, DNA that lacked or had defective nuclear envelope was apparent in the blastomeres of BUB1B deficient cleavage-stage embryos. Disassembly of the embryos into individual cells for assessment of DNA content and CNV analysis demonstrated that while some euploid blastomeres were obtained following BUB1B MAO injection, BUB1B deficiency mostly produced blastomeres with chaotic aneuploidy (Fig. 4F). Analogous to the uninjected controls with chaotic aneuploidy (Fig. 3E), a complete loss of certain chromosomes and a gain of up to 5-6 copies of other chromosomes were detected, suggesting that the lack of BUB1B permits asymmetrical genome distribution in embryos.
Lack of BUB1B in zygotes impacts expression of other mitosis and cell cycle-related genes
Given that inappropriate expression of maternally-inherited signaling factors has been suggested to regulate early mitotic chromosome segregation in mammalian preimplantation embryos (Mantikou et al., 2012; Taylor et al., 2014; Tsuiko et al., 2019), we next determined whether BUB1B deficiency impacted the expression of other key genes (Fig. 1A). Therefore, the relative abundance of mitotic, cell cycle, developmentally-regulated, and cell survival genes was assessed in individual BUB1B MAO #1 versus non-injected and Std Control-injected MAO embryos (Supplemental Fig. S3 and Supplemental Table 2) via microfluidic quantitative RT-PCR (qRT-PCR). Besides BUB1B, other genes involved in cytokinesis and chromosome segregation such as amyloid beta precursor protein binding family B member 1 (APBB1), which inhibits cell cycle progression, aurora kinase B (AURKB), Polo-like kinase 1 (PLK1), and Ribosomal protein S6 kinase alpha-5 (RPS6KA5) were significantly downregulated in BUB1B MAO-injected embryos relative to the controls (Fig. 5A; p≤0.05). Additional genes, including those associated with the extracellular matrix (cartilage acidic protein 1; CRTAC1 and ADAM metallopeptidase with thrombospondin type 1 motif 2; ADAMTS2) and stress response (Endoplasmic Reticulum Lectin 1; ERLEC1) were also significantly decreased in BUB1B deficient embryos in comparison to the noninjected and Std Control MAO-injected embryos. In contrast, genes involved in cell cycle progression such as Epithelial Cell Transforming 2 (ECT2), pogo transposable element derived with ZNF domain (POGZ), centromere protein F (CENPF), and Ribosomal protein S6 kinase alpha-4 (RPS6KA4), were significantly upregulated in BUB1B MAO-injected embryos, along with microtubule polymerization (HAUS augmin like complex subunit 6; HAUS6) or orientation (Synaptonemal complex protein 3; SCP3) genes (Fig. 5B; p<0.05). Thus, in the absence of BUB1B, we postulate that zygotes still entered mitosis, but were unable to obtain proper microtubule-kinetochore attachments prior to the first cytokinesis despite several attempts. This resulted in dysregulation of other genes important for mitotic exit, cytokinesis, and chromosome segregation, suggesting that inhibition of the MCC via reduced BUB1B abundance does indeed impact early cleavage divisions in higher mammals.
DISCUSSION
Aneuploidy is a major cause of embryo arrest, implantation failure, and spontaneous miscarriage across most mammalian species. Yet, relatively little is still known about the molecular mechanism(s) underlying aneuploidy generation and pregnancy loss during embryonic or fetal development. Of the known factors that contribute to aneuploidy and tumorigenesis in somatic cells, only cell cycle checkpoints have been examined during embryogenesis (Bolton et al., 2016; Singla, Iwamoto-Stohl, Zhu, & Zernicka-Goetz, 2020; Vazquez-Diez, Paim, & FitzHarris, 2019b; Wei et al., 2011). Unlike tumors and cancer cells, which often overexpress SAC proteins and rarely sustain SAC gene mutations (Schvartzman, Sotillo, & Benezra, 2010), cleavage-stage human embryos tend to underexpress cell cycle checkpoints (Kiessling et al., 2009, 2010). Knockout or hypomorphic studies of the core SAC component, BUB1B/BUBR1, was shown to result in meiotic missegregation, postimplantation lethality, infertility, and aging (Baker et al., 2004; Schmid et al., 2014; Touati et al., 2015). Relatively few studies, however, have investigated the role of specific SAC proteins in early cleavage divisions when mitotic aneuploidy typically occurs (Vazquez-Diez, Paim, & FitzHarris, 2019a). Additionally, these studies were conducted in mouse embryos, which naturally exhibit a low incidence (~1-4%) of aneuploidy (Lightfoot et al., 2006; Macaulay et al., 2015; Treff et al., 2016) unless chemically induced (Bolton et al., 2016; Singla et al., 2020; Vazquez-Diez et al., 2019b; Wei et al., 2011). Using a combination of live-cell imaging and single-cell DNA-seq, here we visualized mitotic chromosome segregation in real-time from the zygote to the ~12-cell stage and assessed the specific role of BUB1B in embryos from a monovulatory animal model that suffers from a comparable incidence of aneuploidy and developmental arrest as humans.
