New Results

Comparative study of a 3CLpro inhibitor and remdesivir against both major SARS-CoV-2 clades in human airway models

Maren de Vries, Adil S Mohamed, Rachel A Prescott, Ana M Valero-Jimenez, Ludovic Desvignes, Rebecca O’Connor, Claire Steppan, Annaliesa S. Anderson, Joseph Binder, Meike Dittmann
doi: https://doi.org/10.1101/2020.08.28.272880

Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the etiological agent of Coronavirus Disease 2019 (COVID-19), a pandemic that has claimed over 700,000 human lives. The only SARS-CoV-2 antiviral, for emergency use, is remdesivir, targeting the viral polymerase complex. PF-00835231 is a pre-clinical lead compound with an alternate target, the main SARS-CoV-2 protease 3CLpro (Mpro). Here, we perform a comparative analysis of PF-00835231 and remdesivir in A549+ACE2 cells, using isolates of two major SARS-CoV-2 clades. PF-00835231 is antiviral for both clades, and, in this assay, statistically more potent than remdesivir. A time-of-drug-addition approach delineates the timing of early SARS-CoV-2 life cycle steps and validates PF-00835231’s time of action. Both PF-00835231 and remdesivir potently inhibit SARS-CoV-2 in human polarized airway epithelial cultures. Thus, our study provides in vitro evidence for the potential of PF-00835231 as an effective antiviral for SARS-CoV-2, addresses concerns from non-human in vitro models, and supports further studies with this compound.

Introduction

In December 2019, multiple cases of severe pneumonia with unexplained etiology were reported in Wuhan, China1. The infectious agent was identified as a novel member of the family Coronaviridae1, later named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)2, and the disease it is causing was named Coronavirus Disease 2019 (COVID-19), which has since spread globally. At the time of writing, there are 751,910 deaths among 20,739,537 confirmed cases in 188 countries3. The only directly-acting antiviral drug, with emergency use authorization, to treat SARS-CoV-2 infections is remdesivir, a nucleoside analog that is incorporated into viral RNA by the viral polymerase, resulting in chain termination4. It remains a strategic priority to increase our arsenal of effective antiviral SARS-CoV-2 drugs by developing novel compounds with minimal side effects and alternate viral targets.

One such alternate SARS-CoV-2 target is its main protease, 3CLpro (Mpro), which plays an essential role in the viral life cycle: Upon entry and uncoating of the viral particles, the positive stranded RNA genome is rapidly translated into two polyproteins which are subsequently processed into functional proteins by PL2pro and 3CLpro viral proteases5. 3CLpro is the main protease and is responsible for releasing 11 of the 13 individual proteins, including the polymerase subunits, enabling their proper folding and assembly into the active polymerase complex6. Thus, blocking 3CLpro activity would effectively shut down the life cycle before viral transcription or replication can occur, making it an enticing target for intervention7. In addition, 3CLpro has a unique substrate preference (Leu-Gln ↓ {Ser, Ala, Gly}), a preference not shared by any known human protease, implying the potential for high selectivity and low side effects of 3CLpro-targeting drugs8. Although there have been intense efforts to develop 3CLpro inhibitors specific for SARS-CoV-27–13, no such compounds have yet been approved.

In response to a previous epidemic coronavirus in 2003, PF-00835231 was initially designed as an inhibitor of the SARS-CoV 3CLpro protease10, but, with disease declining, clinical studies were not practical and, consequently, PF-00835231 was never tested clinically. Because 3CLpro of SARS-CoV and SARS-CoV-2 are 96% identical at the amino acid level, including 100% identity within the catalytic pocket8, PF-00835231 may inhibit SARS-CoV-2 as well. Since the discovery of SARS-CoV-2, limited evolution had been observed. The two major lineages of SARS-CoV-2 circulating globally as of time of writing are represented by the Wuhan basal clade and the spike protein D614G clade, also referred to as clades A and B, respectively14. Compared to clade A, clade B isolates carry a mutation in ORF S, encoding the spike protein, which results in amino acid substitution D614G. D614G is frequently accompanied by an additional mutation in ORF 1b, which encodes the RNA-dependent RNA-polymerase complex (RdRp), resulting in substitution P323L in NSP1215. Clade B viruses are more prevalent globally, but whether this is due to a founder effect or due to functional differences remains to be determined16. Here, we aimed to characterize the antiviral potency and cytotoxicity profile of PF-00835231 in comparison to remdesivir, in a human type II alveolar epithelial cell line, using clinical isolates representing the two major clades, SARS-CoV-2 USA-WA1/2020 and USA/NYU-VC-003/2020 (D614G), as well as in polarized human airway epithelial cultures (SARS-CoV-2 USA-WA1/2020). Our in vitro studies identify PF-00835231 as a compound with better potency than other SARS-CoV-2 3CLpro inhibitors described to date and similar or better potency than remdesivir.

Results

Establishing A549+ACE2 cells as a tool to determine SARS-CoV-2 infection and cytopathic effect by high-content microscopy

The human adenocarcinomic alveolar epithelial cell line A549 is a workhorse cell line in the study of respiratory viruses. However, A549 cells are not permissive to SARS-CoV-2 infection, as they do not highly express the SARS-CoV-2 receptor ACE217. To make A549 cells amenable for experiments with SARS-CoV-2, we generated a stable A549 cell line expressing ACE2 exogenously. We confirmed elevated levels of ACE2 mRNA in A549+ACE2 cells by RT-qPCR, and of ACE2 protein by Western blot, flow cytometry and confocal microscopy (Fig. S1a-e). To determine permissiveness, we infected A549 or A549+ACE2 cells with a serial dilution of SARS-CoV-2, in a 96-well format, for 24 or 48 h. Using immunofluorescence staining for SARS-CoV-2 nucleocapsid protein (N) and high-content microscopy, we found A549+ACE2 cells permissive to SARS-CoV-2 infection, whereas parent A549 cells were not (Fig. S1f). Additionally, in A549+ACE2 cells, the percentage of infected cells increased over time, suggesting de novo virus production and spread (Fig. S1g). Finally, we observed that the cytopathic effect (CPE) caused by SARS-CoV-2 on A549+ACE2 cells manifests in syncytia formation, in which the nuclei form a ring-like structure (Fig. S1h), similar to what has been described for other coronaviruses18,19. Altogether, our data establish A549+ACE2 cells as a tool to study SARS-CoV-2 infection, spread, and cytopathic effect.

Supplemental Figure 1.
Supplemental Figure 1. Validation of A549+ACE2 cells as a tool to study SARS-CoV-2.

