Abstract
More than 80% of gastric cancer is attributable to stomach infection with Helicobacter pylori (Hp), even though the bacterium is not always present at time of diagnosis. Infection is thought to lead to cancer by promoting the accumulation of oncogenic mutations downstream of inflammation; once oncogenic pathways become activated, infection may become dispensable for cancer development. Gastric preneoplastic progression involves sequential changes to the tissue, including loss of parietal cells, spasmolytic polypeptide-expressing metaplasia (SPEM), intestinal metaplasia (IM) and dysplasia. In mice, active KRAS expression recapitulates these tissue changes in the absence of Hp infection. This model provides an experimental system to investigate whether Hp infection has additional roles in preneoplastic progression, beyond initiating inflammation. Mice were assessed by evaluating tissue histology, gene expression changes, the immune cell repertoire, and expression of metaplasia and dysplasia markers. Compared to Hp-/KRAS+ mice, Hp+/KRAS+ mice had i) severe T cell infiltration and altered macrophage polarization; ii) altered expression of metaplasia markers, including increased expression of CD44v9 (SPEM) and decreased expression of TFF3 (IM); iii) more dysplastic (TROP2+) glands; and iv) greater proliferation of metaplastic and dysplastic glands. Hp was able to persistently colonize the stomach during the onset of these tissue changes, and eradication of Hp with antibiotics prevented metaplastic, dysplastic and proliferation marker changes. Collectively, these results suggest that gastric preneoplastic progression differs between Hp+ and Hp-cases, and that sustained Hp infection can promote the later stages of gastric preneoplastic progression, in addition to its established role in initiating chronic inflammation.
Introduction
About 13% of the global cancer burden in 2018 was attributable to carcinogenic infections 1, and Helicobacter pylori (Hp)-associated gastric cancer accounted for the largest proportion of these cancers 2. More than 77% of new gastric cancer cases, and more than 89% of new non-cardia gastric cancer cases, were attributable to infection with Hp 1, a bacterium that colonizes the stomach of half the world’s population 3. However, Hp infection confers only a 1 to 2% lifetime risk of developing stomach cancer 4 and thus a complex interplay between the bacterium and host is presumed to lead to cancer development in only some individuals.
The exact mechanisms through which Hp infection promotes gastric cancer remain largely elusive. Hp infection typically occurs during childhood and always causes chronic inflammation (gastritis) 5. Hp-dependent chronic inflammation promotes the accumulation of reactive oxygen species and other toxic products that cause mutations in gastric epithelial cells 6-8. Early studies using tissue histology rarely detected Hp in tumors, leading to a belief that Hp triggers the initial inflammatory insult in the stomach, but that Hp is essentially irrelevant by the time gastric cancer is detected; in other words, once chronic gastric inflammation develops and oncogenic pathways are activated, the presence of Hp is no longer necessary to promote metaplastic changes that lead to cancer. However, more sensitive molecular methods detect Hp in about half of tumors 9-11, and eradication of Hp combined with tumor resection helps prevent tumor recurrence 12, suggesting that Hp may promote the later stages of metaplasia and cancer development in at least some individuals.
Beyond eliciting oncogenic mutations, the mechanism(s) through which chronic gastritis might promote gastric cancer development is not well understood 13. Humans generally develop a strong Th1 and Th17 immune response against Hp that helps control the infection 14-16. This T cell response does not clear the infection and furthermore can drive immunopathology in the gastric mucosa 17, 18, and Hp infection can disrupt normal T cell function through multiple mechanisms 13, 19, 20. Thus, T cells can play both protective and detrimental roles during Hp stomach infection. More broadly, anticancer immunity in the context of gastric cancer is not well understood. A better understanding of how active Hp infection may impact gastric inflammation in the context of metaplasia and cancer development may lead to the discovery of new drug targets or therapeutic strategies.
The Mist1-Kras mouse is one of the only existing mouse models to recapitulate the progression from healthy gastric epithelium to spasmolytic polypeptide-expressing metaplasia (SPEM), intestinal metaplasia (IM) and dysplasia 21. This model utilizes KRAS, a GTPase signaling protein of the Ras (Rat Sarcoma) family that regulates cell survival, proliferation and differentiation 22, 23. Molecular profiling studies have shown that about 40% of gastric tumors have signatures of RAS activity 24, 25. In the mouse model, treatment with tamoxifen (TMX) induces the expression of a constitutively active Kras allele (G12D) in the gastric chief cells. Within one month, SPEM develops in 95% of corpus glands, and over the next three months progresses to IM 21. Thus, active KRAS expression in mice serves as a tool to recapitulate changes that, in humans, are induced by years of inflammation due to Hp infection. We used Mist1-Kras mice to test our hypothesis that Hp, if present during metaplasia and dysplasia, could impact pathology. We found that sustained Hp infection coupled with active KRAS expression led to severe inflammation, altered metaplasia marker expression, and increased cell proliferation and dysplasia compared to Hp-/KRAS+ mice. Thus, the course of gastric neoplastic progression may differ depending on whether Hp is present during the later stages of disease progression.