While micronuclei-like structures have been previously detected in bovine embryos (Yao et al., 2018), we were able to assess their prevalence throughout preimplantation development and follow their fate in subsequent mitotic divisions. Of the cleavage-stage bovine embryos examined by immunostaining or live-cell imaging, over ~30% contained micro- or multi-nuclei and anaphase lagging of chromosomes was detected in certain embryos prior to micronuclei formation. When we evaluated other cellular behaviors that might indicate how these atypical nuclear structures formed, we observed that most micronuclei-containing embryos underwent normal bipolar divisions, excluding abnormal cytokinesis as the primary mechanism. However, multipolar divisions were associated with a lack of syngamy and often produced cells that did not contain any apparent nuclear structure (Fig. 6A). Unlike mouse embryos, which exhibit spatial separation of parental genomes by dual-spindle formation (Mayer, Smith, Fundele, & Haaf, 2000; Reichmann et al., 2018), bovine embryos normally undergo syngamy at the zygote stage (Yao et al., 2018). By avoiding syngamy and undergoing multipolar cytokinesis, zygotes differentially segregate entire parental genomes to daughter cells, helping to explain previous findings of heterogoneic divisions and the production of blastomeres with uniparental origins in both cattle and primates (Daughtry et al., 2019; Destouni et al., 2016; Middelkamp et al., 2020). Examination of micronuclei fate in subsequent divisions revealed an equal incidence of unilateral inheritance and fusion back with the primary nucleus, with a smaller percentage of embryos exhibiting a chromatin bridge between blastomeres following micronuclei formation (Fig. 6B). Because cancer cell micronuclei have been shown to contain extensive DNA damage upon re-fusion with the primary nucleus (Crasta et al., 2012; Y. Huang et al., 2012; C. Z. Zhang et al., 2015), whether there are differences in chromosomal integrity and developmental outcome between these events should be determined. Nevertheless, a similar assessment of bovine blastocysts determined that micronuclei often reside in the placental-derived TE, but can also be contained within the ICM of the embryo, where they may be less tolerated.
Given the large range in the percentage of aneuploidy (~32-85%) and differences in the whole-genome method used in previous studies (Destouni et al., 2016; Hornak et al., 2016; Tsuiko et al., 2017), we sought to comprehensively assess the aneuploidy frequency in bovine embryos at multiple cleavage stages using an approach that provided uniform genome coverage and avoided the input of parental DNA (Borgstrom, Paterlini, Mold, Frisen, & Lundeberg, 2017; de Bourcy et al., 2014); (McCoy, Demko, Ryan, Banjevic, Hill, Sigurjonsson, Rabinowitz, Fraser, et al., 2015; McCoy et al., 2018). After reconstructing each cleavage-stage embryo and combining the results, we determined that ~55% of the embryos contained only aneuploid cells, whereas another ~29% were mosaic, all of which were primarily the product of non-reciprocal mitotic errors. In those embryos with meiotic errors, most also experienced mitotic missegregation of different chromosomes than those originally affected during meiosis and the remaining aneuploid embryos exhibited a compete loss and/or a gain of up to 6 copies of chromosomes characteristic of chaotic aneuploidy. This indicates that embryos with meiotic missegregation are more prone to mitotic errors and propagated by subsequent divisions, which helps explain the large genotypic complexity reported in human IVF embryos (Chavez et al., 2012; Chow et al., 2014; McCoy, Demko, Ryan, Banjevic, Hill, Sigurjonsson, Rabinowitz, Fraser, et al., 2015; Vanneste et al., 2009).
