Abstract
The coronavirus disease 2019 (COVID-19) pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has rapidly become a global public health threat due to the lack of effective drugs or vaccines against SARS-CoV-2. The efficacy of several repurposed drugs has been evaluated in clinical trials. Among these drugs, a relatively new antiandrogen agent, enzalutamide, was proposed because it reduces the expression of transmembrane serine protease 2 (TMPRSS2), a key component mediating SARS-CoV-2-driven entry into host cells, in prostate cancer cells. However, definitive evidence for the therapeutic efficacy of enzalutamide in COVID-19 is lacking. Here, we evaluated the antiviral efficacy of enzalutamide in prostate cancer cells, lung cancer cells, human lung organoids and SARS-CoV-2-infected Ad-ACE2-transduced Tmprss2 knockout (Tmprss2-KO) and wild-type (WT) mice. TMPRSS2 knockout significantly inhibited SARS-CoV-2 infection in vivo. Enzalutamide effectively inhibited SARS-CoV-2 infection in human prostate cancer cells (LNCaP) but not in human lung cancer cells or patient-derived lung organoids. Although Tmprss2 knockout effectively blocked SARS-CoV-2 infection in ACE2-transduced mice, enzalutamide showed no antiviral activity due to the AR independence of TMPRSS2 expression in mouse and human lung epithelial cells. Moreover, we observed distinct AR binding patterns between prostate cells and lung cells and a lack of direct binding of AR to TMPRSS2 in human lung cells. Thus, our findings do not support the postulated protective role of enzalutamide in treating COVID-19.
Introduction
Coronavirus disease 2019 (COVID-19), which is caused by the novel coronavirus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has emerged as a new worldwide pandemic. COVID-19 has led to nearly 28,000,000 confirmed global cases and 910,000 deaths as of September 11, 2020 1. SARS-CoV-2 is a serious worldwide threat due to its high infectivity2,3. The current pandemic and the potential for future pandemics have exposed the urgent need for the rapid development of efficient countermeasures. Therefore, repurposing clinically proven drugs has been postulated as a promising strategy for developing treatments for SARS-CoV-2 infection.
Transmembrane serine protease 2 (TMPRSS2) has been reported with essential role in mediating viruses including SARS-CoV-2-driven entry into host cells4–7. The spike glycoprotein (S) of SARS-CoV-2 and its receptor, angiotensin-converting enzyme 2 (ACE2) have been demonstrated with the function in mediating the attachment of SARS-CoV-2 to host cells8,9. Then, the priming of SARS-CoV-2 S protein is processed by TMPRSS25. Moreover, besides SARS-CoV-2, both SARS-CoV, another type of coronaviruses and H1N1, an influenza virus, also employ TMPRSS2 for viral entry6,10,11. Since the conserved role of TMPRSS2 in provoking coronaviruses and influenza viruses-driven entry into host cells has been highlighted, modulating TMPRSS2 expression or its protease activity is postulated to be a potential method for antiviral intervention12–15
Enzalutamide is a potent inhibitor of the androgen receptor (AR) and has been approved for the treatment of castration-resistant prostate cancer (CRPC) patients16,17. Mechanistically, enzalutamide binds to AR, reduces the efficiency of its translocation from the cytoplasm to the nucleus, and impairs the AR-mediated signaling pathway17. Given the modulation of TMPRSS2 expression by AR in prostate cells18, several clinical trials have been initiated to assess the therapeutic efficacy of enzalutamide in COVID-19 patients (ClinicalTrials.gov identifiers; NCT04475601 and NCT04456049). However, it remains elusive whether AR indeed controls TMPRSS2 expression in different organs, especially lung. Thus, an investigation of enzalutamide in the treatment of SARS-CoV-2 infection is urgently needed. Herein, we evaluated the antiviral efficacy of enzalutamide in human lung organoids (LuOs) and human ACE2 recombinant adenovirus (Ad-ACE2)-transduced Tmprss2 knockout (Tmprss2-KO) and wild-type (WT) mice. With these powerful approaches, we comprehensively defined the antiviral effect of enzalutamide. Moreover, we showed the potential mechanism of enzalutamide with its different antiviral activity in the human prostate and lung.
Results
TMPRSS2 plays a crucial role in promoting SARS-CoV-2 infection
To elucidate whether TMPRSS2 is crucial for SARS-CoV-2-driven entry into host cells, we employed previously established Tmprss2-KO mouse model (Extended Data Fig. 1a). In line with previous findings10,19, under physiological conditions, Tmprss2 knockout exhibited little effect on multiple organs including lungs (Fig. 1a). In order to identify Tmprss2 positive cells in multiple organs, we next crossed Tmprss2-KO mice with Rosa26-EYFP mice expressing a CAG-driven YFP Cre-reporter (T2Y), when exposed to tamoxifen, this mouse model can be utilized to trace cells of the Tmprss2-positive lineage via detection of YFP expression (Extended Data Fig. 1b). With this model, we further investigated the existence of Tmprss2-positive cells in multiple organs. Notably, in addition to prostate, other essential organs, including lung, kidney and liver, which are permissive for SARS-CoV-2 infection in human, were characterized with Tmprss2-postive epithelial cells (Fig. 1b and Extended Data Fig. 1c). The broad distribution of Tmprss2-positive cells might indicate the universal function of Tmprss2 in mediating SARS-CoV-2-driven entry in multiple organs.