Results
Hp infection worsens gastric immunopathology in mice expressing active KRAS
To assess whether Hp impacts KRAS-driven metaplasia, we performed concomitant infection/induction experiments in Mist1-Kras mice. First mice were infected with Hp, or mock-infected, and the next day mice were treated with tamoxifen (TMX) to induce active KRAS expression in stomach chief cells, or sham-induced. After two, six or 12 weeks, mice were humanely euthanized and stomachs were aseptically harvested and used for downstream analyses (Figure 1). Formalin-fixed, paraffin-embedded tissue sections were used for histological analysis of the corpus (Figure 2), where active KRAS is expressed in TMX-induced Mist1-Kras mice. Compared to Hp-/KRAS-mice (Figure 2A and B), Hp infection alone caused modest inflammation at two weeks that increased over time, with loss of parietal cells by six weeks and moderate surface epithelial hyperplasia by 12 weeks (Figure 2C and D). Mice expressing active KRAS had far more striking changes to the tissue over time (Figure 2E-H). To quantify the effects of Hp infection in this model, a blinded analysis was performed to assess inflammation, oxyntic atrophy (loss of parietal cells), and surface epithelial hyperplasia in active KRAS-expressing mice (Figure 3A-C).
KRAS expression caused changes to the corpus epithelium that were apparent within two weeks, with a moderate degree of inflammation, surface epithelial hyperplasia, and some loss of parietal cells. These changes were slightly more severe in a subset of Hp+/KRAS+ mice, but overall there were no significant histological differences between Hp-/KRAS+ and Hp+KRAS+ mice at this early time point (Figure 2E and G). By six weeks, each of these parameters became more severe, and notably, parietal cell loss was significantly greater in Hp+/KRAS+ mice compared to Hp-/KRAS+ mice (Figure 3A). By 12 weeks, Hp-/KRAS+ mice had mucinous cells, in line with previous observations 21 (Figure 2F). Hp+KRAS+ mice looked different from Hp-/KRAS+ mice, with loss of normal basal polarity of epithelial cells, and gland architecture that was severely disrupted, including forked or star-shaped gland structure indicative of extensive branching and disorganized maturation (Figure 2G). As well, these mice had hyperchromatic nuclei with variations in nuclear size, which can indicate dysplasia. Moreover, at 12 weeks Hp+/KRAS+ mice had significantly increased inflammation, parietal cell loss and surface epithelial hyperplasia compared to Hp-/KRAS+ mice (Figure 3A-C). Finally, the overall histology score (histological activity index), which sums the above scores along with scores for other parameters like epithelial defects and hyalinosis (Supplementary Figure S1) and which thus indicates the degree of overall immunopathology 26, was significantly increased in Hp+/KRAS+ mice compared to Hp-/KRAS+ mice at both six and 12 weeks (Figure 3D). Thus, concomitant Hp infection and active KRAS expression in the corpus leads to histopathological changes to the tissue within six weeks that become more severe by 12 weeks.
The striking inflammation seen in Hp+/KRAS+ mice compared to Hp+/KRAS-mice might be expected to eliminate Hp infection. However, Hp was recovered from most KRAS+ mice by stomach culturing (Figure 3E), demonstrating that the bacterium could to some extent withstand the severe inflammation of the preneoplastic stomach. At two weeks, Hp titers were not significantly different between Hp+/KRAS- and Hp+/KRAS+ mice, suggesting that the early histopathological changes did not impact bacterial colonization. In sham-induced (KRAS-) mice, Hp titers were similar at six and 12 weeks, and in both cases were lower than at two weeks, likely due to the onset of adaptive immunity to control the infection. However, in Hp+/KRAS+ mice, the contraction of the Hp population was greater, with Hp recovered from only ten out of 12 animals at six weeks and ten out of 13 animals at 12 weeks. Hp could be detected within glands by immunofluorescence microscopy (Supplementary Figure S2). No differences in titer or overall histology score were observed between male and female mice. Interestingly, stomach Hp loads were not correlated with histology scores (Figure 3F). We therefore hypothesized that the host inflammatory response to Hp infection might contribute to Hp-dependent tissue changes.
Hp infection increases and alters KRAS-driven inflammation
Activated KRAS expression itself elicits inflammation: by 12 weeks, the median corpus inflammation score in Hp-/KRAS+ mice was two (Figure 3B), denoting coalescing aggregates of inflammatory cells in the submucosa and/or mucosa 26. In this histological evaluation, the addition of Hp significantly increased inflammation by 12 weeks (P < 0.01), with the median score rising to three (denoting organized immune cell nodules in the submucosa and/or mucosa). To characterize the nature of the inflammation, gene expression changes at 12 weeks were assessed with a NanoString mouse immunology panel (Figure 4 and Supplementary Table S2). Transcripts of Cd45, a pan-immune cell marker, were significantly increased in Hp+/KRAS-mice and especially in Hp+/KRAS+ mice compared to Hp-mice (Supplementary Figure S3), suggesting greater numbers of immune cells in infected mice. Of the 561 genes in the panel, 60 had no detectable expression among any mice (n=25) and were excluded from subsequent analysis. Hierarchical clustering was performed on the remaining 501 genes and revealed distinct clustering of the treatment groups (Figure 4A). All Hp+ mice clustered separately from Hp-mice, demonstrating that infection had the greatest impact on gene expression. Within both the Hp+ and the Hp-cluster, KRAS+ mice clustered separately from KRAS-mice, suggesting that active KRAS expression also impacted inflammatory gene expression, though to a lesser extent than Hp infection did.