Because of apparent disparity on whether the MCC is functional in the early cleavage divisions of mammalian preimplantation development in previous studies (Vazquez-Diez et al., 2019b; Wei et al., 2011), we investigated the consequences of MCC inhibition by directly targeting BUB1B in bovine zygotes. Following injection, BUB1B MAO embryos either failed to divide even after several attempts or exhibited abnormal divisions that were multipolar and/or asymmetrical (Fig. 6C). Furthermore, immunostaining of the BUB1B MAO treated embryos that did divide revealed blastomeres with severely abnormal nuclear structures or those that were completely devoid of DNA. CNV analysis of blastomeres that did contain nuclear DNA showed chaotic aneuploidy, with a complete loss or excessive number of chromosomal copies as described in some uninjected embryos and recently reported in primate embryos with multipolar divisions (Daughtry et al., 2019). We speculate that without BUB1B, embryos were unable to obtain proper microtubule-kinetochore attachments prior to the first cytokinesis, resulting in failed SAC and arrest, or premature cell division and chromosome missegregation due to MCC dysregulation. The role of another SAC protein, Mad2, was also recently investigated in mouse embryos and while 40% Mad2 knockdown had no effect on blastocyst formation, it did increase the number of micronuclei present at the morula stage (Vazquez-Diez et al., 2019b). Both MAD2 and BUB1B bind CDC20 to prevent activation of the APC, but in vitro binding assays demonstrated that BUB1B is 12 times more effective than MAD2 in inhibiting CDC20 (Fang, 2002). In addition, it was shown in Drosophila that the recruitment of CDC20 to the kinetochore requires BUB1B and not MAD2 (Li, Morley, Whitaker, & Huang, 2010) and that BUB1B is maternally inherited (Perez-Mongiovi, Malmanche, Bousbaa, & Sunkel, 2005). Thus, these studies help explain the robust effect of BUB1B deficiency observed here and suggests that inhibition of the MCC via BUB1B knockdown impacts early cleavage divisions in higher mammals by allowing multipolar cytokinesis and asymmetrical genome partitioning to occur.
The expression of additional genes involved in mitosis and cell cycle progression was also affected by BUB1B knockdown and indicates that their abundance may be regulated by BUB1B availability in embryos. One of the downregulated genes included Plk1, which is conserved across both mammalian and non-mammalian species and has been shown to be important for the first mitosis in mouse zygotes (Ajduk, Strauss, Pines, & Zernicka-Goetz, 2017; Baran, Brzakova, Rehak, Kovarikova, & Solc, 2016). In somatic cells, PLK1 localization to non-attached kinetochores is required for the phosphorylation of BUB1B (Elowe, Hummer, Uldschmid, Li, & Nigg, 2007; H. Huang et al., 2008; H. Huang & Yen, 2009) and promotes the interaction of BUB1B with phosphatases that, in turn, inhibit excessive aurora kinase activity at kinetochores through positive feedback (Suijkerbuijk, Vleugel, Teixeira, & Kops, 2012). Therefore, the removal of BUB1B or inhibition of PLK1 increases the phosphorylation of kinase substrates, which has been shown to include ECT2, POGZ, and HAUS6 (Bibi, Parveen, & Rashid, 2013; Kettenbach et al., 2011; Suzuki et al., 2015), genes identified as upregulated following BUB1B knockdown here. Since BUB1B MAO-injected embryos also exhibited increased expression of CENP-F and SYCP3 and both are regulated by PLK1 phosphorylation in other contexts (Bisig et al., 2012; Santamaria et al., 2011), we suspect that these genes also serve as kinase substrates important for mitotic progression during embryogenesis. Additionally, we note that other polo-like kinase family members besides PLK1 have been reported to play a role in tripolar divisions and aneuploidy in human embryos (McCoy, Demko, Ryan, Banjevic, Hill, Sigurjonsson, Rabinowitz, Fraser, et al., 2015; McCoy et al., 2018) and determining how BUB1B cooperates with this regulatory network of kinases to reinforce SAC function and ensure chromosome fidelity during early mammalian embryogenesis requires further investigation. Overall, our results confirm a role for BUB1B and the MCC in maintaining proper chromosome segregation in initial cleavage divisions and show that the genotypic complexity observed in preimplantation embryos from higher-order mammals is likely contributed by deficiency in BUB1B or other maternally-inherited factors.
AUTHOR CONTRIBUTIONS
Conceptualization, K.E.B. and S.L.C; Methodology, K.E.B., B.L.D., and S.L.C.; Software, K.E.B., B.D., and M.Y.Y.; Validation, K.E.B. and S.L.C.; Formal Analysis, K.E.B. and S.L.C.; Investigation, K.E.B. and B.L.D.; Data Curation, S.S.F. and S.L.C.; Writing – Original Draft, K.E.B. and S.L.C.; Writing – Review & Editing, K.E.B., B.L.D., B.D., M.Y.Y., S.S.F., L.C., and S.L.C; Visualization, K.E.B., B.D., and M.Y.Y.; Supervision, S.S.F., L.C., and S.L.C.; Project Administration, S.L.C.; Funding Acquisition, K.E.B., L.C., and S.L.C.
DECLARATION OF INTERESTS
The authors declare no competing interests.