A549+ACE2 cells were generated by lentiviral transduction delivering an ACE2 overexpression construct and subsequent bulk-selection. a.-e. ACE2 expression in A549 parental or A549+ACE2 cells determined by RT-qPCR (a.), western blot (b., quantified in c.), flow cytometry (d.), or microscopy (e.). f. A549 parental or A549+ACE2 cells were infected with a serial dilution of SARS-CoV-2 USA-WA1/2020. At 24 h, cells were fixed, stained for SARS-CoV-2 N protein, and infected cells were quantified by high-content microscopy. g. A549 parental or A549+ACE2 cells were infected with SARS-CoV-2 USA-WA1/2020. At 24 and 48 h, infected cells were quantified as described in (f.). h. Confocal microscopy of SARS-CoV-2 syncytia formation in A549+ACE2 cells at 48 hpi.

In A549+ACE2 cells, PF-00835231 potently inhibits clinical SARS-CoV-2 isolates from the two major clades

PF-00835231 is a pre-clinical small molecule inhibitor of the SARS-CoV-2 protease 3CLpro (Mpro)10. To determine whether PF-00835231 inhibits SARS-CoV-2 in A549+ACE2 cells, we performed antiviral activity and cytotoxicity assays. We challenged A549+ACE2 cells with the clinical SARS-CoV-2 isolate USA-WA1/2020, which falls into SARS-CoV-2 clade A (GenBank accession no. MT233526). We measured virus antigen (N) expression by high-content microscopy in cells exposed to a range of drug doses at 24 or 48 hours post infection (hpi, Fig. 1a). In parallel, we determined cellular viability by measuring ATP levels in drug-treated, but uninfected cells. Remdesivir inhibited SARS-CoV-2 with an average 50% effective concentration (EC50) of 0.442 μM at 24 h, and 0.238 μM at 48 h, with no significant cytotoxicity (Fig. 1b, d). In comparison, PF-00835231 was statistically more potent than remdesivir, with an EC50 of 0.221 μM at 24 h (p=0.0017 vs remdesivir), and 0.158 μM at 48 h (p=0.036 vs remdesivir), and showed no detectable cytotoxicity (CC50 > 10 μM; Fig. 1c, d).

Figure 1.
Figure 1. Cytotoxicity and antiviral SARS-CoV-2 activity of PF-00835231 and remdesivir in A549+ACE2 cells.

a. Antiviral assay workflow. A549+ACE2 cells were infected with SARS-CoV-2 and treated with serial dilutions of PF-00835231 or remdesivir. At 24 or 48 h, cells were fixed, stained for SARS-CoV-2 N protein, and infected cells quantified by high-content microscopy. Cytotoxicity was measured in similarly treated but uninfected cultures via CellTiter-Glo assay. b. Remdesivir and c. PF-00835231 antiviral activity and cytotoxicity in A549+ACE2 cells infected with SARS-CoV-2 USA-WA1/2020. Representative graph of one experiment in duplicate shown. d. Summary of remdesivir and PF-00835231 antiviral activity against SARS-CoV-2 isolate USA-WA1/2020 from n=3 independent experiments. hpi, hours post infection; CI, confidence interval. e. Remdesivir and f PF-00835231 antiviral activity and cytotoxicity in A549+ACE2 cells infected with SARS-CoV-2 USA/NYU-VC-003/2020. Representative graph of one experiment in duplicate shown. g. Summary of remdesivir and PF-00835231 antiviral activity against SARS-CoV-2 isolate USA/NYU-VC-003/2020 from n=3 independent experiments. h. Representative images of SARS-CoV-2 USA-WA1/2020 syncytia formation at 48 hpi in A549+ACE2 cells under remdesivir or PF-00835231 treatment at the 0.33 μM dose.

To determine the efficacy of PF-00835231 against a SARS-CoV-2 clade B representative, we tested clinical isolate USA/NYU-VC-003/2020, which we had isolated in March 2020 (GenBank accession no. MT703677). USA/NYU-VC-003/2020 carries both of the signature clade B amino acid changes, S D614G and NSP12 P323L. PF-00835231 potently inhibited USA/NYU-VC-003/2020 in A549+ACE2 cells, with an EC50 of 0.184 μM (CC50 >10 μM), whereas remdesivir was inhibitory with an EC50 of 0.283 μM (p=0.028 vs. PF-00835231, CC50 >10 μM; Fig. 1 e-g). Thus, while PF-00835231 had similar antiviral activities against representative isolates of both major SARS-CoV-2 lineages in this assay, remdesivir exhibited statistically significant weaker antiviral activity against the clade A isolate compared to the clade B isolate (p<0.05).

Finally, we analyzed microscopy data for inhibition of the CPE that leads to ring-shaped syncytia formation. Both PF-00835231 and remdesivir decreased the overall number of infected foci, and fully protected A549+ACE2 cells from ring syncytia formation, at 0.33 μM and above (Fig. 1h). Collectively, we show that, in this assay, PF-00835231 inhibits isolates from both major SARS-CoV-2 lineages at similar or better effective concentrations than the only currently available SARS-CoV-2 drug, remdesivir.

Timing of PF-00835231 antiviral action against USA-WA1/2020 in A549+ACE2 cells is consistent with PF-00835231’s role as a 3CLpro inhibitor

PF-00835231 and remdesivir target different SARS-CoV-2 proteins10,20. PF-00835231 targets 3CLpro, blocking polyprotein processing and thus formation of the viral polymerase complex21. Remdesivir acts on the subsequent step, which is the incorporation of nucleotides into nascent viral RNA transcripts and genomes by the viral polymerase complex4,22. To determine whether the action of PF-00835231 is consistent with its role as a 3CLpro inhibitor, and to delineate the timing of early SARS-CoV-2 life cycle stages in A549+ACE2 cells, we performed time-of-drug-addition experiments23. This approach determines how long the addition of a drug can be delayed before the drug loses antiviral activity. Using one-hour-increments (from 1 h prior to 4 h post infection), we varied the time-of-drug-addition for a monoclonal neutralizing antibody (a control targeting the attachment step in the viral life cycle), the drug GC-376 (a control drug for 3CLpro inhibition, licensed for veterinary use in feline coronavirus infections24, and recently shown to inhibit SARS-CoV-212), PF-00835231, and remdesivir. We measured the percentage of SARS-CoV-2-infected cells via high-content microscopy at 12 h post-infection, which corresponds to one replication cycle in A549+ACE2 cells, as determined previously. We synchronized infection using a preincubation step at 4°C, followed by a transition to 37°C at 1 h post-addition of virus, and used the minimum treatment doses for each drug that led to undetectable infection levels – 3 μM for PF-00835231 and the neutralizing antibody, and 10 μM for remdesivir and GC-376. The neutralizing antibody lost its antiviral function first, starting at the first addition point post-infection (1 h), confirming blockage of attachment and entry as the mode of antiviral action (Fig. 2). Interestingly, all three treatments, GC-376, PF-00835231, and remdesivir lost antiviral action at the same time of addition, starting at 2 hpi, and with more pronounced loss of activity at 3 and 4 hpi (Fig. 2). This suggests that both polyprotein processing and the start of viral transcription / translation follow each other very closely in time. These time-of-drug-addition experiments confirm the timing of PF-00835231 antiviral action as consistent with its role as a 3CLpro inhibitor, and delineate the timing of the SARS-CoV-2 life cycle events in the tissue culture model of A549+ACE2 cells. Furthermore, these experiments demonstrate that polymerase and protease inhibitors such as PF-00835231 can effectively block SARS-CoV-2 replication in cells when administered within a few hours after infection has already taken place.