To confirm the role of Tmprss2 in SARS-CoV-2 infection, we employed a previously reported Ad-ACE2 transduction method to overcome the natural resistance of mice to SARS-CoV-2 infection20. Briefly, we first transduced 10- to 18-week-old WT mice and Tmprss2-KO mice with 2.5×109 PFU of FLAG-tagged Ad-ACE2 adenovirus. Consistent with previous findings, predominant ACE2 expression was observed in the alveolar epithelium, as indicated by FLAG staining (Extended Data Fig. 1d). Five days post Ad-ACE2 transduction, mice were challenged with 1×105 PFU of SARS-CoV-2. Notably, compared to WT mice challenged with SARS-CoV-2, Tmprss2-KO mice exhibited extremely less severe lung pathology, as indicated by the lack of robust inflammatory responses (Fig. 1d, e). We also quantified the percentage of lung cells with SARS-CoV-2 infection. Based on the quantification of more than one million cells in 5 mice per group via S protein staining, the percentage of S protein-positive lung cells was significantly lower in Tmprss2-KO mice than in WT mice (Fig. 1f, g). Collectively, these findings suggested that the lack of TMPRSS2 had marked effects on SARS-CoV-2 infection, highlighting the important role of TMPRSS2 in mediating SARS-CoV-2-driven entry into host cells.
Enzalutamide effectively inhibits SARS-CoV-2-driven entry into prostate cells
Since TMPRSS2 expression is modulated by AR in prostate cells, which promoted us to identify whether AR inhibition can prevent SARS-CoV-2 infection through reducing TMPRSS2 expression. We first surveyed TMPRSS2 and AR expression across a panel of well-characterized prostate cancer cell lines and two previously established organoid lines MSKPCa1 and MSKPCa321. Notably, both qRT-PCR and western blotting demonstrated high AR and TMPRSS2 expression in LNCaP and VCaP cells (Extended Data Fig. 2a, b). Consistent with previous findings22,23, a marked reduction in TMPRSS2 protein and mRNA expression was induced by AR inhibition using enzalutamide treatment and was validated in both LNCaP and VCaP cells (Extended Data Fig. 2c, d, e and f).
For sensitive and convenient detection of SARS-CoV-2-driven entry into host cells, we employed a pseudovirus system by incorporating SARS-CoV-2 S protein and luciferase into pseudoviral particles through cotransfection of pNL4-3.luc.RE and PCDNA3.1 encoding the SARS-CoV-2 S protein. Thus, this system allowed the sensitive detection of SARS-CoV-2 pseudotype entry by measuring luciferase activity. The constructed pseudovirus was named SARS-CoV-2-S. We first asked whether LNCaP and VCaP were susceptible to SARS-CoV-2-S-driven entry. Since undetectable ACE2 expression in LNCaP and VCaP cells was identified, we observed lack of robust SARS-CoV-2-S-driven entry into these cells, as expected (Extended Data Fig. 3b, d). To enable the permissiveness of LNCaP and VCaP cells, we next transduced Ad-ACE2 into these cells (Extended Data Fig. 3a, c).
Given that enzalutamide treatment can reduce TMPRSS2 expression in prostate cells17,23, we next sought to ascertain whether enzalutamide can prevent SARS-CoV-2 from infecting prostate cells through downregulation of TMPRSS2 expression. We first investigated the therapeutic efficacy of enzalutamide in blocking SARS-CoV-2-S-driven entry into LNCaP cells. In line with previous results generated from other TMPRSS2 positive cells5,24, camostat mesylate, a clinically proven inhibitor for serine protease including TMPRSS2, significantly attenuated the infection of SARS-CoV-2-S, as indicated by the reduction in luciferase activity, suggesting that TMPRSS2 is also an important factor for facilitating SARS-CoV-2-driven entry into LNCaP cells (Fig. 2a). Remarkably, enzalutamide also significantly blocked SARS-CoV-2-S infection, which even exhibited much higher treatment efficacy than camostat mesylate (Fig. 2a). In addition, immunofluorescence staining for luciferase also demonstrated the consistent results that enzalutamide significantly reduced the percentage of cells with SARS-CoV-2-S-driven entry (Fig. 2b, c). Since pseudovirus system was limited to investigations on SARS-CoV-2-S-driven entry into host cells, we next assessed whether enzalutamide interferes with authentic SARS-CoV-2-driven entry and the subsequent steps of the viral replication cycle. Consistent with findings from the pseudovirus system, enzalutamide efficiently exerted antiviral activity against SARS-CoV-2 in LNCaP cells, as demonstrated by the significantly reduced viral titers of SARS-CoV-2 in both culture medium supernatant and cellular contents (Fig. 2d, e). Moreover, we evaluated whether enzalutamide can prevent SARS-CoV-2-S-driven entry into VCaP cells. Recapitulating results in LNCaP cells, enzalutamide treatment also significantly blocked SARS-CoV-2-S-driven entry into VCaP cells (Extended Data Fig. 3e). Taken together, utilizing both the pseudovirus system and authentic SARS-CoV-2, we demonstrated that enzalutamide efficiently prevented SARS-CoV-2-driven entry into prostate cells by inhibiting AR to reduce TMPRSS2 expression.
Enzalutamide fails to prevent SARS-CoV-2 from infecting human lung organoids and cells
Since enzalutamide efficiently inhibited infection of human prostate cells with SARS-CoV-2, we next sought to evaluate its therapeutic efficacy in human lung cells. To this end, we surveyed single-cell RNA-sequencing data from healthy human lungs25, consistent with previous results26, TMPRSS2-positive cells were broadly distributed in various cell types, potentially indicating an important role of TMPRSS2 in mediating SARS-CoV-2 infection in multiple lung cell types (Extended Data Fig. 4a, b and d). In particular, high expression levels of both TMPRSS2 and ACE2 were identified in SFTPC-positive alveolar type II (ATII) cells, potentially indicating TMPRSS2-dependent entry of SARS-CoV-2 into these cells (Extended Data Fig. 4a, c, e and f). We further assessed AR expression and found that similar to TMPRSS2, AR was also highly expressed with a wide distribution (Extended Data Fig. 4a, g). These results might indicate the presence of AR-positive cells and TMPRSS2-positive cells in human lungs. To confirm the presence of TMPRSS2-positive cells and AR-positive cells, we next performed immunofluorescence staining to detect TMPRSS2 and AR expression in normal human lungs. In accordance with the single-cell RNA-seq data, both AR-positive cells and TMPRSS2-positive cells were widely distributed in the bronchiolar and alveolar regions (Extended Data Fig. 4h, i).