MATERIALS AND METHODS
Reagents and media
All chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA) or Fisher Scientific (Pittsburgh, PA, USA) unless otherwise stated. Tyrode’s albumin lactate pyruvate (TALP) medium with Hepes (TALP-Hepes) was used as washing media and contained 114mM NaCL, 3.2mM KCl, 25mM NaHCO3, 0.34mM NaH2PO4-H2O, 10mM C3H5NaO3, 2 mM CaCl2-H2O, 0.5mM MgCl2-6H2O, 10.9 mM Hepes, 0.25mM sodium pyruvate, 1ul/ml Phenol Red, 3mg/ml FAF-BSA, 100uM Gentamicin Sulfate. For fertilization, TALP-IVF was used and comprised of 114mM NaCL, 3.2mM KCl, 25mM NAHCO3, 0.34mM NaH2PO4-H2O, 10mM C3H5NaO3, 2mM CaCl2-H2O, 0.5mM MgCl2-6H2O, 1ul/ml Phenol Red, 0.25mM sodium pyruvate, 100units/ml penicillin, 100μg/ml streptomycin, 1uM epinephrine, 0.02 mM penicillamine, 10uM hypotaurine, 6mg/ml FAF-BSA, and 10mg/ml heparin.
IVF and embryo culture
Cumulus-oocyte complexes (COC) were retrieved by follicular aspiration of ovaries collected at a commercial abattoir (DeSoto Biosciences, Seymour, TN, USA). Those COCs with at least three layers of compact cumulus cells and homogeneous cytoplasm were placed in groups of 50 in 2ml sterile glass vials containing 1ml of oocyte maturation medium, covered with mineral oil, and equilibrated in 5% CO2. Tubes with COCs were shipped overnight in a portable incubator (Minitube USA Inc., Verona, WI, USA) at 38.5°C. Following 24h of maturation, COCs were washed 3 times in TALP-Hepes followed by a final wash in fertilization media, before placement in a 4-well dish (Nunc™; Fisher Scientific) containing 0.5ml of fertilization media. Semen from either Racer (014HO07296) from Accelerated Genetics (Baraboo, WI, USA) or Colt P-red (7HO10904) from Select Sires (Plain City, OH, USA was obtained for IVF. Sperm were purified from frozen-thawed straws using a gradient [50% (v/v) and 90% (v/v)] of Isolate (Irvine Scientific, Santa Ana, CA), washed two times in fertilization media by centrifugation at 100 RCF, and diluted to a final concentration of 1 million/ml in the fertilization dish. Fertilization was allowed to commence for 17–19 h at 38.5°C in a humidified atmosphere of 5% CO2. Presumed zygotes were denuded from the surrounding cumulus cells by vortexing for 4 min in 200μl of TALP-Hepes with 0.5% (w/v) hyaluronidase (Sigma-Aldrich). Denuded zygotes were washed in fresh TALP-Hepes prior to transfer to custom Eeva™ 12-well polystyrene dishes (Progyny, Inc., New York, NY; formerly Auxogyn, Inc.) containing 100μl drops of BO-IVC culture media (IVF Bioscience; Falmouth, Cornwall, UK) under mineral oil (CooperSurgical, Trumbull, CT) at 38.5°C in a humidified atmosphere of 5% CO2, 5% O2,and 90% N2.
Time-lapse imaging
Zygotes were monitored with an Eeva™ darkfield 2.2.1 or bimodal (darkfield/brightfield) 2.3.5 time-lapse microscope system (Progyny, Inc) housed in a small tri-gas incubator (Panasonic Healthcare, Japan) as previously described (Vera-Rodriguez, Chavez, Rubio, Reijo Pera, & Simon, 2015). Images were taken every 5 min with a 0.6 second exposure time. Each image was time stamped with a frame number and all images compiled into an AVI movie using FIJI software version 2.0.0 (NIH, Bethesda, MD(Schindelin et al., 2012) for assessment of mitotic divisions by two independent reviewers.