Figure 2.
Figure 2. Time-of-drug-addition assay for PF-00835231 and remdesivir in A549+ACE2 cells.

a. At the indicated time points, A549+ACE2 cells were infected with SARS-CoV-2 USA-WA1/2020, treated with 3 μM monoclonal neutralizing antibody (control targeting attachment and entry), 10 μM of the drug GC-376 (control drug for 3CLpro inhibition), 3 μM PF-00835231, or 10 μM remdesivir. At 12 h (one round of replication) cells were fixed, stained for SARS-CoV-2 N protein, and infected cells quantified by high-content microscopy. Data from n=3 independent experiments. b. Schematic of SARS-CoV-2 life cycle steps in A549+ACE2 cells.

PF-00835231 is well-tolerated in polarized human airway epithelial cultures (HAEC)

The human respiratory tract is a major entry portal for viruses, including SARS-CoV-2, and the first battle between host and virus occurs in cells of the respiratory epithelium. This specialized tissue contains four major cell types (basal, secretory club, goblet, and ciliated) which are organized in a characteristic polarized architecture. Human airway epithelial cultures (HAEC) recapitulate much of the complexity and architecture of this tissue (Fig. 3 a,b), and thus make it arguably one of the most physiologically relevant human tools with which we study respiratory pathogens in vitro. HAEC are permissive to SARS-CoV-2 infections and were utilized to obtain the very first SARS-CoV-2 isolate in December 20191.

Figure 3.
Figure 3. Comparative anti-SARS-CoV-2 activity of PF-00835231 and remdesivir in polarized human airway epithelial cultures (HAEC).

a. Schematic representation of a trans-well containing a polarized HAEC in air-liquid interface. To test for antiviral activity, drugs were added to the basolateral chamber, cultures infected with SARS-CoV-2 USA-WA1/2020 from the apical side, and apical washes collected in 12 h increments to determine viral titers by plaque assay. Orange, basal cells; blue, goblet cells; green, ciliated cells; red, secretory club cells; grey, mucus. b. Representative cross-sections of HAEC prior to infection. H&E (upper panel) or PAS-Alcian blue staining (lower panel). c, d. SARS-CoV-2 USA-WA1/2020 infectious titers from HAEC treated with incremental doses of remdesivir (c) or PF-00835231 (d). e. Representative top views of HAEC at 72 hpi. Blue, DAPI (nuclei); cyan, ZO-1 (tight junctions); red, SARS-CoV-2 N protein (infected).

To establish the use of PF-00835231 in HAEC, we first determined its cytotoxicity profile and compared it to that of remdesivir. We added PF-00835231 or remdesivir to HAEC basolaterally (Fig. 3a), and determined tissue morphology by histology, expression of apoptosis markers by RT-qPCR, and disruption of the epithelial layer by measuring trans-epithelial resistance (TEER; Fig. S2a-d). Neither drug caused measurable adverse effects on the morphology of the cultures (Fig. S2a,b) or triggered expression of apoptosis markers (Fig. S2c). However, remdesivir, more so than PF-00835231, negatively impacted trans-epithelial resistance over time (albeit not statistically significantly), suggesting that PF-00835231 may be better-tolerated by HAEC than remdesivir (Fig. S2d).

Supplementary Figure 2.
Supplementary Figure 2. Cytotoxicity of PF-00835231 and remdesivir in polarized human airway epithelial cultures (HAEC).

a.,b. Representative cross-sections of uninfected HAEC, 72 h post treatment with 10 μM PF-00835231 or 10 μM remdesivir. H&E (a.) or PAS-Alcian blue staining (b.). c. BAX/BCL-2 ratio in drug-treated HAEC as a measure of cell death determined by RT-qPCR. DMSO as carrier control, staurosporine as positive control inducing cell death. d. Trans-epithelial resistance (TEER) in drug-treated, uninfected HAEC over time as a measure of epithelial integrity. Data from n=3 independent experiments. e. CellTiter-glo assay on undifferentiated, basal-like cell monolayers. Data from n=3 independent experiments.

To complement these data from differentiated HAEC with a more standardized assay, we treated a monolayer of basal-like undifferentiated precursor cells with a dose range of PF-00835231 or remdesivir for 48 hours, and quantified ATP as a measure of cell viability, similar to previous experiments with A549+ACE2 cells. We did not detect a decrease in ATP upon PF-00835231 treatment, even at the highest amount of drug (10 μM) tested. In contrast, 10 μM of remdesivir caused a dose-dependent reduction in ATP levels, albeit not statistically significantly (Fig. S2e). These experiments demonstrate that PF-00835231 has a favorable cytotoxicity profile in our model of the polarized human airway epithelium.

In HAEC, PF-00835231 exhibits potent anti-SARS-CoV-2 USA-WA1/2020 activity

To determine PF-00835231’s anti-SARS-CoV-2 activity in HAEC, we added either 0.025, 0.5 or 10 μM PF-00835231 or remdesivir, or DMSO carrier control, to the basolateral chamber of HAEC (Fig. 3a). We then challenged HAEC apically with SARS-CoV-2 USA-WA1/2020 (Fig. 3a), and determined viral infectious titers from apical washes collected at 12-hour increments. Both PF-00835231 and remdesivir potently inhibited SARS-CoV-2 titers in a dose-dependent manner, with the 10 μM dose resulting in viral titers below the limit of detection (Fig. 3c,d).

To visualize SARS-CoV-2 infection in HAEC during drug treatment, we fixed infected HAEC at the 72 h endpoint and stained them for SARS-CoV-2-N-expressing cells (Fig. 3e). In carrier control cultures, we observed robust infection. Upon treatment with 10 μM PF-00835231 or remdesivir, we found in both cases the number of infected cells significantly reduced. Taken together, both remdesivir and PF-00835231 potently inhibit SARS-CoV-2 infection in our model of the polarized human airway epithelium.

Inhibiting the multi-drug transporter MDR1 does not increase efficacy of PF-00835231 in vitro

Previously, a hurdle in accurately determining PF-00835231’s in vitro efficacy was the action of the multi-drug transporter MDR1 (also known as P-Glycoprotein, encoded by MDR1 / ABCB1) in Vero E6 cells10. Vero E6 cells express high levels of the transporter. MDR1 efficiently exports PF-00835231, thereby reducing intracellular PF-00835231 levels, resulting in an under-representation of the true antiviral activity of the compound in these cells. To determine a potential role of MDR1 transporter in our in vitro human airway models, we measured PF-00835231 anti-SARS-CoV-2 activity in the presence or absence of MDR1-inhibitor CP-100356. We observed no statistically significant changes in antiviral activity when blocking MDR1 activity (Fig. S3), suggesting that this transporter does not play a role in our human model systems. Our findings highlight the importance of using appropriate in vitro model systems in order to characterize antiviral drugs.