Next we assessed gene expression patterns in the different mouse groups. Compared to Hp-/KRAS+ mice, Hp+/KRAS+ mice had 235 significantly differentially expressed genes (DEGs) (Padjusted < 0.05) (Figure 4B). Several of the most highly upregulated genes, including Cd3d, Cd3e, Cd4, Cd8a, Gzma, Ctla4, Icos and Cd6, implicated a strong T cell response, in accordance with previous studies in humans and naive animal models 27, 28. Likewise, compared to Hp-/KRAS-mice, Hp+/KRAS-mice had 177 DEGs, with Cd3d, Cd3e, Cd4, Cd8a, Gzma, Ctla4, Icos and Cd6 once again highly significantly differentially expressed (Figure 4C). Thus, many of the gene expression differences seen in Hp+/KRAS+ mice vs. Hp-/KRAS+ mice are likely reflective of a general pattern of Hp-mediated inflammation that is independent of the metaplastic state of the tissue. However, we identified a unique inflammatory gene signature in Hp+/KRAS+ mice (Figure 4D), demonstrating that the inflammation observed in this group is not only of a greater magnitude than in the other groups, but also of a different nature. We identified 46 genes whose expression (normalized to Hp-/KRAS-mice) was >2-fold increased or decreased in Hp+/KRAS+ mice, but <1.5-fold increased or decreased in Hp+/KRAS- and Hp-/KRAS+ mice. Many of these genes implicated T cells (Ccr6, Cd27, Cd53, Cxcl11, Foxp3, Gata3, Il12b, Pdcd1lg2 [PD-L2], Tigit, and Tnfsf18 upregulated; Il17re downregulated) and macrophages (Ccl3, Csf1r, Emr1 [F4/80], Il1a and Irf5 upregulated). As well, most markers of T cell exhaustion 29, 30 were only strongly expressed in Hp+/KRAS+ mice (Supplementary Figure S4). Thus, even though both Hp+/KRAS+ mice and Hp+/KRAS-mice had significant upregulation of T cell-related genes compared to their Hp-counterparts, the addition of active KRAS may impact the nature of T cell polarization and function.
In animal models, immune pressure due to chronic Hp infection results in loss of function of the Hp type IV secretion system (T4SS) 31. Hp strains isolated from long-term experimental infections of C57BL/6 mice (but not Rag1 mice deficient in adaptive immune responses), gerbils and monkeys lose their ability to elicit IL-8 secretion by gastric epithelial cells in vitro 31. In line with these observations, we found that approximately 50% of Hp strains isolated from 12+ week infections of KRAS-mice had lost their T4SS activity (Supplementary Figure S5). Surprisingly, Hp strains isolated from KRAS+ mice were no more likely to lose their T4SS activity, despite the severe inflammation seen in these animals.
Hp+/KRAS+ mice have T cells throughout the lamina propria and fewer M2 macrophages
To detect immune cell subsets in the corpus of Hp-/KRAS+ vs. Hp+/KRAS+ mice at 12 weeks, we performed multiplex fluorescent immunohistochemistry (IHC) with the following markers: for T cells, CD3, CD4, CD8α, FOXP3 (regulatory T cell marker) and PD-1 (T cell exhaustion marker); for macrophages, F4/80 and the polarization markers MHC class II (M1 macrophages) and CD163 (M2 macrophages) (Figure 5). HALO software was used to detect and enumerate immune cell subsets (Supplementary Figure S6). In Hp-/KRAS+ mice we detected moderate numbers of CD3+ T cells, most of which were CD4+, and a few of which were CD8α+ (Figure 5A and Supplementary Figure S6A). Hp+/KRAS+ mice had significantly more CD3+ T cells, but the proportion of CD4+ vs. CD8α+ cells was similar, with more CD4+ than CD8α+ cells. Interestingly, most of the CD3+ cells in Hp-/KRAS+ mice expressed FOXP3 and PD-1 (Figure 5B), suggesting they may be activated regulatory T cells 32. In Hp+/KRAS+ mice, there were significantly more FOXP3+ cells (Supplementary Figure S6A), some of which were PD-1 double-positive (Figure 5B). However, many CD3+ cells did not express either of these markers, suggesting they may be different T cell subsets than are found in Hp-/KRAS+ mice, and/or NK cells. Cell localization was also different between treatment groups: in Hp-/KRAS+ mice, most T cells were located at the base of the glands, whereas in Hp+/KRAS+ mice, T cells were located throughout the glands. Finally, both groups of mice had F4/80+ cells throughout the lamina propria (Figure 5C and Supplementary Figure S6B), suggesting presence of macrophages or eosinophils 33. We previously found that M2 macrophages promoted SPEM progression in mice and were associated with human SPEM and IM 34. In Hp-/KRAS+ mice, some F4/80+ cells were dual-positive for the M2 polarization marker CD163, in line with previous findings 21, and some were dual-positive for the M1 polarization marker MHC class II. Hp+/KRAS+ mice had similar numbers of F4/80+/MHC class II+ cells present, but significantly fewer F4/80+/CD163+ cells (Supplementary Figure S6B), suggesting altered macrophage polarization; most CD163 signal was observed in the gland lumen, likely non-specific staining due to mucus binding. These IHC experiments confirm our gene expression-based findings that inflammation in Hp+/KRAS+ mice is not only more severe than in Hp-/KRAS+ mice, but is also altered in nature.