Immunostaining and fluorescent imaging
Embryos were washed in PBS with 0.1% BSA and 0.1% Tween-20 (PBST; Calbiochem, San Diego, CA) and fixed with 4% paraformaldehyde (Alfa Aesar, Ward Hill, MA) in PBST for 20 min. at room temperature (RT). Once fixed, the embryos were washed with gentle shaking three times for a total of 15 min. in PBS-T to remove residual fixative. Embryos were permeabilized in 1% Triton-X (Calbiochem) for one hour at RT and washed in PBST as described above. To block non-specific antibody binding, embryos were transferred to a 7% donkey serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA)/PBS-T solution for either 1 hour at RT or overnight at 4°C. An antibody against LMNB1 (catalog #ab16048, Abcam, Cambridge, MA) was diluted 1:1,000, while the CDX2 mouse monoclonal antibody (clone #CDX2-88, Abcam) was diluted 1:100 in PBS-T with 1% donkey serum, and embryos stained for 1 hour at RT or overnight at 4°C. Primary LMNB1 and CDX2 immunosignals were detected using 488-conjugated donkey anti-rabbit or 647-conjugated donkey anti-mouse Alexa Fluor secondary antibodies (Thermo Fisher), respectively, at a 1:250 dilution with 1 % donkey serum in PBS-T at RT for 1 hour in the dark. Embryos were washed in PBS-T and the DNA stained with 1 μg/ml DAPI for 15 min. Embryos were mounted on slides using Prolong Diamond mounting medium (Invitrogen, Carlsbad, CA, USA). Immunofluorescence was initially visualized on a Nikon Eclipse Ti-U fluorescent microscope system and images captured using a Nikon DS-Ri2 color camera and confirmed with a Leica SP5 AOBS spectral confocal system. Z-stacks, 1–5mM apart, were imaged one fluorophore at a time to avoid spectral overlap between channels. Stacked images and individual channels for each color were combined into composite images using FIJI software version 2.0.0.
Modified mRNA construction
Plasmids containing the coding sequence (CDS) for mCitrine-Lifeact (Addgene #54733), which labels filamentous actin (F-actin), mCherry-Histone H2B-C-10 (Addgene #55057), and mCherry-LAMINB1-10 (Plasmid #55069) were a gift from Dr. Michael Davidson’s laboratory and deposited in Addgene (Cambridge, MA). Custom primers containing a 5’-T7 promoter sequence were used to amplify each fluorescent tag-mRNA fusion construct as follows:
T7_mCitrine_F: CTAGCTTAATACGACTCACTATAGGGCGGTCGCCACCATGGTGA
LifeAct_R: TTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGC
T7_mCherry_F: AATTAATACGACTCACTATAGGGAGAGCCACCATGGTGAGCAA
H2B_R: GCGGCCGCTTTACTTGT
LAMINB1_R: TCCGGTGGATCCCTACATAA
PCR amplification was performed with high fidelity Platinum Taq polymerase (Thermo Fisher) under the following conditions: 94°C for 2 min., followed by 35 cycles of 94°C-30 sec., 70°C-30 sec. and, 72°C-3 min. PCR products were purified with the QIAquick PCR Purification kit (Qiagen; Hilden, Germany), then underwent in vitro transcription using the mMessage Machine T7 Transcription Kit (Invitrogen). Following the synthesis of capped mRNA, the MEGAclear transcription clean up kit (Invitrogen) was used to purify and concentrate the final modified mRNA product.
Live-cell imaging
Bovine zygotes were microinjected with mCitrine-Lifeact and either mCherry-H2B or mCherry-LAMINB1 mRNAs at a concentration of 20 ng/ul each in the presence of Alexa Fluor 488 labeled Dextran (Invitrogen) using a CellTram vario, electronic microinjector and Transferman NK 2 Micromanipulators (Eppendorf, Hauppauge, New York, USA). Zygotes that exhibited mCherry fluorescent signal within 4-6 hours following microinjection were selected for overnight imaging. Imaging dishes were prepared by placing 20μl drops of BO-IVC media on glass bottom dishes (Matek Corporation; Ashland, MA) and covering with mineral oil. A Zeiss LSM 880 laser-scanning confocal microscope with 10X objective and Fast Airy capabilities was used to capture fluorescent images of embryos for 18-20 hours, which encompassed the first three mitotic divisions. Z-stack images were taken every 1.5μm for a total of ~60 slices covering a 90μm range at 10 min. intervals. Each fluorophore was acquired independently to prevent crosstalk and maximize scanning speed. Individual images underwent Airyscan processing using Zeiss software and were compiled into videos with individual embryo labels using FIJI. Assessment of cytoplasmic and nuclear structure in embryos during mitotic divisions was completed by two independent reviewers.
Embryo disassembly
Embryos were disassembled under a stereomicroscope equipped with a heated stage and digital camera (Leica Microsystems, Buffalo Grove, IL) for documentation. The zona pellucida (Rocafort, Enciso, Leza, Sarasa, & Aizpurua) was removed from each embryo by a 30 second exposure to warm Acidified Tyrode’s Solution (EMD Millipore, Temecula, CA), followed by 30-60 seconds in 0.1% (w/v) pronase (Sigma, St. Louis, MO, USA). Once ZP free, embryos were washed in TALP-Hepes and gently manipulated using a STRIPPER pipettor (Origio, Målov, Denmark), with or without brief exposure to warm 0.05% trypsin-EDTA (Thermo Fisher Scientific, Waltham, MA) as necessary, until all blastomeres were separated. Following disassembly, each blastomere and cellular fragment if present was washed three times with Ca2+ and Mg2+-free PBS (Fisher Scientific), collected into individual PCR tubes in ~2μL of PBS, and snap frozen on dry ice. Downstream analysis was completed only for embryos where the disassembly process was successful for all blastomeres.