Supplementary Figure 3.
Supplementary Figure 3. Cytotoxicity and antiviral SARS-CoV-2 activity of PF-00835231 in the presence or absence of MDR1 drug exporter activity.

a. PF-00835231 antiviral activity and cytotoxicity in A549+ACE2 cells infected with SARS-CoV-2 USA-WA1/2020, in the presence or absence of 1 μM MDR1 inhibitor CP-100356. Assay performed as in Figure 1. Data from n=3 independent experiments. b. Apical SARS-CoV-2 USA-WA1/2020 infectious titers from HAEC treated basolaterally with 0, 0.025, or 0.5 μM PF-00835231 in the presence or absence of 1 μM MDR1 inhibitor CP-100356. Data from n=3 independent experiments.

Discussion

The current public health emergency caused by COVID-19 has illustrated our dire need for vaccines and therapeutics to combat SARS-CoV-2. In theory, each step of the SARS-CoV-2 life cycle is a potential target for antiviral intervention by small molecule inhibitors9. However, at the time of writing, the only antiviral drug authorized and recommended for emergency use in COVID-19 is remdesivir. Here, we report the potent antiviral activity of the protease inhibitor PF-00835231 against SARS-CoV-2 in human lung epithelial cells and a model of polarized human airway epithelial cultures (HAEC). We show that PF-00835231 has significantly better potency than remdesivir in our A549+ACE2 cell assay, whereas in human airway epithelial cultures, we find both remdesivir and PF-00835231 similarly potent. How the potencies of either drug may relate to differences in treatment effectiveness in vivo is yet to be determined. We also demonstrate that PF-00835231’s antiviral activity holds for viral isolates from different lineages of SARS-CoV-2.

The SARS-CoV-2 polymerase complex is the target of the majority of small molecule inhibitors in multiple stages of development for COVID-19, including remdesivir20, favipiravir25, and ß-d-N4-hydroxycytidine26. In contrast to those compounds, PF-00835231 blocks the SARS-CoV-2 3CLpro protease10. The existence of a drug with an alternate target has important implications regarding the potential selection and management of drug resistant viral variants. First, treatment of both chronic and acute viral diseases have taught us that blocking multiple targets in combination therapy significantly decreases the likelihood for selection of viral resistance mutants27–29. Second, upon failure of monotherapy, it is preferable to switch to an antiviral with a different target to avoid cross-resistance27–29. For both scenarios, combination therapy or switching, PF-00835231 might provide an option. In coronaviruses, the genetic barrier to remdesivir or ß-d-N4-hydroxycytidine is high, as mutations conferring resistance significantly reduce viral fitness, and cross-resistance between remdesivir or ß-d-N4-hydroxycytidine has not been documented22,26. However, the development of a diverse toolbox of antiviral drugs with different targets to combat SARS-CoV-2 is important to further understand and control this disease.

The optimal window of opportunity for starting a successful antiviral drug regimen during acute viral infections, such as influenza, is the first few days post symptom onset, while viral replication is actively ongoing30. For most COVID-19 patients, this window is likely limited to the first week of symptoms31. Such early treatment with remdesivir is impeded by its need for intravenous (IV) administration, requiring a healthcare facility setting, though it still demonstrated benefit for 68% of patients with more advanced infection in randomized clinical studies32. PF-00835231 is also a potential IV treatment. However, the time of active SARS-CoV-2 replication might be prolonged in the most severe patients, as suggested by the aforementioned clinical data32. Thus, the usefulness of a SARS-CoV-2 antiviral regimen even at later times of infection further supports the investigation of therapeutic efficacy of coronavirus specific 3CLpro protease inhibitors for the treatment of COVID-19.

Early in the pandemic, protease inhibitors approved for other viruses were tested off-label in COVID-19 treatment, albeit with limited success33. This failure highlighted the need for novel compounds specific to the protease of coronaviruses. A number of compounds have since been identified and characterized in in vitro assays, including the cancer drug carmofur (1-hexylcarbamoyl-5-fluorouracil)13, an alpha-ketoamide inhibitor named 13b8, and others, including GC-37634. In cell-based assays, these compounds act at an EC50 in the micromolar range, whereas PF-00835231 inhibits SARS-CoV-2 with EC50 in the nanomolar range. In fact, our direct comparison of GC-376 and PF-00835231 in A549+ACE2 cells (Fig. 2) showed that 10 μM of GC-367 are required to suppress SARS-CoV-2 infection completely, whereas the same is achieved with only 3 μM of PF-00835231. These results illustrate the potency of PF-00835231 compared to other 3CLpro inhibitors.

Spillovers of zoonotic coronaviruses with high pathogenic potential into the human population are not isolated events, as repeatedly illustrated by the emergence of SARS-CoV in 2002, Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012, and now SARS-CoV-2 in 201935. To prepare for future pandemics, the development of pan-coronavirus compounds is of strategic importance. This involves choosing viral targets that are highly conserved within the coronavirus family, such as the 3CLpro protease8. Indeed, in vitro inhibition assays with PF-00835231 and purified 3CLpro of SARS-CoV, SARS-CoV-2 or CoV 229E showed that PF-00835231 inhibits all three at low nanomolar levels10. Work to advance this compound to needed pre-clinical in vivo efficacy studies is currently underway. Together, our promising results in two physiologically relevant human in vitro models for SARS-CoV-2 show efficient antiviral activity, address concerns arising from non-human models like Vero E6 cells, and therefore warrant additional investigations of PF-00835231 as a potential treatment for COVID-19.

Methods

Study design

The primary goal of this study was to compare the in vitro efficacy and cytotoxicity of PF-00835231 and remdesivir in two human model systems for SARS-CoV-2 infection, A549+ACE2 cells and polarized human airway epithelial cultures. Compound characterization at NYU was done in a blinded manner. If not stated otherwise, all assays were performed in n=3 biological replicates. First, we performed in-depth characterization of A549+ACE2 cells for the study of SARS-CoV-2, using RT-qPCR, western blotting, flow cytometry, microscopy, and high-content imaging. Second, we evaluated the in vitro efficacy and cytotoxicity of PF-00835231 and remdesivir in A549+ACE2 cells. We performed antiviral assays with SARS-CoV-2 from the two major clades at two different time points. Third, we performed time-of-drug-addition assays in A549+ACE2 cells to delineate the time of antiviral action for PF-00835231 and remdesivir within the SARS-CoV-2 life cycle. Fourth, we assessed the in vitro efficacy and cytotoxicity of PF-00835231 and remdesivir in the physiologically relevant model of polarized human airway epithelial cultures. Finally, we determined the role of efflux transporter MDR1 on the antiviral efficacy of PF-00835231. Our studies were intended to generate the data required to justify further pre-clinical investigations as a potential treatment for COVID-19.