Since human lungs were characterized with both AR and TMPRSS2 expression, we next sought to determine whether AR can modulate TMPRSS2 expression in the lungs. We firstly established human lung organoids (LuOs) derived from adjacent normal lung tissues with similar culture protocol as previously reported27 (Fig. 3a). To verify whether LuOs are an appropriate model in which to evaluate the therapeutic efficacy of enzalutamide, we performed immunofluorescence staining for AR and TMPRSS2 in LuOs. By staining of serial sections, we identified both AR expression and TMPRSS2 expression in LuOs, which also contained AR/TMPRSS2 double-positive cells (Fig. 3b). We next employed LuOs to explore whether enzalutamide could manipulate TMPRSS2 expression. Distinct from above findings in prostate LNCaP cells, enzalutamide treatment did not significantly reduce TMPRSS2 expression, validated in three LuOs lines (Fig. 3c, d and e). To ensure the permissiveness of LuOs for SARS-CoV-2-S-driven entry, we also transduced these organoids with Ad-ACE2 (Fig. 3f). Twenty-four hours post Ad-ACE2 transduction, LuOs were pretreated with 10 μM camostat mesylate or 10 μM enzalutamide for 48 hours before virus infection (Fig. 3g). Camostat mesylate but not enzalutamide inhibited infection of LuOs with SARS-CoV-2-S, confirming that enzalutamide could not protect lung cells against SARS-CoV-2 infection (Fig. 3h, i and j). Moreover, we also evaluated whether enzalutamide blocked authentic SARS-CoV-2-driven entry and viral replication. Consistent with the results obtained with the SARS-CoV-2 pseudovirus, enzalutamide did not exhibit antiviral activity against authentic SARS-CoV-2 (Fig. 3k).
Given that lack of treatment efficacy of enzalutamide in blocking SARS-CoV-2-driven entry was characterized in human lung organoids, we also employed multiple lung cancer cell lines to validate whether these results could be recapitulated. Among these cell lines, three of eight, namely, H1437, H2126 and A549 cells were AR-positive, confirming the wide distribution of AR expression across multiple lung cell types (Extended Data Fig. 5a). Since only H1437 and H2126 cells exhibited detectable TMPRSS2 expression, we treated these two cell lines with the AR ligand dihydrotestosterone (DHT) and the AR inhibitor enzalutamide to assess changes in TMPRSS2 expression (Extended Data Fig. 5b). Notably, unlike in LNCaP cells, in which DHT stimulated and enzalutamide reduced TMPRSS2 expression, no obvious changes in TMPRSS2 expression were observed in H2126 and H1437 cells treated with these two agents (Extended Data Fig. 5c, d, e and f). In addition, we also performed immunofluorescence for TMPRSS2 to validate these results. Distinct from results in LNCaP cells that DHT stimulated TMPRSS2 expression and enzalutamide reduced TMPRSS2 expression respectively, no obvious changes in TMPRSS2 expression were observed in H2126 and H1437 cells with these two treatments (Extended Data Fig. 5g). To enable these lung cells to be susceptible to SARS-CoV-2-S-driven entry, we also transduced Ad-ACE2 into these cells (Extended Data Fig. 5h). We next compared camostat mesylate and enzalutamide-induced inhibition of SARS-CoV-2-S entry into H2126 cells (AR-positive and TMPRSS2-positive), H23 cells (AR-negative and TMPRSS2-negative) and Calu-3 cells (AR-negative and TMPRSS2-positive). Both H2126 and Calu-3 cells were dependent on TMPRSS2 for SARS-CoV-2-S infection, as indicated by the inhibitory effects of camostat mesylate. Consistent with the finding that enzalutamide could not reduce TMPRSS2 expression in H2126 cells, enzalutamide did not inhibit infection of either H2126 cells or AR-negative Calu-3 cells by SARS-CoV-2-S (Extended Data Fig. 5i, j). As a control, we also used AR-negative and TMPRSS2-negative H23 cells, in which neither camostat mesylate nor enzalutamide exhibited therapeutic efficacy in preventing viral entry (Extended Data Fig. 5k). Collectively, utilizing both human lung organoids and lung cancer cells, we demonstrated that TMPRSS2 expression was independent of AR expression in human lung epithelial cells, thus AR inhibition using enzalutamide did not reduce TMPRSS2 expression to block SARS-CoV-2-driven entry into human lung epithelial cells.
Mouse model for COVID-19 demonstrates the lack of therapeutic efficacy of enzalutamide in interfering with SARS-CoV-2-driven entry
In order to identify whether AR was not capable of modulating TMPRSS2 expression utilizing in vivo mouse models, we next treated WT mice and castrated mice with enzalutamide for 7 days. Notably, in castrated mice, enzalutamide treatment impaired the function of AR by blocking its nuclear translocation in prostate cells (Extended Data Fig. 6a). As observed in human prostate cells, reduced Tmprss2 mRNA levels were identified in prostate epithelial cells in enzalutamide-treated mice and castrated WT mice (Fig. 4a). No significant changes in Tmprss2 mRNA levels in response to enzalutamide treatment and castration were observed in the lungs of male mice (Fig. 4b). In addition, consistent results were obtained in the lungs of female mice treated with enzalutamide (Fig. 4c). Finally, consistent with findings in human prostates and lungs, in vivo experimentation in mice also demonstrated the organ-specific role of AR in regulating TMPRSS2 expression.