DNA library preparation
Single blastomeres and cellular fragments underwent DNA extraction and WGA using the PicoPLEX single-cell WGA Kit (Rubicon Genomics, Ann Arbor, MI) according to the manufacturer’s instructions with slight modifications. Cells were lysed at 75°C for 10 min. followed by pre-amplification at 95°C for 2 min. and 12 cycles of gradient PCR with PicoPLEX pre-amp enzyme and primer mix. Pre-amplified DNA was further amplified with PicoPLEX amplification enzyme and 48 uniquely-indexed Illumina sequencing adapters provided by the kit or custom adapters with indices designed as previously described (Vitak et al., 2017). Adapter PCR amplification consisted of a 95°C hotstart for 4 min., four cycles of 95°C for 20 sec., 63°C for 25 sec., and 72°C for 40 sec. and seven cycles of 95°C for 20 sec. and 72°C for 55 sec. Libraries were quantified with a Qubit High Sensitivity (HS) DNA assay (Life Technologies, Carlsbad, CA). Amplified DNA from each blastomere (50ng) and cellular fragment (25ng) was pooled and purified with AMPure® XP beads (Beckman Coulter, Indianapolis, IN). Final library quality assessment was performed on a 2200 TapeStation (Agilent, Santa Clara, CA).
Multiplex DNA-seq
Pooled libraries were sequenced on an Illumina NextSeq 500 using a 75-cycle kit with a modified singleend workflow that incorporated 14 dark cycles at the start of the first read prior to the imaged cycles. This step excluded the quasi-random priming sequences that are G-rich and lack a fluorophore for the two-color chemistry utilized by the NextSeq platform during cluster assignment. A total of ~3.5×106 reads/sample were generated. All raw sample reads were demultiplexed and sequencing quality assessed with FastQC as previously described (Krueger, Andrews, & Osborne, 2011). Illumina adapters were removed from raw reads with the sequence grooming tool, Cutadapt (C. Chen, Khaleel, Huang, & Wu, 2014), which trimmed 15 bases on the 5’ end and five bases from the 3’ end, resulting in reads of 120 bp on average. Trimmed reads were aligned to the most recent bovine reference genome, BosTau8 (Zimin et al., 2009), using the BWA-MEM option of the Burrows-Wheeler Alignment Tool (Salavert Torres J & J, 2012) with default alignment parameters. Resulting bam files were filtered to remove alignments with quality scores below 30 (Q<30) as well as alignment duplicates that were likely the result of PCR artifacts with the Samtools suite (Ramirez-Gonzalez, Bonnal, Caccamo, & Maclean, 2012). The average number of filtered and uniquely mapped sequencing reads in individual libraries was between 1.9 and 2.2 million.
CNV analysis
CNV was determined by the integration of two previously developed bioinformatics pipelines, Variable Non-Overlapping Window Circular Binary Segmentation (VNOWC) and the Circular Binary Segmentation/Hidden Markov Model (CBS/HMM) Intersect termed CHI, as previously described (Vitak et al., 2017). All CNV calls from the two pipelines generated profiles of variable sized windows that were intersected on a window-by-window basis. Because other low-input sequencing studies have shown that CNV can be reliably assessed at a 15 Mb resolution with 0.5-1X genome coverage (Lee, Lee, Kim, & Yoon, 2013; Zhou et al., 2018), we classified breaks of 15 Mb in length or larger that did not affect the whole chromosome as segmental. Only whole and segmental CNV calls in agreement between the VNOWC and CHI methods at window sizes containing 4,000 reads were considered. Chaotic aneuploidy was classified by the loss or gain of greater than four whole and/or broken chromosomes as previously described (Delhanty, Harper, Ao, Handyside, & Winston, 1997). Additional classification of each aneuploidy as meiotic or mitotic in origin was accomplished by determining whether a loss or gain of the same chromosome was detected in all blastomeres (meiotic) or if different and/or reciprocal chromosome losses and gains were observed between blastomeres (mitotic).
Morpholino Design
Two non-overlapping MAOs were designed and synthesized by Gene Tools (Philomath, OR) to specifically target bovine BUB1B (Ensembl transcript ID: ENSBTAT00000009521.5). BUB1B MAO #1 (TTTCCTTCTGCATCGCCGCCATC) specifically targeted the ATG start codon of the BUB1B mRNA coding sequence, while BUB1B MAO #2 (CGATCTGAGGCTCTGAAGAAAGGCC) targeted upstream of MAO #1 in the 5’ UTR of bovine BUB1B. A standard control MO (CCTCTTACCTCAGTTACAATTTATA) that targets a splice site mutant of the human hemoglobin beta-chain (HBB) gene (GenBank accession no. AY605051) that is not present in the Bos Taurus genome served as a control. Both Bub1b and standard control MAO where synthesized with a 3’-Carboxyfluorescein tag to aid in visualization during embryo manipulation.