Hp infection alters metaplasia marker expression
We wondered whether the changes in tissue histology observed in Hp+/KRAS+ mice (Figure 2) reflected changes to the nature of metaplasia in these mice. To detect differences in hyperplasia, metaplasia and cell proliferation in corpus tissue from Hp+/KRAS+ vs. Hp-/KRAS+ mice over time (Figure 6A-C), we used: conjugated lectin from Ulex europaeus (UEA-I), which binds alpha-L-fucose, to detect foveolar (pit cell) hyperplasia; conjugated Griffonia simplicifolia lectin II (GS-II), which binds α- or β-linked N-acetyl-D-glucosamine, to detect mucous neck cells and SPEM cells; anti-CD44v10 (orthologous to human CD44v9, referred to herein as “CD44v”) to detect SPEM cells 35; anti-TFF3 and anti-MUC2 to detect IM (goblet) cells 36 (verified by staining of mouse intestine as shown in Supplementary Figure S7); and anti-KI-67 to detect proliferating cells. We assessed differences through quantitative and semi-quantitative analysis of three to five images per mouse (Figure 6D-H). No difference was observed in UEA-I staining among the treatment groups (Supplementary Figure S8), suggesting that Hp infection did not impact foveolar hyperplasia development in this model. In Hp-/KRAS+ mice, GS-II staining was observed at the base of the glands at six weeks, co-localizing with CD44v, demonstrating SPEM (Figure 6A, D, E). As well, most mice had robust, cell-associated TFF3 staining (Figure 6A and F) and a low degree of MUC2 staining (Figure 6B and G), suggestive of early IM. At 12 weeks, CD44v and GS-II staining was reduced, TFF3 staining remained robust, and the percentage of MUC2+ glands increased, suggesting a transition from SPEM to IM in these mice, consistent with previous findings 21. In Hp+/KRAS+ mice, GS-II and MUC2 staining patterns were similar, with GS-II decreasing and MUC2 increasing between six and 12 weeks (Figure 6A, B, D, G). However, CD44v and TFF3 exhibited a different pattern. At six weeks, Hp+/KRAS+ mice had greater CD44v staining and less TFF3 staining compared to Hp-/KRAS+ mice (Figure 6A, E, F). By 12 weeks, CD44v staining waned somewhat but remained higher than in Hp-/KRAS+ mice, and TFF3 staining further diminished compared to Hp-/KRAS+ mice. Taken together, these results demonstrate that Hp infection alters the kinetics of metaplasia development in KRAS+ mice. Metaplasia marker expression was not detected in KRAS-mice (Supplementary Figure S9). Of note, no differences in immunostaining patterns or quantification were observed in KRAS+ mice at two weeks (Supplementary Figure S10), suggesting that Hp-driven metaplastic changes take longer than two weeks to become apparent.
We observed mitotic figures in KRAS+ mice at 12 weeks (Figure 2F and H), suggesting increased cell division. Previously, patients with intestinal metaplasia were found to have significantly increased cellular proliferation (assessed by KI-67 staining) in biopsy tissue compared to healthy controls and patients with chronic active gastritis 37. Here we found substantially more KI-67+ nuclei in corpus tissue of Hp+/KRAS+ mice than Hp-/KRAS+ mice at both six and 12 weeks (Figure 6C and H). Most KI-67+ cells were found within the glandular epithelial compartment, not in the lamina propria, and interestingly, the localization of KI-67+ cells was altered in KRAS+ mice. In KRAS-mice, proliferating cells were found in the middle of the glands, where gastric stem cells are found (Supplementary Figure S9B). We observed that KI-67+ cells localized toward the base of the glands in Hp-/KRAS+ mice (Figure 6C). In Hp+/KRAS+ mice, KI-67 cells were abundant toward the base of the glands and higher up into the middle of the glands. In both groups of mice, some KI-67+ nuclei were found in GS-II+ cells at the base of the glands, suggesting proliferation of SPEM cells. However, in Hp+/KRAS+ mice most KI-67+ nuclei were found above GS-II+ cells, suggesting proliferation of additional cell types beyond those with a SPEM phenotype.
Hp infection increases dysplasia and cancer-associated gene expression
Overexpression of the calcium signal tranducer TROP2 has been implicated in a variety of cancers 38, including gastric cancer, where it is associated with worse outcomes 39. Notably, TROP2 expression was recently identified as a strong indicator of the transition from incomplete IM to gastric dysplasia in Mist1-Kras mice and in human samples 40. We observed TROP2+ corpus glands by immunofluorescence microscopy at six and 12 weeks (Figure 7A and Supplementary Figure S11). Quantitation using collagen VI as a gland segmentation marker revealed that Hp-/KRAS+ mice had TROP2 expression in 0 to 3.6% of glands at six weeks, and 0 to 4.9% of glands at 12 weeks (Figure 7B and Supplementary Figure S11). Hp+/KRAS+ mice had similar TROP2 expression at six weeks (0.5 to 2.5% of glands), but at 12 weeks had significantly more TROP2+ glands (1.5 to 9.1%, P < 0.05). Thus, the addition of Hp significantly increased the percentage of TROP2+ glands in the corpus at 12 weeks. In all mice, most regions of TROP2 staining co-localized with KI-67 staining, suggesting proliferation of dysplastic glands. Only a few TROP2+ regions did not harbor KI-67+ cells (Figure 7A, asterisk). However, the association between TROP2 and Ki67 was greatest in Hp+/KRAS+ mice at 12 weeks, where a median of 86% of TROP2+ glands or gland fragments were KI-67+ (P < 0.01) (Figure 7C), suggesting that Hp infection increases the proliferation of dysplastic glands.