To demonstrate enzalutamide treatment efficacy in preventing SARS-CoV-2 driven entry into lung cells utilizing in vivo models, we also employed Ad-ACE2 transduced mouse models (Extended Data Fig. 6b). Briefly, we firstly treated 10-12-week-old wild type C57BL/6 mice with or without enzalutamide treatment by daily intragastric gavage. We next transduced control and enzalutamide-treated mice with 2.5×109 PFU of Ad-ACE2 adenovirus. Five days post Ad-ACE2 transduction, mice were challenged with 1×105 PFU of SARS-CoV-2. Mouse lungs were collected for pathological analysis and viral load determination 3 days post SARS-CoV-2 challenge. Notably, histopathological analysis revealed similar levels of inflammatory infiltration in control and enzalutamide-treated mice (Fig. 4d, e). In addition, the viral titers did not differ significantly between control and enzalutamide-treated mouse lungs (Fig. 4f). Moreover, the percentage of lung cells infected with SARS-CoV-2 in control mice did not differ significantly from that in enzalutamide-treated mice (Fig. 4g, h). Taken together, utilizing in vivo mouse models, we obtained consistent results indicating that enzalutamide did not inhibit SARS-CoV-2-driven entry into lung cells and subsequent viral replication.
Identification of a distinct AR binding pattern between prostate cells and lung cells
Given the discrepancy between prostate cells and lung cells in the changes in TMPRSS2 expression in response to enzalutamide treatment, we next sought to elucidate whether such discrepancy was attributed to distinct AR binding pattern. We first performed chromatin immunoprecipitation with sequencing (ChIP-seq) on AR in prostate cells LNCaP and assay for transposase-accessible chromatin using sequencing (ATAC-seq) in both prostate cells LNCaP and lung cells A549, H1437 and H2126. Based on AR ChIP-seq in LNCaP cells, we compared chromatin accessibility among these four cell lines of AR binding sites. Notably, distinct from extensive chromatin accessibility of these sites in LNCaP cells as expected, the other three lung cell lines were characterized with much less open chromatin (Fig. 5a). In principle, transcription factors modulate transcriptional regulation through binding to regulatory elements of target genes, which tightly associates with chromatin accessibility28. The chromatin accessibility disparity might indicate distinct AR binding pattern between prostate cells and lung cells. To further characterize AR binding pattern in prostate cells and lung cells respectively, we categorized these AR binding sites into two main groups: “both-open” sites were characterized with open chromatin in both prostate cells LNCaP and the other three lung cell lines (Fig. 5b, Supplementary Table 1), and “prostate-open” sites were identified by the specific existence of open chromatin in prostate LNCaP cells (Fig. 5c, Supplementary Table 2). In order to validate whether chromatin accessibility in AR binding sites remarkably coordinated AR binding activity, we also performed AR ChIP-seq in the other three lung cell lines. In accordance with open chromatin of a both-open site in PARP14, we also observed AR binding in this region in both lung cells and prostate cells (Fig. 5d). Different from this both-open site, upon close inspections on TMPRSS2, we only observed AR binding sites in upstream region of TMPRSS2 in LNCaP cells instead of the other three lung cell lines (Fig. 5e). Compatible with AR binding in TMPRSS2, two extra AR binding sites were verified with extensive chromatin accessibility in LNCaP cell but not in other lung cells (Fig. 5e). In addition, unlike in prostate cells, ChIP-qPCR demonstrated the lack of robust AR binding in the upstream region of TMPRSS2 locus in lung cells (Fig. 5f). These results indicated lack of AR binding in TMPRSS2 in lung cells, which coincided with the above findings that AR inhibition utilizing enzalutamide did not reduce TMPRSS2 expression to inhibit SARS-CoV-2-driven entry. Furthermore, Gene Set Enrichment Analysis (GSEA) revealed that androgen response genes were significantly enriched in AR-positive prostate cells (LNCaP, VCaP and 22RV1) when compared with AR-positive lung cells (A549, H1437 and H2126) (Fig. 5g). In accordance with GSEA results, a significantly higher sum of z-scores for androgen responsive genes was observed in AR-positive prostate cells than that in AR-positive lung cells (Fig. 5h).
Since we demonstrated lack of AR binding in TMPRSS2 in lung cells, utilizing freshly dissociated lung cells from 43 normal human lung tissue samples, we next sought to validate whether the correlation between the expression of AR and TMPRSS2 coordinated these findings. Concordant with above findings, no significant correlation relationship was identified between AR and TMPRSS2 expression (Fig. 5i, j, k). We also analyzed normal lung tissues and normal prostate tissues from TCGA datasets. A significant and positive correlation between the mRNA expression of AR and a both-open gene PARP14 was observed in both lung and prostate tissues, in keeping with AR binding in this gene (Extended Data Fig. 7a, d). The mRNA levels of both TMPRSS2 and FKBP5, which were characterized with specific AR binding in prostate cells, significantly correlated with AR mRNA levels in prostate tissues but not in lung tissues (Extended Data Fig. 7b, c, e, f). These findings established a distinct AR binding pattern between the prostate and the lungs, providing clinical evidence that TMPRSS2 expression is not responsive to AR inhibition in lungs. Collectively, these results revealed a distinct AR binding pattern between human prostate and lung cells. This finding not only offers a mechanistic explanation for the inability of AR to modulate TMPRSS2 expression but also suggests that enzalutamide is not a promising drug for blocking SARS-CoV-2-driven entry into host cells.
Discussion
TMPRSS2 has been demonstrated with a pivotal role in promoting SARS-CoV-2-driven entry into host cells through facilitating S protein priming via its serine protease activity4–7, 29. These previous findings suggest that the modulation of TMPRSS2 expression may provide a novel strategy to treat SARS-CoV-2 infection by blocking viral entry into host cells. It is well known that TMPRSS2 expression is regulated by AR in prostate epithelial cells. Enzalutamide, an AR inhibitor approved for use in CRPC patients, can reduce TMPRSS2 expression in prostate cancer cells. Thus, enzalutamide has been proposed as a promising repurposed drug to inhibit SARS-CoV-2 infection and subsequent replication, which even provoked the initiation of two clinical trials. Here, we further confirmed the indispensable role of TMPRSS2 in SARS-CoV-2 infection using human ACE2-transduced Tmprss2-KO mice (Fig. 1). Consistently, enzalutamide significantly decreased TMPRSS2 expression and inhibited SARS-CoV-2 infection in human prostate cancer cells (Fig. 2). However, we did not observe any antiviral activity of enzalutamide against SARS-CoV-2 in the lungs of Ad-ACE2-transduced WT mice or human lung organoids. These results suggested that enzalutamide may have antiviral activity in the prostate in male COVID-19 patients, but also indicated that enzalutamide may have no clinical efficacy in treating COVID-19 patients with lung infection.