BUB1B knockdown
Zygotes underwent cytoplasmic injection with 3’-carboxyfluorescein-labeled MAO at 20 hours post fertilization as described above. A concentration of 0.3 mM MAO was used based on previous findings that standard control MAO at this concentration was the maximum which allowed normal blastocyst formation rates (Foygel et al., 2008). Following microinjection, embryos were cultured up to the blastocyst stage as described above with or without imaging on the Eeva™ darkfield 2.2.1 microscope system. Upon developmental arrest, embryos were collected for immunostaining, gene expression analysis, or disassembled into single cells (as described above) for downstream analysis.
Validation of BUB1B knockdown
To further validate MAO specificity, bovine embryos were co-injected with BUB1B modified mRNA at a concentration of approximately 3 nl (75 pg) of mRNA per embryo in addition to BUB1B MAO #1. The BUB1B coding sequence (CDS) was amplified from the plasmid, pcDNA5-EGFP-AID-BubR1 (Addgene #47330), followed by mutation of the MAO binding site using the Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions. Briefly, custom primers (forward: 5’-aaaaaagagggaGGTGCTCTGAGTGAAGCC-3’, and reverse: 5’-aactgcagccatATGGGATCCAGCTCTGCT-3’) were designed to mutate the region of the BUB1B CDS targeted by the MAO without affecting the amino acid sequence. Exponential amplification of the template plasmid using high fidelity DNA polymerase was followed by a single step phosphorylation, ligation and DpnI restriction enzyme digestion. NEB 5-apha competent cells were transformed with the mutated plasmid, followed by DNA miniprep isolation using QIAprep spin columns (Qiagen). Mutated plasmids were identified by Sanger sequencing performed by the ONPRC Molecular and Cellular Biology Core using a custom designed primer (TTGGTGAATAGCTGGGACTATG). Following identification and isolation, the mutated plasmid served as a template to synthesize a PCR product containing a T7 promoter using Platinum Taq (Invitrogen). Custom primers (forward: CTAGCTTAATACGACTCACTATAGGGAGCGCCACCATGGCTGCAGTTAAAAAAGAG, reverse: CAATCTGTGAGACTTGATTGCCTAGCTCACTGAAAGAGCAAAGCCCCAG) were designed for use with the T7 mMessage mMachine Ultra Kit as described above.
Quantitative RT-PCR analysis
Gene expression was analyzed in Std control MAO and BUB1B MAO injected embryos using the BioMark Dynamic Array microfluidic system (Fluidigm Corp., So. San Francisco, CA, USA). All embryos were collected within 36 hours post fertilization as described above. Individual embryos were pre-amplified according to the manufacturer’s “two-step single cell gene expression” protocol (Fluidigm Corp.) using SuperScript VILO cDNA synthesis kit (Invitrogen), TaqMan PreAmp Master Mix (Applied Biosystems, Foster City, CA, USA), and gene-specific primers designed to span exons using Primer-BLAST (NCBI). Bovine fibroblasts and no RT template samples were used as controls. Pre-amplified cDNA was loaded into the sample inlets of a 96 × 96 dynamic array (DA; Fluidigm Corp.) and assayed in triplicate. A total of 10 reference genes were assayed for use as relative expression controls. Cycle threshold (Ct) values were normalized to the two most stable housekeeping genes (RPL15 and GUSB) using qBase+ 3.2 software (Biogazelle; Ghent, Belgium). Calculated normalized relative quantity (CNRQ) values were averaged across triplicates + the standard error and graphed using Morpheus (https://software.broadinstitute.org/morpheus/).
Statistical Analysis
Averaged CNRQ values of each gene was compared across embryo groups using the Mann-Whitney U-test. The unadjusted p-value≤0.05 was considered statistically significant.
SUPPLEMENTAL INFORMATION
Supplemental Methods
Madin-Darby Bovine Kidney (MDBK) cell culture
The Madin-Darby Bovine Kidney (MDBK) epithelial cell line (Madin & Darby, 1958) was a kind gift from Dr. Thomas Spencer at the University of Missouri-Columbia. Cells were cultured in Eagle’s Minimum Essential Medium modified to contain Earle’s Balanced Salt Solution, non-essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1500 mg/L sodium bicarbonate, 10% (v/v) FBS and antibiotics (50 U penicillin, 50 μg streptomycin) in 5% CO2 at 37°C.