Cells and viruses

A549 cells were purchased from ATCC (cat no. CCL-185). To generate A549+ACE2 cells, we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously36. A549 cells were transduced with pLV-EF1α-hACE2-IRES-Puro lentivirus and bulk-selected for transduced cells using 2.5 μg/ml puromycin. A549+ACE2 cells were maintained in DMEM (Gibco, cat no. 11965-092) containing 10% FBS (Atlanta Biologicals, cat no. S11150) (complete media), and puromycin (2.5 μg/ml final) was added to the media at every other passage. A549+ACE2 cells were used for SARS-CoV-2 infection studies. Vero E6 cells, purchased from ATCC (cat no. CLR-1586), were maintained in DMEM (Gibco, cat no. 11965-092) containing 10% FBS (Atlanta Biologicals, cat no. S11150). Vero E6 cells were used for growing SARS-CoV-2 stocks and for SARS-CoV-2 plaque assays. Basal-like human airway progenitor cells (Bci-NS1.137) were obtained from Dr. Ronald G. Crystal and maintained in BEGM Medium (Lonza, cat no. CC-3171 and CC-4175) for cytotoxicity assays, while Pneumacult Ex Plus medium (StemCell, cat no. 05040) was used to culture cells for generation of human airway epithelial cultures. Bci-NS1.1 were used for cytotoxicity assays and for generation of polarized human airway epithelial cultures (HAEC).

All SARS-CoV-2 stock preparations and following infection assay were performed in the CDC/USDA-approved BSL-3 facility in compliance with NYU Grossman School of Medicine guidelines for biosafety level 3. SARS-CoV-2 isolate USA-WA1/2020, deposited by the Center for Disease Control and Prevention, was obtained through BEI Resources, NIAID, NIH (cat no. NR-52281, GenBank accession no. MT233526). The USA-WA1/2020 stock, obtained at passage 4, was passaged once in Vero E6 cells to generate a passage 5 working stock (1.7E + 06 PFU/mL) for our studies on A549+ACE2. For studies on human airway epithelial cultures, passage 5 USA-WA1/2020 was amplified once more in Vero E6 cells and concentrated using an Amicon Ultra-15 centrifugal filter unit with a cut off of 100 kDa, resulting in a passage 6 working stock with 1.08E + 07 PFU/ml. SARS-CoV-2 USA/NYU-VC-003/2020 was isolated from a patient in March 2020, and deposited at BEI Resources, NIAID, NIH (not yet available, GenBank accession no. MT703677). The USA/NYU-VC-003/2020 passage 0 stock was passaged twice in Vero E6 to generate a passage 2 working stock (1.1E + 07 PFU/mL) for our studies on A549+ACE2.

Characterization of A549+ACE2 cells

Confluent 6-well A549 and A549+ACE2 cells were washed with PBS and cells were detached with CellStripper dissociation reagent (Corning cat no. 25056CI). Cells were pelleted, washed with PBS and either i) lysed in LDS sample buffer (ThermoFisher cat no. NP0007) supplemented with reducing agent (ThermoFisher cat no. NP0004) and Western blots were performed to analyze levels of ACE2 (1:1,000, GeneTex cat no. GTX101395) with beta-actin (1:10,000, ThermoFisher cat no. MA5-15739) as the loading control and imaged using Li-Cor Odyssey CLx, or ii) incubated in FACS buffer (PBS, 5% FBS, 0.1% sodium azide, 1mM EDTA) for 30 min on ice followed by 1 hour incubation with AlexaFluor 647 conjugated anti-ACE2 (1:40, R&D Biosystems cat no.FABAF9332R) or isotype control (1:40, R&D Biosystems cat no. IC003R) and subsequent analysis on CytoFLEX flow cytometer. Surface ACE2 was visualized by staining A549 and A549+ACE2 cells at 4°C with anti-ACE2 (1:500, R&D Biosystems AF933) and AlexaFluor 647 secondary antibody and DAPI. Images were collected on the Keyence BX-Z microscope. Confluent 6-well A549 and A549+ACE2 cells were collected in RLT lysis buffer supplemented with beta-mercaptoethanol and total RNA was extracted using Qiagen RNeasy mini kit. cDNA synthesis was performed using SuperScript™ III system (ThermoFisher cat no. 18080051) followed by RT-qPCR with PowerUp SYBR Master Mix (ThermoFisher cat no. A25742) on a QuantStudio 3 Real Time PCR System using gene-specific primers pairs for ACE2 and RPS11 as the reference gene. (ACE2fwd:GGGATCAGAGATCGGAAGAAGAAA, ACE2rev:AGGAGGTCTGAACATCATCAGTG, RPS11fwd:GCCGAGACTATCTGCACTAC, RPS11rev:ATGTCCAGCCTCAGAACTTC). A549 and A549+ACE2 cells were seeded in black wall 96-well plates and at confluency, cells were infected with SARS-CoV-2. At 24 and 48hpi, samples were fixed, stained with SARS-CoV-2 N mouse monoclonal SARS-CoV anti-N antibody 1C7, which cross reacts with SARS-CoV-2 N (1:1000, kind gift of Thomas Moran), AlexaFluor 647 secondary antibody and DAPI and imaged using CellInsight CX7 LZR high-content screening platform. Images were analyzed and quantified with HCS Navigator software. Syncytia were imaged using the Keyence BX-Z microscope at 60X magnification on A549+ACE2 cultured on chambered slides followed by 48 hpi SARS-CoV-2 infection and staining with SARS-CoV-2 N, AlexaFluor 647 secondary antibody and DAPI.

Human airway epithelial cultures (HAEC)

To generate HAEC, Bci-NS1.1 were plated (7.5 E + 04 cells/well) on rat-tail collagen type 1-coated permeable transwell membrane supports (6.5 mm; Corning, cat no. 3470), and immersed apically and basolaterally in Pneumacult Ex Plus medium (StemCell, cat no. 05040). Upon reaching confluency, medium was removed from the apical side (“airlift”), and medium in the basolateral chamber changed to Pneumacult ALI maintenance medium (StemCell, cat no. 05001). Medium in the basolateral chamber was exchanged with fresh Pneumacult ALI maintenance medium every 2-3 days for 12-15 days to form differentiated, polarized cultures that resemble in vivo pseudostratified mucociliary epithelium. Cultures were used within 4-6 weeks of differentiation. HAEC were used for cytotoxicity assays and SARS-CoV-2 infections.