Enzalutamide reduced TMPRSS2 expression by inhibiting AR activity in LNCaP and VCaP cells, and significantly inhibited infection of these prostate cells by both authentic SARS-CoV-2 or SARS-CoV-2-S pseudovirus. These results indicated that enzalutamide would display effective antiviral activity against SARS-CoV-2 if it could modulate a reduction in TMPRSS2 expression in host cells. Moreover, these findings also highlighted the important role of TMPRSS2 in mediating SARS-CoV-2-driven entry. Given the high efficacy of enzalutamide in inhibiting SARS-CoV-2 in prostate cells, we further assessed its efficacy in human lung cancer cells. Surprisingly, in AR/TMPRSS2 double-positive H2126 and H1437 lung cancer cells, neither AR inhibition using enzalutamide nor AR stimulation using DHT resulted in a significant change in TMPRSS2 expression, implying that AR cannot regulate TMPRSS2 expression in human lung cancer cells. These findings seemed inconsistent with those of previous studies indicating that androgen exposure enhanced TMPRSS2 expression in another lung cell line, A54930. This discrepancy might be due to 100nM testosterone, since such higher concentration of testosterone to treat cells might result in misleading findings, which could not reflect the physiological function of AR. In addition, notably, TMPRSS2 mRNA was hard to detect under physiological conditions in A549 cells, which exhibit high AR expression (Extended Data Fig. 5b). Given that enzalutamide did not downregulate TMPRSS2 expression in these cells, we further demonstrated that enzalutamide failed to inhibit the entry driven by SARS-CoV-2-S, as expected. Since lung cancer cell lines harbor many genetic alterations, which might lead to disparities in findings with respect to normal lung cells, we employed early-passage benign human LuOs for further study. Compatible with findings in lung cancer cells, enzalutamide had no treatment efficacy in preventing authentic SARS-CoV-2 and SARS-CoV-2-S pseudovirus in benign human lung organoids. Moreover, we also employed Ad-ACE2-transduced mouse models and demonstrated that enzalutamide lacked antiviral activity against SARS-CoV-2 in vivo.
A previous study demonstrated that androgen-deprivation therapy (ADT) significantly reduced the risk of SARS-CoV-2 infection in prostate cancer patients31. However, a subsequent study demonstrated that the lethality rate of SARS-CoV-2 in metastatic prostate cancer patients with ADT was not lower than that in other cohorts of infected Italian male patients32, which did not suggest that ADT exhibited antiviral activity against SARS-CoV-2 in patients with metastatic prostate cancer. The inconsistent findings from these two studies might be attributed to the different populations selected for investigation. However, to date, no concordant and definitive clinical evidence indicates that ADT, including enzalutamide treatment, significantly inhibits SARS-CoV-2 infection.
Utilizing multiple models, including human lung cancer cells, human lung organoids and Ad-ACE2-transduced WT mice, we demonstrated that enzalutamide failed to inhibit SARS-CoV-2 infection, which was attributed to the lack of AR-driven modulation of TMPRSS2 expression in lung epithelial cells. To elucidate the mechanisms underlying the disparity of AR-driven regulation between prostates and lungs, we further performed AR ChIP-seq and ATAC-seq in AR-positive lung cells and AR-positive prostate cells. Unlike in prostate cells, the lack of specific AR binding at TMPRSS2 locus in lung cells, as demonstrated by AR ChIP-seq, were consistent with the finding that TMPRSS2 expression was independent of AR expression in human lung epithelial cells. These findings indicated mechanisms explaining that the lack of antiviral activity of enzalutamide against SARS-CoV-2 is due to a lack of direct AR binding at the TMPRSS2 locus in lung epithelial cells.
However, our study had limitations. Microenvironmental components, including immune cells, nerve cells and stromal cells, are involved in viral infection and subsequent replication33–35. Although we employed Ad-ACE2-transduced in vivo mouse models, our models did not consider the human lung microenvironment. Since stromal cells in multiple human organs, including the lungs, are also characterized by AR expression, we cannot exclude the possibility that enzalutamide might display antiviral activity by altering the expression of some essential cytokines or chemokines in stromal cells.
It was also noting that SARS-CoV-2 could still infect the lungs of Tmprss2-KO mice with lower effectivity. Besides, when transduced with Ad-ACE2, both TMPRSS2-negative prostate cells PC3 (data not shown) and lung cells H23 were permissive for robust SARS-CoV-2-driven entry (Extended Data Fig. 5k). These findings implied that besides TMPRSS2, other factors may also play a crucial role in promoting SARS-CoV-2 infection. Further studies to identify these factors and their precise functions in mediating SARS-CoV-2 infection will be really necessary.
Finally, we took advantage of multiple models of human prostate and lung cells, patients-derived benign lung organoids and Ad-ACE2-transduced Tmprss2-KO and WT mice to comprehensively confirm the pivotal function of TMPRSS2 in SARS-CoV-2 infection. Our findings validated that enzalutamide significantly inhibits SARS-CoV-2 infection in AR and TMPRSS2 double positive prostate cancer cells, identified that enzalutamide does not exhibit antiviral activity in human lung cancer cells and patients-derived benign lung organoids in vitro and in the lungs of Ad-ACE2-transduced WT mice in vivo, and demonstrated the distinct AR binding pattern between prostate and lung epithelial cells. These findings will enhance our understanding of TMPRSS2 in SARS-CoV-2 infection and indicate the potential failure of clinical trials using enzalutamide to treat COVID-19 patients.