We mined our NanoString gene expression data (Figure 4A) and identified 49 genes implicated in the development of gastrointestinal cancers 41-46. Hierarchical clustering analysis showed that as with the overall panel, Hp infection status had the greatest impact on expression of this subset of genes at 12 weeks, and that active KRAS expression also impacted gene expression, though to a lesser extent than Hp infection status did (Figure 7D). However, some genes, such as Jak2, Notch2 and Runx1, were upregulated in KRAS+ mice regardless of infection status. Finally, metaplastic and dysplastic organoids generated from Hp-/KRAS+ mice at 12 and 16 weeks after active KRAS induction, respectively, were previously found to have unique phenotypes and gene expression signatures 41. Seven of these genes were found in our panel (Figure 7D, denoted with #). Expression of the metaplasia-associated gene Clu was strongly upregulated in KRAS+ mice, but the metaplasia-associated gene Ly86 was only strongly expressed in Hp+/KRAS+ mice. Of the dysplasia-associated genes, Tubb5 was elevated in Hp+ mice, Gapdh was elevated in KRAS+ mice, and Eef1g was not differentially expressed among treatment groups. Finally, Cd44 and Tgfb1 were previously found in both metaplastic and dysplastic organoids 41 and in our study were strongly elevated in Hp+/KRAS+ mice at 12 weeks relative to the other mouse groups. Thus, gene expression in Hp+/KRAS+ whole stomachs at 12 weeks is distinct from Hp-/KRAS+ organoids generated at either 12 or 16 weeks, further supporting the hypothesis that concomitant Hp infection and active KRAS expression results in a unique gastric environment that is distinct from either Hp-/KRAS+ or Hp+/KRAS-mice.
Sustained Hp infection is necessary to elicit changes to metaplasia, dysplasia and cell proliferation
Finally, we tested the impact of antibiotic eradication of Hp in two lines of experiments (Figure 8 and Supplementary Figure S12). First mice were infected with Hp or mock-infected, and active KRAS was induced. Starting at two weeks after active KRAS induction, mice received two weeks of “triple therapy” of tetracycline, metronidazole and bismuth 47 or vehicle (water) as a control, and were euthanized at six weeks (Figure 8A and B). Notably, Hp+/KRAS+ mice that received triple therapy had low CD44v (Figure 8A and C) and high TFF3 (Figure 8A and D) expression, similar to Hp-/KRAS+ mice (whether untreated as in Figure 6E-F, or treated with triple therapy or water). Thus, eradication of Hp early in the course of infection prevents the altered course of metaplasia seen at six weeks. Similarly, we tested the effects of triple therapy after six weeks (a time point where significant Hp-dependent changes to the tissue are already evident) with euthanasia at 12 weeks (Figure 8E and F). Hp+/KRAS+ mice that received triple therapy had reduced TROP2+ glands at 12 weeks (Figure 8E and G), suggesting that sustained Hp presence is necessary to accelerate dysplasia in this model. Finally, we found that at both time points antibiotic-treated Hp+/KRAS+ mice had reduced KI-67 staining (Figure 8B, F and H), demonstrating that sustained Hp presence is also required for the hyperproliferation phenotype in Hp+/KRAS+ mice.
Discussion
In this study we examined the effect of Hp infection in stomachs expressing active KRAS (Table 1). Up to 40% of human gastric cancers have genetic signatures of RAS activity 24, 25. Activation of RAS and/or other oncogenic pathways in humans could be a consequence of Hp-driven inflammation. In our model, KRAS activation serves as a tool to model the consequences of oncogenic inflammation caused by Hp infection. Because active KRAS alone is sufficient to cause gastric preneoplastic progression 21, it might be expected that Hp infection would have no impact on KRAS-driven phenotypes. However, we found that Hp infection did influence preneoplastic progression in this model. Hp infection in KRAS-expressing mice led to more severe inflammation, an altered trajectory of metaplasia, substantial cell proliferation, and increased dysplasia compared to active KRAS alone. Additionally, eradication of Hp with antibiotics prevented these tissue changes, in accordance with a major long-term study of Hp eradication in Colombian adults with precancerous lesions, which showed that continuous Hp presence was significantly associated with disease progression 48. Thus, our study supports the hypothesis that sustained Hp can impact the molecular course of cancer development, beyond just initiating chronic inflammation.
Different mouse models exhibit different clinical features of preneoplastic progression: for example, Helicobacter infection alone causes SPEM, but does not cause foveolar hyperplasia or IM in C57BL/6 mice, whereas uninfected Mist1-Kras mice exhibit all of these tissue states after active KRAS induction 49. Here we found that the combination of sustained Hp infection and active KRAS expression has a unique impact on the development of gastric metaplasia that is not observed with either individual parameter. Compared to Hp-/KRAS+ mice, Hp+/KRAS+ mice had no difference in foveolar hyperplasia or expression of the IM marker MUC2, but had decreased expression of the IM marker TFF3 and increased expression of the SPEM marker CD44v. Further work is needed to determine whether these changes in metaplasia marker expression may reflect increased SPEM vs. a process similar to incomplete IM. To our knowledge, of the various mouse models of gastric corpus preneoplastic progression, only Mist1-Kras mice exhibit true IM (indicated by TFF3+ and MUC2+ glands) in 100% of mice; most other models exhibit SPEM with or without intestinalizing characteristics 49. The finding that Hp infection altered TFF3 expression in Mist1-Kras mice is therefore quite striking. TFF3 expression was moderate in both treatment groups at two weeks, and it is not yet known whether TFF3 expression may have peaked in Hp+/KRAS+ mice at an intermediate time point, such as four weeks, or was never as strongly expressed as in Hp-/KRAS+ mice. Notably, several human studies have reported that the association of SPEM with gastric adenocarcinoma is equal to or even greater than that of IM 50-52, leading to questions in the field regarding the trajectory of metaplasia development prior to gastric cancer onset. Our findings suggest that the trajectory of metaplasia could differ depending on whether or not Hp remains present in the stomach throughout preneoplastic progression.