Compound acquisition, dilution, and preparation

PF-00835231, remdesivir and CP-100356 were solubilized in 100% DMSO and provided by Pfizer, Inc. Compound stocks diluted in DMSO to 30 mM were stored at −20°C. Compounds were diluted to 10 μM working concentration in complete media or Pneumacult ALI maintenance medium. All subsequent compound dilutions were performed in according media containing DMSO equivalent to 10 μM compound. As controls for the time-of-drug-addition assay, GC-376 was purchased from BPS Biosciences (cat no. 78013) and used at 10 μM working concentration, and SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 μM working concentration. As a positive control for cytotoxicity assays, staurosporine was purchased from Sigma (cat no. S6942), and used at 1 μM working concentration.

In vitro efficacy and cytotoxicity in A549+ACE2 cells

A549+ACE2 cells were seeded into black wall 96-well plates at 70% confluency. The next day, media was removed and replaced with complete media containing compound/carrier two hours prior to infection. Cells were then infected at multiplicity of infection (MOI) 0.425, based on Vero E6 titer, at 37°C. 1 hour post virus addition, virus was removed, and media containing compound/carrier was added. At 24 and 48 hours post infection, cells were fixed by submerging in 10% formalin solution for 30-45 min. After fixation cells were washed once with H2O to remove excess formalin. Plates were dried and PBS was added per well before exiting the BSL-3 facility. Fixed cells were permeabilized and stained with mouse monoclonal SARS-CoV anti-N antibody 1C7, which cross-reacts with SARS-CoV-2 N (kind gift of Thomas Moran), goat anti-mouse AlexaFluor 647, and DAPI. Plates were scanned on the CellInsight CX7 LZR high-content screening platform. A total of 9 images were collected at 4x magnification to span the entire well. Images were analyzed using HCS Navigator to obtain total number of cells/well (DAPI stained cells) and percentage of SARS-CoV-2 infected cells (AlexaFluor 647 positive cells). To enable accurate quantification, exposure times for each channel were adjusted to 25% of saturation and cells at the edge of each image were excluded in the analysis. SARS-CoV-2-infected cells were gated to include cells with an average fluorescence intensity greater than 3 standard deviations that of mock infected and carrier treated cells.

For determination of cytotoxicity, A549+ACE2 cells were seeded into opaque white wall 96-well plates. The following day, media was removed, replaced with media containing compound/carrier or staurosporine, and incubated for 24 or 48 hours, respectively. At these timepoints, ATP levels were determined by CellTiter-Glo 2.0 (Promega, cat no. G9242) using a BioTek Synergy HTX multi-mode reader.

Time-of-drug-addition experiments

A549+ACE2 cells seeded into black wall 96-well plates and at confluency were treated and infected as followed. At 2.5 hours prior infection cells were pre-treated with complete media containing 1x compound/carrier. In addition, SARS-CoV-2 (2x) was incubated with SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody (nAB, 2x). Pre-treated cells and virus/neutralizing antibody mix (1x) were incubated for 1 hour at 37°C. To synchronize infection, pre-incubated plates and SARS-CoV-2/nAB mix were chilled at 4°C for 30 min and SARS-CoV-2 was diluted on ice in media containing compound/carrier/nAB. Following pre-chilling, virus/compound/carrier/nAB mixtures were added to the cells to allow binding of virus for 1 hour at 4°C. Plates were moved to 37°C to induce virus entry and therefore infection. 1 hour post virus addition, virus was removed, and complete media was added to all wells. Complete media containing 2x compound/carrier/nAB was added to pre-treated cells, cells treated at infection and cells treated at 1 hour post infection. At 2, 3 and 4 hours post infection complete media containing compound/carrier/nAb was added to according wells. At 12 hours post infection, samples were fixed, stained with SARS-CoV-2 N, AlexaFluor 647 secondary antibody and DAPI and imaged using CellInsight CX7 LZR high-content screening platform. Images were analyzed and quantified with HCS Navigator software as described for in vitro efficacy in A549+ACE2.

In vitro efficacy and cytotoxicity in human airway epithelial cultures (HAEC)

48 hours prior to infection, 2-6 week old HAEC were washed apically twice for 30 min each with pre-warmed PBS containing calcium and magnesium, to remove mucus on the apical surface. 2 hours prior to infection HAEC were pretreated by exchanging the ALI maintenance medium in the basal chamber with fresh medium containing compounds or carrier. Remdesivir and PF-00835231 were used at 10, 0.5 and 0.025 μM, and CP-100356 at 1 μM. 1 hour prior to infection, cultures were washed apically twice for 30 min each with pre-warmed PBS containing calcium and magnesium. Each culture was infected with 1.35E + 05 PFU (Vero E6) per culture for two hours at 37°C. A sample of the inoculum was kept and stored at −80°C for back-titration by plaque assay on Vero E6 cells. For assessment of compound toxicity, additional cultures were washed and pre-treated as the infected cultures. Instead of being infected, these cultures were incubated with PBS containing calcium and magnesium only as Mock treatment. HAEC were incubated with the viral dilution or Mock treatment for 2 hours at 37°C. The inoculum was removed and the cultures were washed three times with pre-warmed PBS containing calcium and magnesium. For each washing step, buffer was added to the apical surface and cultures were incubated at 37°C for 30 min before the buffer was removed. The third wash was collected and stored at −80°C for titration by plaque assay on Vero E6 cells. Infected cultures were incubated for a total of 72 hours at 37°C. Infectious progeny virus was collected every 12 hours by adding 60 μl of pre-warmed PBS containing calcium and magnesium, incubation at 37°C for 30 min and collection of the apical wash to store at −80°C until titration. Additionally, trans-epithelial electrical resistance (TEER) was measured in uninfected but treated HAEC to quantify the tissue integrity in response to treatment with compounds or carrier. At the end point, cultures were fixed by submerging in 10% formalin solution for 24 hours and washed three times with PBS containing calcium and magnesium before further processing for histology. Alternatively, at the end point, transwell membranes were excised and submerged in RLT buffer to extract RNA using the RNAeasy kit (Qiagen, cat no. 74104). cDNA synthesis was performed using SuperScript™ III system (ThermoFisher cat no. 18080051) followed by RT-qPCR with TaqMan universal PCR master mix (ThermoFisher cat no. 4305719) and TaqMan gene expression assay probes (ThermoFisher GAPDH cat no. 4333764F, BAX cat no. Hs00180269_m1, BCL2 cat no. Hs00608023_m1) using a QuantStudio 3 Real Time PCR System.

For additional determination of cytotoxicity in undifferentiated HAEC precursor cells, Bci-NS1.1 cells were seeded into opaque white wall 96-well plates. The following day, media was removed, replaced with media containing compound/carrier or staurosporine, and incubated for 24 or 48 hours, respectively. At these timepoints, ATP levels were determined by CellTiter-Glo 2.0 (Promega, cat no. G9242) using a BioTek Synergy HTX multi-mode reader.

Histology on human airway epithelial cultures

For histology, transwell inserts were prepared using a Leica Peloris II automated tissue processor, paraffin embedded, and sectioned at 3 μm. The resulting slides were stained using a modified Periodic acid–Schiff (PAS)-Alcian Blue protocol (Histotechnology,Freida L. Carson). Sections were imaged on the Leica SCN whole slide scanner and files uploaded to the Slidepath Digital Image Hub database for viewing.