Author contributions
D.G. conceived and designed the experimental approach. F.L., M.H., P.F.D., J.H. and X.T.T. performed most experiments. W.X., Y.W., X.C., Y.T.L. and D.Q. performed the experiments in Biosafety Level 3 Laboratory. S.B.J., Y.H.X. and L.L. supervised and designed experiments in Biosafety Level 3 Laboratory. X.Y.T., X.Y.X, W.X.G., Y.J.Z., Y.G.L., Y.Q.Z, X.Y.Z., Z.L., R.A., S.B.J., Q.W. and H.B.J. helped with the experiments and provided technical support. J.H., M.H., P.F.D. and Q.W. edited the paper. F.L. and D.G. wrote the manuscript. D.G., L.L., Y.H.S. and Y.H.X. prepared the manuscript as the senior authors.
Competing interests
The authors have no competing interests to declare.
Methods
Transduction and infection of mice
Mice were anesthetized with Avertin (Sigma-Aldrich, T48402-5G) and transduced intranasally with 2.5×109 FFU of Ad5-ACE2 adenovirus in 75μL DMEM (Gibco C11995500BT). Mice were infected intranasally with 1×105 PFU of SARS-CoV-2 at the fifth day after Ad-ACE2 transduction. Three days post infection, lungs were harvested for virus titer measurement and pathogenicity analysis using qPCR and immunohistology, respectively.
Castration and enzalutamide treatment of mice
Enzalutamide (Selleck, S1250) (10 mg/kg; the vehicle contained 1% carboxymethyl cellulose, 0.1% Tween 80, and 5% DMSO) was administered intragastrically to castrated mice daily for 10-30 days as previously described22.
Isolation of human lung cells and lung organoid culture
Non-tumor lung tissue obtained from patients undergoing lung resection was dissected and minced with scissors, washed with 5 mL of DMEM (Gibco, C11995500BT) with Primocin (InvivoGen, ant-pm-2), and then digested with Collagenase II (Gibco, 17101015) for 1-2 h in a cell incubator at 37°C with shaking. DMEM supplemented with 10% FBS (ExCell (Serum), FSP500) was added to terminate digestion. The suspension was strained through a 70 μm filter, and the cells were then collected by centrifugation at 1,500 rpm. If a visible red pellet was produced, erythrocytes were lysed in 8 mL of red blood cell lysis buffer (1 g/L KHCO3, 8.3 g/L NH4Cl, and 0.041 g/L EDTA-Na2.2H2O) for 4 minutes at room temperature before the addition of 24 mL of PBS and centrifugation at 1,500 rpm. Dissociated cells were washed and seeded in growth factor-reduced Matrigel (Corning) and cultured in Advance DMEM/F12 medium supplemented with 10 mM HEPES (Gibco), 2 mM GlutaMAX-1 (Gibco), 500× Primocin (InvivoGen), 1×B27 (Gibco), 1.56 mM N-acetylcysteine (Sigma), 10 mM nicotinamide (Sigma), 0.5 μM A83-01 (Tocris), 10 μM Y27632, 50 ng/mL EGF (Peprotech), 10 ng/mL FGF10 (Peprotech), 1 ng/mL FGF2 (Peprotech), 10% in-house-prepared R-Spondin1, 10% Noggin and 30% Wnt3a.
qRT-PCR (SYBR)
Total RNA was extracted with TRIzol reagent (Ambion, 15596018). The solution was mixed well by pipetting several times and lysed at room temperature (RT) for 30-60 minutes. Then, a 1/5 volume of chloroform was added, and the mixture was vortexed for 15 s. The mixture was then incubated for 2 minutes and centrifuged at 12,000 rpm for 15 minutes at 4°C. The aqueous phase was transferred into a new tube, and an equal volume of isopropanol was added. The mixture was centrifuged at 13,000 rpm for 10 minutes at 4°C. The supernatant was discarded, and the pellet was resuspended in 75% ethanol and centrifuged at 8,000 rpm for 7 minutes at 4°C. The supernatant was then thoroughly removed and discarded. The pellet was resuspended in 50 μL of nuclease-free water. Reverse transcription was further performed with PrimeScriptTM RT Master Mix (TaKaRa, RR036A) with 400 ng of total RNA as input. qRT-PCR was conducted with SYBR qPCR Mix (Qiagen, 208054) using the manufacturer’s protocol. The primer sequences are listed as followed:
Human-TMPRSS2-F: CCTCTAACTGGTGTGATGGCGT;
Human-TMPRSS2-R: TGCCAGGACTTCCTCTGAGATG;
Human-AR-F: ATGGTGAGCAGAGTGCCCTATC;
Human-AR-R: ATGGTCCCTGGCAGTCTCCAAA;
Human-ACTB-F: CATGTACGTTGCTATCCAGGC;
Human-ACTB-R: CTCCTTAATGTCACGCACGAT;
Mouse-Tmprss2-F: AAGTCCTCAGGAGCACTGTGCA;
Mouse-Tmprss2-R: CAGAACCTCCAAAGCAAGACAGC;
Mouse-Actb-F: CATTGCTGACAGGATGCAGAAGG;
Mouse-Actb-R: TGCTGGAAGGTGGACAGTGAGG.
Western blotting
Cell lysates were prepared in RIPA buffer supplemented with proteinase/phosphatase inhibitors. The protein content was quantified with a BCA (Thermo) assay. Fifteen micrograms of protein were separated via SDS-PAGE and transferred onto a 0.45 mm PVDF membrane (GE). The membrane was blocked for 1 hour at room temperature in TBST buffer containing 5% milk and was incubated overnight at 4°C or for 2 h at room temperature with primary antibodies diluted in TBST buffer containing 5% milk. The membrane was then incubated with rabbit HRP-conjugated secondary antibodies (SAB, #L3012) for 1 h in 5% milk at RT. The primary antibodies included anti-β-Actin (Sigma-Aldrich, A3854, 1:5,000), anti-AR (Abcam, ab108341, 1:2,000), anti-TMPRSS2 (Abcam, ab92323, 1:1,000), and anti-ACE2 (Proteintech, 21115-1-AP, 1:1000) antibodies.