Sustained Hp infection also caused a striking increase in cell proliferation as indicated by KI-67 staining, and increased TROP2 staining at 12 weeks. TROP2 expression was lower in our mice than what was previously reported 40, which may reflect differences in animal housing conditions, different methods of tissue fixation and processing, or components of the microbiome (although antibiotic perturbation in Hp-/KRAS+ mice had no effect on expression of TROP2 or metaplasia markers). Nonetheless, within our controlled experiments, TROP2 staining was greatest in Hp+/KRAS+ mice, suggesting that infection accelerates the onset of dysplasia. While almost all of the TROP2+ glands in Hp+/KRAS+ mice had co-localized KI-67 staining, demonstrating proliferation of dysplastic glands, there were also many KI-67+ cells in TROP2-glands. Future studies will seek to elucidate the specific cell types that are proliferating in Hp+/KRAS+ mice. Despite the enhanced proliferation of dysplastic glands, Hp+/KRAS+ mice did not develop gastric tumors within 12 weeks. One limitation of our study is that the Mist1 promoter is expressed outside the stomach in secretory lineages, including the salivary glands. Approximately four months after active KRAS induction, Mist1-Kras mice require humane euthanasia due to salivary gland tumors. Thus, we cannot test whether Hp infection promotes even more severe phenotypes, such as tumor development, at later time points. Specifically targeting active KRAS to the chief cells via other promoters could overcome this hurdle. However, Hp+/KRAS+ mice did have increased expression of genes known to be associated with gastrointestinal cancers. It may be that at least some of these genes are associated with gastric cancer simply because they reflect Hp infection, the biggest risk factor for gastric cancer development.
Interestingly, we found that a few Hp+/KRAS+ mice naturally cleared their infection, yet still had a high degree of immunopathology. A limitation of modeling Hp infection in mice is the inability to monitor bacterial burdens over time. It may be that the mice in question cleared their infection just prior to euthanasia, with no time for Hp-driven tissue changes to reverse. Alternatively, Hp infection may lead to a “point of no return,” after which immunopathology develops even in the absence of Hp. This hypothesis has been used to explain the lack of detectable Hp in about half of human gastric tumors 53, 54. However, we found that antibiotic eradication of Hp after six weeks prevented the accelerated dysplasia and hyperproliferation phenotypes at 12 weeks. Thus, if a “point of no return” exists in this model, it must occur after six weeks.
We note that no significant differences in metaplasia or dysplasia marker expression were observed between Hp-/KRAS+ mice and Hp+/KRAS+ mice at two weeks, suggesting that the adaptive immune response to Hp infection may be what promotes the differences in metaplasia and dysplasia observed at later time points. This observation agrees with previous findings that T cells were necessary for Helicobacter-associated gastritis 27, 28 and metaplasia development 55. The immune response seen in Hp+/KRAS+ mice at six and especially 12 weeks far exceeded what was observed in either Hp+/KRAS- or Hp-/KRAS+ mice, and indeed is much greater than what is typically seen in Hp mouse models. Notably, this inflammation did not eradicate Hp: most Hp+/KRAS+ mice remained colonized at 12 weeks. Hp cells were observed within the lumen of metaplastic glands, where they may be protected from direct immune cell interaction. Additionally, Hp has multiple strategies to prevent immune-mediated clearance 13, including disruption of normal T cell functions by: triggering upregulation of PD-L1, a T cell inhibitory ligand that binds programmed cell death protein-1 (PD-1), on gastric epithelial cells, leading to T cell exhaustion 19; inducing anergy through promoting T cell expression of the CTLA-4 co-receptor 56; inhibiting T cell proliferation and normal effector functions with the vacuolating cytotoxin VacA 20; and the induction of tolerogenic dendritic cells, which promote the differentiation of naive T cells into immunosuppressive regulatory T cells 13. It remains unknown whether and to what extent Hp may disrupt T cell functions in our model. Hp+/KRAS+ mice were unique in their upregulation of Foxp3 and had FOXP3+ T cells at 12 weeks, but these cells were not sufficient to limit immunopathology. As well, in Hp+/KRAS+ mice we observed strong transcriptional upregulation of T cell exhaustion-related genes, such as Pdcd1 (PD-1), and Ctla4, implicated in T cell anergy. By immunohistochemistry we saw evidence of PD-1 expression in both Hp-/KRAS+ and Hp+/KRAS+ mice. Further studies are needed to characterize the exact nature of immune cell polarization differences between treatment groups; to confirm whether the T cells observed in Hp+/KRAS+ mice may be exhausted, anergic or senescent; and to test whether immunosuppression or immunomodulation would be protective against Hp’s effects in the model. Nonetheless, it is clear that the combination of Hp infection and active KRAS expression leads to a potent and unique inflammatory state. Given that immunotherapy is still under-utilized in gastric cancer 57 and only a subset of patients benefit from such treatments 58, a better understanding of how active Hp infection may alter the immune microenvironment during gastric metaplasia and cancer development is urgently needed and may lead to new therapeutic strategies.