Assessment of BUB1B MAO knockdown
MDBK epithelial cells were plated on poly-L-lysine treated coverslips, and grown to 70% confluency prior to MAO treatment. Cells were incubated with 6 μl/ml Endo-Porter delivery reagent containing DMSO (Gene Tools) and 2, 4, or 8 μM of either Bub1b MAO #1 or Standard control MAO. After 36 hours, cells were synchronized at metaphase in the presence of 0.03μg of colcemid (Sigma) for 12 hours, and collected for staining at 48 hours post MAO treatment. Cells were washed in PBS, followed by a single 20 min. fixation and permeabilization step using 4% paraformaldehyde (Alfa Aesar, Ward Hill, MA) with 1% Triton-X (Calbiochem) in PBS. Additional PBS washes were completed prior to blocking with 7% donkey serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) in PBS for either 1 hour at RT or overnight at 4°C. A primary antibody against Bub1b (ab28193, Abcam, Cambridge, MA) was diluted 1:1000 in PBS with 1% donkey serum and cells were incubated overnight at 4°C. Bub1b antibody binding was detected using a 568-conjugated donkey, anti-rabbit Alexa Fluor secondary antibody (Thermo Fisher) at a 1:250 dilution with 1 % donkey serum in PBS at RT for 1 hour in the dark. Cells were washed in PBS and the DNA stained with 1 μg/ml DAPI for 15 min. The coverslips with adherent cells were then mounted on slides using Prolong Diamond mounting medium (Invitrogen, Carlsbad, CA, USA). Immunofluorescence was visualized on a Nikon Eclipse Ti-U fluorescent microscope system. Bub1b immunostaining was assessed visually for 100 metaphase cells in each MAO concentration treatment group. To determine statistical differences between treatment concentrations log-binomial modeling using the Generalized Estimating Equations (GEEs) approach was performed, and Tukey adjusted p-values reported to adjust for multiple comparisons. Representative fluorescent images were captured using a Nikon DS-Ri2 color camera. Using FIJI, background fluorescence was subtracted from the red (BUB1B) channel, followed by combination of individual channels for each color into a composite image.
Supplemental Tables
Supplemental Table S1. Sequencing statistics of all embryonic and control samples. A table depicting the number or percentage of reads following de-multiplexing of embryonic (with embryo stage) and fibroblast samples at each step of the post-sequencing process, including adaptor removal, repeat masking, genome mapping, and quality assessment. The sequencing kit used and whether single- or paired-end is also included.
Supplemental Figures
Supplemental Movies
Supplemental Movie S1. Live-cell fluorescent imaging of early cleavage divisions. Bovine zygotes were microinjected with fluorescently labeled modified mRNAs to mCitrine-Actin (green) and mCherry-Histone H2B (red) to distinguish blastomeres and DNA, respectively, and early mitotic divisions visualized by live-cell confocal microscopy. Note the micro-/multi-nuclei in embryos #3, #4, and #11, chromatin bridge in embryo #1, lack of syngamy in embryos #3 and #11, multipolar divisions in embryos #1, #3-6, #11, and #15, and production of empty blastomeres in embryos #5 and #15.
Supplemental Movie S2. BUB1B deficient embryos struggle to divide. A bovine zygote following BUB1B MAO microinjection attempts to divide by forming multiple cleavage furrows, but never successfully completed cytokinesis.
Supplemental Movie S3. Multipolar divisions are observed in BUB1B-injected embryos. Certain bovine zygotes were able to undergo cytokinesis even with BUB1B knockdown, but these divisions were abnormal with multipolar cleavage.
Supplemental Movie S4. BUB1B knockdown causes blastomere asymmetry. Besides abnormal divisions, BUB1B-injected bovine embryos often exhibited blastomere asymmetry following the multipolar cleavage.
ACKNOWLEDGEMENTS
We gratefully acknowledge Dr. Tom Spencer at the University of Missouri-Columbia for the Madin-Darby Bovine Kidney (MDBK) epithelial cells. K.E.B. was supported by the NIH/NICHD Postdoctoral Individual National Research Service Award (5F32HD095550-01). B.L.D. was supported by the P.E.O. Scholar Award, N.L. Tartar Research Fellowship, and T32 Reproductive Biology NIH Training Grant (T32 HD007133). The authors acknowledge the support of the Oregon National Primate Research Center (ONPRC) Integrated Pathology Core for confocal microscopy (supported by S10RR024585) that operates under the auspices of the ONPRC NIH/OD core grant (P51OD011092). This work was supported by OHSU/ONPRC start-up funds (to SLC) and the NIH/NICHD (R01HD086073-A1). The content of this paper is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.