Immunohistochemistry and immunofluorescence
Organoids were fixed with 4% paraformaldehyde for 15 minutes at room temperature. Fixed organoids were dehydrated sequentially with 95% and 100% ethanol for 10 minutes, cleared in xylene for 15 minutes, and then immersed in paraffin 3 times for 30 minutes each. Human lung tissues were fixed with 4% paraformaldehyde overnight at 4°C. The tissue was dehydrated sequentially with 75%, 95% and 100% ethanol for 1.5 h each, cleared in xylene for 22 minutes at 55°C and immersed in paraffin. For immunohistochemistry, freshly sliced 4-micron paraffin sections were subjected to antigen retrieval by boiling for 45 minutes in 0.01 M citrate buffer. Endogenous peroxidase activity was quenched by immersing the slides in 3% H2O2 for 20 minutes. The slides were then blocked in 2% BSA for 1 hour and stained with primary antibodies in blocking buffer at 4°C overnight or at room temperature for 2 h. The slides were then incubated with an HRP-conjugated secondary antibody (OriGene) for 20 minutes at RT and stained with DAB (Vector Laboratories). The following primary antibodies were used: anti-FLAG (Abmart, M20008F, 1:250) and anti-AR (Abcam, ab108341, 1:200). For immunofluorescence, sections were blocked in 5% goat serum for 1 h at room temperature, stained with primary antibodies at 4 °C overnight, washed with PBST three times and incubated with secondary antibodies for 1 h at room temperature. Sections were then washed with PBST three times and stained with DAPI (Thermo) for 5 minutes. The monoclonal antibody against the RBD domain of SARS-CoV-2 S protein (anti-S) was cloned from a convalescent SARS-CoV-2 individual and produced by transiently transfecting HEK293F cells. To visualize AR and TMPRSS2 signals, we used Tyramide SuperBoost Kits (Invitrogen, B40926) and incubated the sections for 8.5 minutes at room temperature. The following primary antibodies were used: anti-SPC (Sigma-Aldrich, ab3786, 1:200), anti-AR (Abcam, ab108341, 1:200), and anti-TMPRSS2 (Abcam, ab92323, 1:250).
Transduction of cells with Ad-ACE2
Cells were seeded in 6-well plates before transduction. The next day, Ad-ACE2 was transduced into cells at a multiplicity of infection (MOI) of 100 with polybrene. The culture medium supernatant was replaced with fresh medium 12 hours post transduction.
Pseudovirus production
SARS-CoV-2 pseudovirus was produced by cotransfection of 293T cells with pNL4-3.luc.RE and PCDNA3.1 encoding the SARS-CoV-2 S protein using Vigofect transfection reagent (Vigorous Biotechnology, T001). One hour before transfection, the medium was replaced with fresh DMEM (GIBCO, C11995500BT). Further transfection was performed according to the manufacturer’s protocol. The supernatants were harvested at 48 hours post transfection, filtered through a 0.45 μm cell strainer, and split into 1.5 mL tubes for storage at −80°C.
Pseudovirus infection assay
Cells transduced with or without Ad-ACE2 were seeded in 96-well plates at initial count of between 15, 000 and 20, 000 cells per well and treated with different agents (10 μM camostat mesylate (Selleck, S2874) or 10 μM enzalutamide (Selleck, S1250)). Two days post seeding and treatment, cells were incubated with pseudovirus for 12 hours. The culture medium supernatant was then replaced with fresh medium. Two days post virus infection, the culture medium supernatant was removed, and the cells were washed with PBS. The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm. Lysis buffer (20 μL) was used for luciferase activity measurement with the Luciferase Assay System (Promega, E151A) in a BioTek Synergy 2 reader.
SARS-CoV-2 infection
The SARS-CoV-2 isolate was obtained from a clinical case in Shanghai, China (SARS-CoV-2/SH01/human/2020/CHN, GenBank ID; MT121215). SARS-CoV-2 were propagated in Vero cells. Ad-ACE2-transduced mice were infected intranasally with 1×105 PFU of SARS-CoV-2. Cells and LuOs were infected with SARS-CoV-2 at M.O.I=0.01 and M.O.I=1 respectively. All experiments using authentic SARS-CoV-2 were performed in a biosafety level 3 (BSL3) facility at Fudan University.
qRT-PCR (Probe)
Viral RNA was extracted using TRIzol®LS Reagent (Invitrogen, 10296010) as manufacture’s instruction. One-Step PrimeScript RT-PCR Kit (Takara, RR064) was utilized for qRT-PCR (probe) to measure viral loads with program setting as followed: 95°C 10s, 42°C 5min for reverse transcription; (95°C 5s, 56°C 30s, 72°C 30s) x 40 cycles for PCR reaction. Sequences of primers are listed as followed:
SARS-CoV-2-N-F: GGGGAACTTCTCCTGCTAGAAT;
SARS-CoV-2-N-R: CAGACATTTTGCTCTCAAGCTG;
SARS-CoV-2-N-probe: 5’-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3’.