Immunofluorescence on human airway epithelial cultures

For Immunofluorescence of HAEC at top view, fixed and washed cultures were permeabilized with 50 mM NH4Cl (in PBS), 0.1% w/v saponin and 2% BSA (permeabilization/blocking (PB) buffer). Cultures were stained with i) rabbit polyclonal anti-SARS Nucleocapsid Protein antibody, which cross reacts with SARS-CoV-2 N (1:1000, Rockland cat no. 200-401-A50) and goat-anti-rabbit AlexaFluor 488, to visualize infection ii) mouse monoclonal anti-ZO-1-1A12 (1:500, Thermo Fisher cat no. 33-9100) and goat anti-mouse AlexaFluor 647 to visualize tight junctions, and DAPI. All dilutions were prepared in PB buffer. Images were collected on the Keyence BX-Z microscope.

Statistical analysis

Antiviral activities of PF-00835231 and remdesivir in A549+ACE2 cells were determined by the following method. The percent inhibition at each concentration was calculated by ActivityBase (IDBS) based on the values for the no virus control wells and virus containing control wells on each assay plate. The concentration required for a 50% / 90% response (EC50 / EC90) was determined from these data using a 4 parameter logistic model. Curves were fit to a Hill slope of 3 when >3 and the top dose achieved ≥50% effect. Geometric means and 95% confidence intervals were generated in ActivityBase. Statistical comparisons were performed by log transforming the EC50 and EC90 values and fitting separate linear models to each endpoint, assuming equal log-scale variances across conditions and interactions of compound with strain and compound with time. The model can be described mathematically as Embedded Image where Treatmenti represents the effect of the combination of compound, strain, and time and ɛi,j represents a normal error term for treatment i and assay replicate j. Contrasts between the factor combinations of interest were computed to assess significance and back-transformed into ratios of geometric means. Statistical significance was defined by a p value <0.05. Other statistical data analyses were performed in GraphPad Prism 7. Statistical significance for each endpoint was determined with specific statistical tests as indicated in each legend. For each test, a P-value < 0.05 was considered statistically significant.

Author contributions

MdV, ASM, JB, ASA, and MD conceived and designed the study. MdV, ASM, AMVJ, RAP performed the experiments and analyzed the data. CS, RO, JB analyzed antiviral data. MdV, ASM, AMVJ, RAP, LD, JB, MD interpreted the data. MdV, ASM, LD, and MD wrote the paper.

Competing interests

M. D. received a contract from Pfizer Inc. to support the studies reported herein. These authors are employees of Pfizer Inc. and hold stock in Pfizer Inc: Joseph Binder, Annaliesa Anderson, Claire Steppan, Rebecca O’Connor.

Materials and correspondence

All correspondence and material requests except those for antiviral compounds should be addressed to Meike.Dittmann{at}nyulangone.org. Compound requests should be addressed to Annaliesa.Anderson{at}pfizer.com.

Acknowledgements

We would like to thank Thomas M Moran, Icahn School of Medicine at Mount Sinai, and Luis Martínez-Sobrido, Texas Biomedical Institute, for the kind gift of mouse monoclonal SARS-CoV N antibody 1C7. Histopathology of human airway cultures was performed by Mark Alu, Branka Brukner Dabovic and Cynthia Loomis from the NYUMC Experimental Pathology Research Laboratory, which is supported by the Cancer Center Support Grant P30CA016087 at NYU Langone’s Laura and Isaac Perlmutter Cancer Center. Statistical analysis of antiviral activities in A549+ACE2 cells was performed by Woodrow Burchett. Research was further supported by grants from NIH/NIAID (R01AI143639 and R21AI139374 to MD, T32AI17647 to RAP), by Jan Vilcek/David Goldfarb Fellowship Endowment Funds to AMVJ, by Pfizer Inc. to MD, and by NYU Grossman School of Medicine Startup funds to MD.