When Hp was first discovered to be a bacterial carcinogen, studies using tissue histology rarely detected Hp within gastric tumors. Such studies may have helped establish the belief that although Hp initiates the gastric cancer cascade, by the time gastric cancer is developed, Hp no longer matters – the so-called “hit-and-run” model. However, more sensitive methods detect Hp in about half of gastric tumors 9-11, indicating that a large percentage of patients maintain active Hp infection throughout cancer development. Notably, Hp eradication combined with endoscopic resection of early gastric cancer significantly prevents metachronous gastric cancer 12. As well, a recent study of 135 Hp-seropositive subjects with IM found that patients with active Hp infection (determined by histology and/or sequencing) were significantly more likely to have somatic copy number alterations (sCNA), and that patients with sCNA were more likely to experience IM progression 42. Given these observations, there is an urgent need for preclinical models that identify unique features of gastric neoplasia with vs. without concomitant Hp infection, both to understand the etiology of gastric cancer and to determine the impact of infection on different therapeutic approaches. We have shown here that Hp can significantly impact metaplasia and dysplasia development in a clinically relevant mouse model, which suggests that gastric preneoplastic progression can develop differently in the presence vs. absence of Hp. Future studies will elucidate the molecular mechanism(s) through which Hp exerts its effects in this model, and test whether active Hp infection during metaplasia or cancer may represent a therapeutic vulnerability that could be targeted with immunotherapy.
Materials and Methods
Ethics Statement
All mouse experiments were performed in accordance with the recommendations in the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Fred Hutch Institutional Animal Care and Use Committee, protocol number 1531.
Helicobacter pylori Strains and Growth Conditions
Hp strain PMSS1, which is also called 10700 and which is CagA+ with an active type IV secretion system 47, 59, and derivatives were cultured at 37°C with 10% CO2 and 10% O2 in a trigas incubator (MCO-19M, Sanyo). Hp titers were determined by quantitative culture on horse blood Columbia agar (BD Biosciences) with antibiotic supplementation to prevent overgrowth of commensal organisms 60.
Mist1-Kras Mouse Model
Mist1-CreERT2 Tg/+; LSL-K-Ras (G12D) Tg/+ (“Mist1-Kras,” C57BL/6 background) mice were described previously 21. Eight to 16 week-old male and female mice were infected with 5×107 mid-log culture Hp cells in 100 µL of liquid media (BB10) containing 90% (v/v) Brucella broth (BD Biosciences) and 10% fetal bovine serum (Gibco), or mock-infected with 100 µL of BB10. To induce active (oncogenic) KRAS expression, mice received three subcutaneous doses of 5 mg of tamoxifen (Sigma) in corn oil (Sigma) over three days, or were sham-induced with corn oil, starting one day after Hp or mock infection. We used n=10-16 mice per group in N=2 independent experiments per time point, except for antibiotic eradication after six weeks, which used n=5-7 mice per group in N=1 experiment. Subsequent analyses of tissue changes used n=5-12 samples per treatment group, chosen randomly. Mice were humanely euthanized by CO2 inhalation followed by cervical dislocation at two, six or 12 weeks after infection and transgene induction. Stomachs were aseptically harvested; a portion was used for Hp culture and the rest fixed in 10% neutral-buffered formalin for sectioning. For antibiotic eradication, mice received 4.5 mg/mL metronidazole, 10 mg/mL tetracycline hydrochloride and 1.2 mg/mL bismuth subcitrate, or vehicle (water), by oral gavage for two weeks 47.
Histology
A veterinary pathologist (A.K.) scored hematoxylin and eosin-stained tissue sections in a blinded fashion according to criteria adapted from Rogers 26. The sum of the individual scores for each criterion were summed to generate a histological activity index (HAI) score.
Gene Expression Analysis
RNA was extracted from five 4-µm formalin-fixed, paraffin-embedded (FFPE) stomach sections per mouse using the AllPrep DNA/RNA FFPE Kit (Qiagen) and gene expression was detected using the nCounter Mouse Immunology Panel (NanoString). Gene expression differences were detected using nSolver software (NanoString) (Supplementary Table S2). Hierarchical clustering was performed and heat maps were generated with HeatMapper 61 using the average linkage method with Euclidian distance, using log2-transformed gene expression data.
Multiplex Immune Immunohistochemistry
Tissues were stained using the Leica BOND RX system using Leica BOND reagents for dewaxing, antigen retrieval/antibody stripping, and rinsing after each step (Supplementary Table S1). To obtain multiplex labeling, one primary antibody was applied for 60 minutes, followed by the relevant secondary antibody and OPAL fluorophore for 10 minutes each. Slides were stripped of excess antibodies and the next primary and secondary were applied in sequence until all eight primary antibodies were applied.
Immunofluorescence Microscopy and Quantitation of Staining
Immunofluorescence microscopy to assess gastric preneoplastic progression was performed as previously described 21 (Supplementary Table S3). Three to five representative images of corpus tissue per mouse were used for quantitation and the median value was reported for each mouse. Scripts for quantitation of KI-67, GS-II, CD44v and TROP2 can be found on GitHub at: https://github.com/salama-lab/stomach-image-quantitation.
Statistical Analyses
For NanoString analysis, Padjusted values were generated in nSolver with the Benjamini-Yekutieli procedure for controlling the false discovery rate. Other statistics were performed in GraphPad Prism v7.01. Comparisons of three or more groups were performed with the Kruskal-Wallis test with Dunn’s multiple test correction. P < 0.05 was considered statistically significant.