ChIP-seq library preparation
ChIP-seq was performed as previously described36. In brief, 10 million cells were fixed with 1% formaldehyde at room temperature for 10 minutes with rotation. Then, 125 mM glycine was added to quench the formaldehyde at room temperature for 5 minutes. Cells were washed with cold PBS. The supernatants were then removed, and 880 μL of ice-cold cell lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, 1× proteinase inhibitor) was added and incubated at 4°C for 30 minutes with rotation. An 880 μL cell lysate was transferred into a Covaris milliTUBE 1 mL AFA Fiber vial and sheared in a Covaris S220 ultrasonicator (fill level: 10, duty cycle: 5, PIP: 140, cycles/BURST: 200, time: 4 minutes). Clarified samples were collected by centrifugation at 16,100 rcf for 15 minutes at 4°C. After preclearing using 20 μL of protein G beads (Invitrogen, 10003D), 3 μL of anti-AR antibody was added (Abcam, ab108341) for immunoprecipitation overnight. To bind the anti-AR antibody, 60 μL of protein G beads was added and incubated with rotation for two hours at 4°C. The beads were washed twice each with Low Salt Wash Buffer, High Salt Wash Buffer and LiCl Wash Buffer and resuspended in 100 μL of freshly prepared DNA Elution Buffer (50 mM NaHCO3 and 1% SDS). The ChIP sample beads were placed on a magnet, and the supernatant was collected into a new tube. The above elution step was repeated with another 100 μL volume of elution buffer. The samples were then digested with 10 μL of Proteinase K (Invitrogen, 25530049) with incubation at 67°C for 4 hours. DNA was purified with DNA Clean & Concentrator™-5 (Zymo Research, D4004). One nanogram of eluted DNA was used as input for library construction with a TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme, TD503). Libraries were sequenced with the Illumina NovaSeq sequencing system (PE 2×150 bp reads) at Berry Genomics.
ChIP-qPCR
Eluted DNA (0.5 μL) was used as the template for ChIP-qPCR with SYBR qPCR Mix (Qiagen, 208054) following the manufacturer’s protocol. The primer sequences used for ChIP-qPCR are listed as follows:
AR_ChIP_TMPRSS2_ARE_F: TGGTCCTGGATGATAAAAAAGTTT;
AR_ChIP_TMPRSS2_ARE_R: GACATACGCCCCCACAACAGA.
ChIP-seq data processing and analysis
Raw fastq files were first trimmed to remove adaptors using TrimGalore-0.5.0 with the following parameter settings: -q 25 --phred33 --length 35 -e 0.1 --stringency 4. Trimmed fastq files were then mapped to hg19 genome utilizing Bowtie237. Sambamba_v0.6.6 was conducted to remove duplicates38. For IGV visualization, deepTools was then performed using function bamCoverage to generate normalized CPM .bw files39. For peak calling, MACS2 was utilized with -q 0.05 parameter setting. DeepTools was further applied for heatmap visualization with the function of computeMatrix and plotHeatmap.
ATAC-seq library preparation
To reduce the amount of contaminating mitochondrial DNA, we performed a previously reported optimized ATAC-seq protocol40. In brief, 50,000 cells were collected and washed once with PBS. Cells were then lysed in 50 μL of ice-cold lysis buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgCl2; 0.1% NP-40; 0.1% Tween 20; and 0.01% digitonin) for 3 minutes on ice. Immediately after lysis, nuclei were washed with 1 mL of wash buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgCl2; and 0.1% Tween 20) and then centrifuged at 500g for 10 minutes at 4°C. To prepare sequencing libraries, a TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme, TD501) was utilized for the following steps.
ATAC-seq data processing and analysis
The approach used or ATAC-seq data processing was quite similar to that used for ChIP-seq data processing. However, the peak calling step differed due to the lack of input control files. In brief, after raw reads were trimmed with TrimGalore-0.5.0, Bowtie2 was used for mapping the reads to the hg19 genome37. SAMtools was further utilized for bam file sorting and indexing. The bamCoverage function in deepTools was used to generate .bw files with counts per million (CPM) normalization39. R package Diffbind was used to identify overlapped peaks between AR ChIP-seq-generated peaks in LNCaP cells and ATAC-seq-generated peaks in all four cell lines, respectively. Then, both-open peaks were defined by overlapping the above generated peaks in all four cell lines. To further identify specific prostate-open peaks, we employed the intersect function in bedtools 41 to exclude peaks that emerged in any of the three lung cell lines in LNCaP cells.
GSEA analysis
We downloaded gene expression matrices of multiple cancer cell lines from cBioPortal42,43 (derived from Cancer Cell Line Encyclopedia). We next performed GSEA to determine whether hallmark androgen response genes show significantly differences between AR-positive prostate cancer cells (LNCaP, VCaP and 22RV1) and AR-positive lung cancer cells (A549, H1437 and H2126)44. In addition, we also compared sum of z-scores for hallmark androgen response genes between these two groups.
Single-cell RNA-seq analysis
Single-cell RNA-seq analysis was performed on data from the COVID-19 Cell Atlas (https://www.covid19cellatlas.org). To evaluate the mRNA expression levels of target genes in different lung cell types, we selected a single-cell RNA-seq dataset generated from healthy human lungs25.
Statistical analysis
Two-tailed Student’s t-tests were performed in GraphPad Prism 7 to compare differences between two groups. All data are presented as the mean ± standard error of the mean (SEM) values. Pearson correlation analysis was performed with the cor.test function in R to identify whether the mRNA expression of one gene was significantly correlated with that of another gene.
Acknowledgements
We thank members of the Core Facility of Microbiology and Parasitology (SHMC) and the Biosafety Level 3 Laboratory at Shanghai Medical College of Fudan University, especially Qian Wang, Chengjian Gu. We thank the Genome Tagging Project (GTP) Center, Shanghai Institute of Biochemistry and Cell Biology (CAS), for technical support. We thank Lingling Chen and Yang Wang for providing thoughtful suggestions and technical support in immunofluorescence staining. This study was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA16020905 and XDB19000000), the National Key Research and Development Program of China (No. 2017YFA0505500), the National Natural Science Foundation of China (81830054, 81772723, and 81822045), the State Key Project for Infectious Diseases (2018ZX10302207-004-002), the Development Programs for COVID-19 of Shanghai Science and Technology Commission (20431900401) and Program of Shanghai Academic/Technology Research Leader (20XD1420300).