References

  1. 1.↵
    Zhu, N. et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Engl. J. Med. 382, 727–733 (2020).
    OpenUrlCrossRefPubMed
  2. 2.↵
    Gorbalenya, A. E. et al. The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 5, 536–544 (2020).
    OpenUrl
  3. 3.↵
    Dong, E., Du, H. & Gardner, L. An interactive web-based dashboard to track COVID-19 in real time. The Lancet Infectious Diseases (2020). doi:10.1016/S1473-3099(20)30120-1
    OpenUrlCrossRefPubMed
  4. 4.↵
    Pruijssers, A. J. et al. Remdesivir Inhibits SARS-CoV-2 in Human Lung Cells and Chimeric SARS-CoV Expressing the SARS-CoV-2 RNA Polymerase in Mice. Cell Rep. 32, 107940 (2020).
    OpenUrlCrossRefPubMed
  5. 5.↵
    Ziebuhr, J. & Siddell, S. G. Processing of the Human Coronavirus 229E Replicase Polyproteins by the Virus-Encoded 3C-Like Proteinase: Identification of Proteolytic Products and Cleavage Sites Common to pp1a and pp1ab. J. Virol. 73, 177–185 (1999).
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    Gadlage, M. J. & Denison, M. R. Exchange of the Coronavirus Replicase Polyprotein Cleavage Sites Alters Protease Specificity and Processing. J. Virol. 84, 6894–6898 (2010).
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    Dai, W. et al. Structure-based design of antiviral drug candidates targeting the SARS-CoV-2 main protease. Science (80-.). 1335, eabb4489 (2020).
    OpenUrl
  8. 8.↵
    Zhang, L. et al. Crystal structure of SARS-CoV-2 main protease provides a basis for design of improved a-ketoamide inhibitors. Science (80-.). 368, 409–412 (2020).
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    David E. Gordon1, Gwendolyn M. Jang, Mehdi Bouhaddou, Jiewei Xu1, K. O. et al. A SARS-CoV-2-Human Protein-Protein Interaction Map Reveals Drug Targets and Potential Drug-Repurposing. biorxiv (2020).
  10. 10.↵
    Hoffman, R. L. et al. The Discovery of Ketone-Based Covalent Inhibitors of Coronavirus 3CL Proteases for the Potential Therapeutic Treatment of COVID-19. 1–106 (2020). doi:doi.org/10.26434/chemrxiv.12631496.v1
    OpenUrlCrossRef
  11. 11.
    Yoshino, R., Yasuo, N. & Sekijima, M. Identification of key interactions between SARS-CoV-2 Main Protease and inhibitor drug candidates. ChemRxiv doi:10.26434/chemrxiv.12009636.v1 1–12 (2020). doi:10.26434/chemrxiv.12009636.v1
    OpenUrlCrossRef
  12. 12.↵
    Ma, C. et al. Boceprevir, GC-376, and calpain inhibitors II, XII inhibit SARS-CoV-2 viral replication by targeting the viral main protease. Cell Res. (2020). doi:10.1038/s41422-020-0356-z
    OpenUrlCrossRef
  13. 13.↵
    Jin, Z. et al. Structural basis for the inhibition of SARS-CoV-2 main protease by antineoplastic drug carmofur. Nat. Struct. Mol. Biol. 27, 529–532 (2020).
    OpenUrl
  14. 14.↵
    Rambaut, A. et al. A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology. Nat. Microbiol. (2020). doi:10.1038/s41564-020-0770-5
    OpenUrlCrossRefPubMed
  15. 15.↵
    Gonzalez-Reiche, A. S. et al. Introductions and early spread of SARS-CoV-2 in the New York City area. Science (80-.). 21, eabc1917 (2020).
    OpenUrl
  16. 16.↵
    Grubaugh, N. D., Hanage, W. P. & Rasmussen, A. L. Making Sense of Mutation: What D614G Means for the COVID-19 Pandemic Remains Unclear. Cell (2020). doi:10.1016/j.cell.2020.06.040
    OpenUrlCrossRef
  17. 17.↵
    Daniel Blanco-Melo, Benjamin E. Nilsson-Payant, Wen-Chun Liu, Skyler Uhl, D., Hoagland, Rasmus Møller, Tristan X. Jordan, Kohei Oishi, Maryline Panis, D., Sachs, Taia T. Wang, Robert E. Schwartz, Jean K. Lim, Randy A. Albrecht1, B. & TenOever, R. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell (2020). doi:10.1016/j.cell.2020.04.026
    OpenUrlCrossRefPubMed
  18. 18.↵
    Lavi, E., Wang, Q., Weiss, S. R. & Gonatas, N. K. Syncytia formation induced by coronavirus infection is associated with fragmentation and rearrangement of the Golgi apparatus. Virology 221, 325–334 (1996).
    OpenUrlCrossRefPubMedWeb of Science
  19. 19.↵
    Corver, J., Broer, R., Van Kasteren, P. & Spaan, W. Mutagenesis of the transmembrane domain of the SARS coronavirus spike glycoprotein: Refinement of the requirements for SARS coronavirus cell entry. Virol. J. 6, 1–13 (2009).
    OpenUrlCrossRefPubMed
  20. 20.↵
    Gordon, C. J. et al. Remdesivir is a direct-acting antiviral that inhibits RNA-dependent RNA polymerase from severe acute respiratory syndrome coronavirus 2 with high potency. J. Biol. Chem. 295, 6785–6797 (2020).
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    Krichel, B., Falke, S., Hilgenfeld, R. & Redecke, L. Processing of the SARS-CoV pp1a / ab nsp7 – 10 region. 0, 1009–1019 (2020).
    OpenUrl
  22. 22.↵
    Agostini, M. L. et al. Coronavirus Susceptibility to the Antiviral Remdesivir (GS-5734) Is Mediated by the Viral Polymerase and the Proofreading Exoribonuclease. MBio 9, (2018).
  23. 23.↵
    Daelemans, D., Pauwels, R., De Clercq, E. & Pannecouque, C. A time-of-drug addition approach to target identification of antiviral compounds. Nat. Protoc. 6, 925–933 (2011).
    OpenUrlCrossRefPubMed
  24. 24.↵
    Kim, Y. et al. Broad-Spectrum Antivirals against 3C or 3C-Like Proteases of Picornaviruses, Noroviruses, and Coronaviruses. J. Virol. 86, 11754–11762 (2012).
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    Shannon, A. et al. Favipiravir strikes the SARS-CoV-2 at its Achilles heel, the RNA polymerase. bioRxiv (2020). doi:10.1101/2020.05.15.098731
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    Sheahan, T. P. et al. An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice. Sci. Transl. Med. 12, (2020).
  27. 27.↵
    Günthard, H. F. et al. Human Immunodeficiency Virus Drug Resistance: 2018 Recommendations of the International Antiviral Society-USA Panel. Clin. Infect. Dis. (2019). doi:10.1093/cid/ciy463
    OpenUrlCrossRef
  28. 28.
    Su, T. H. & Liu, C. J. Combination therapy for chronic hepatitis B: Current updates and perspectives. Gut and Liver (2017). doi:10.5009/gnl16215
    OpenUrlCrossRef
  29. 29.↵
    Whitley, R. J. & Monto, A. S. Resistance of Influenza Virus to Antiviral Medications. Clin. Infect. Dis. (2019). doi:10.1093/cid/ciz911
    OpenUrlCrossRef
  30. 30.↵
    Kumar, A. Early versus late oseltamivir treatment in severely ill patients with 2009 pandemic influenza A (H1N1): Speed is life. J. Antimicrob. Chemother. (2011). doi:10.1093/jac/dkr090
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    Wölfel, R. et al. Virological assessment of hospitalized patients with COVID-2019. Nature (2020). doi:10.1038/s41586-020-2196-x
    OpenUrlCrossRefPubMed
  32. 32.↵
    Jonathan Grein, M. D. et al. Compassionate Use of Remdesivir for Patients with Severe Covid-19. N. Engl. J. Med. (2020).
  33. 33.↵
    Cao, B. et al. A trial of lopinavir-ritonavir in adults hospitalized with severe covid-19. N. Engl. J. Med. (2020). doi:10.1056/NEJMoa2001282
    OpenUrlCrossRefPubMed
  34. 34.↵
    Ma, C. et al. Boceprevir, GC-376, and calpain inhibitors II, XII inhibit SARS-CoV-2 viral replication by targeting the viral main protease. Cell Res. (2020). doi:10.1038/s41422-020-0356-z
    OpenUrlCrossRef
  35. 35.↵
    Gralinski, L. E. & Menachery, V. D. Return of the coronavirus: 2019-nCoV. Viruses 12, 1–8 (2020).
    OpenUrlCrossRef
  36. 36.↵
    Seifert, L. L. et al. The ETS transcription factor ELF1 regulates a broadly antiviral program distinct from the type i interferon response. PLoS Pathog. (2019). doi:10.1371/journal.ppat.1007634
    OpenUrlCrossRef
  37. 37.↵
    Walters, M. S. et al. Generation of a human airway epithelium derived basal cell line with multipotent differentiation capacity. Respir Res 14, 135 (2013).
    OpenUrlCrossRefPubMed
Back to top
Posted August 28, 2020.
Download PDF
Email
Comparative study of a 3CLpro inhibitor and remdesivir against both major SARS-CoV-2 clades in human airway models
Maren de Vries, Adil S Mohamed, Rachel A Prescott, Ana M Valero-Jimenez, Ludovic Desvignes, Rebecca O’Connor, Claire Steppan, Annaliesa S. Anderson, Joseph Binder, Meike Dittmann
bioRxiv 2020.08.28.272880; doi: https://doi.org/10.1101/2020.08.28.272880
Digg logo Reddit logo Twitter logo Facebook logo Google logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area