Funding
This work was funded by an Innovation Grant from the Pathogen-Associated Malignancies Integrated Research Center at Fred Hutchinson Cancer Research Center and NIH R01 AI54423 (to NRS). Research was supported by the Cellular Imaging, Comparative Medicine, Genomics & Bioinformatics, and Research Pathology Shared Resources of the Fred Hutch/University of Washington Cancer Consortium (P30 CA015704). VPO is a Cancer Research Institute Irvington Fellow supported by the Cancer Research Institute, and was also supported by a Debbie’s Dream Foundation—AACR Gastric Cancer Research Fellowship, in memory of Sally Mandel (18-40-41-OBRI). AER was supported by the Jacques Chiller Award from the University of Washington Department of Microbiology. JRG was supported by Department of Veterans Affairs Merit Review Award IBX000930, NIH R01 DK101332, DOD CA160479 and a Cancer UK Grand Challenge Award. EC was supported by the AACR (17-20-41-CHOI), the DOD CA160399 and pilot funding from Vanderbilt DDRC DK058404 and VICC GI SPORE P50CA236733.
Supplementary Material
Expanded Materials and Methods
Supplementary Figures 1-7
Supplementary Tables 1 and 3
Supplemental References
Expanded Materials and Methods
Ethics Statement
All mouse experiments were performed in accordance with the recommendations in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The Fred Hutchinson Cancer Research Center is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care and complies with the United States Department of Agriculture, Public Health Service, Washington State, and local area animal welfare regulations. Experiments were approved by the Fred Hutch Institutional Animal Care and Use Committee, protocol number 1531.
Helicobacter pylori Strains and Growth Conditions
Helicobacter pylori strain PMSS1, which is also called 10700 and which is CagA+ with an active type IV secretion system 1, 2, and derivatives were cultured at 37°C with 10% CO2 and 10% O2 in a trigas incubator (MCO-19M, Sanyo). Cells were grown on solid media containing 4% Columbia agar (BD Biosciences), 5% defibrinated horse blood (HemoStat Laboratories) 0.2% β-cyclodextrin (Acros Organics), 10 μg/ml vancomycin (Sigma), 5 μg/ml cefsulodin (Sigma), 2.5 U/mL polymyxin B (Sigma), 5 μg/ ml trimethoprim (Sigma) and 8 μg/ml amphotericin B (Sigma). For mouse infections, bacteria grown on horse blood plates were used to inoculate liquid media (BB10) containing 90% (v/v) Brucella broth (BD Biosciences) and 10% fetal bovine serum (Gibco), which was cultured shaking at 200 rpm overnight and grown to an optical density at 600 nm of 0.4 - 0.6 (mid-log phase), from which an inoculum of approximately 5×107 Hp cells per 100 µl BB10 was prepared. To determine Hp titers in the stomach, harvested tissues were weighed, serially diluted, and plated on the solid media described above, with the addition of bacitracin (200 μg/ml, Acros Organics) to prevent growth of the stomach microbiota.
Mist1-Kras Mouse Model
A breeding pair of Mist1-CreERT2 Tg/+; LSL-K-Ras (G12D) Tg/+ (“Mist1-Kras”) mice on the C57BL/6 background, described previously 3, was obtained from Vanderbilt University (E.C. and J.R.G) and used to establish a colony at Fred Hutchinson Cancer Research Center. Mice were housed two to five per cage, with cages docked in HEPA-filtered ventilation racks that provide airflow control on a 12 hour light/dark cycle, and had access to chow (LabDiet) and water ad libitum. At weaning, ear punches were collected and used for genotyping as previously described 3 with the following primers: Mist1 WT F: CCAAGATCGAGACCCTCACG; Mist1 WT R: ACACACACAGCCCTTAGCTC Mist1 Cre F: ACCGTCAGTACGTGAGATATCTT; Mist1 Cre R: CCTGAAGATGTTCGCGATTATCT; active KRAS F: TCTCTGCAGTTGTTGGCTCCAAC; active KRAS R: GCCTGAAGAACGAGATCAGCAGCC. Healthy eight to 16 week-old male and female mice (randomly allocated to treatment groups) were infected with 5 × 107 mid-log culture Hp cells in 100 µL of BB10, or mock-infected with 100 µL of BB10, via oral gavage. To induce active (oncogenic) KRAS expression, mice received three subcutaneous doses of 5 mg of tamoxifen (Sigma) in corn oil (Sigma) over three days, or were sham-induced with corn oil, starting one day after Hp or mock infection. For antibiotic eradication, mice received “triple therapy” of 4.5 mg/mL metronidazole, 10 mg/mL tetracycline hydrochloride and 1.2 mg/mL bismuth subcitrate, or vehicle (water), by oral gavage.1 Mice received six doses in seven days, two weeks in a row. Mice were humanely euthanized by CO2 inhalation followed by cervical dislocation two, six or 12 weeks after infection and transgene induction. Stomachs were aseptically harvested and most of the forestomach (non-glandular region) was discarded, leaving only the squamocolumnar junction between the forestomach and glandular epithelium. Approximately one-third of the stomach was homogenized and plated to enumerate Hp. The remaining approximately two-thirds of the stomach was fixed in 10% neutral-buffered formalin phosphate (Fisher), then embedded in paraffin and cut into 4 µm sections on positively-charged slides. Hp+/KRAS+ and Hp-/KRAS mice did not exhibit overall health differences; body weights and behaviors were similar at time of euthanasia.
Histology
Stomach sections were stained with hematoxylin and eosin (H&E). A veterinary pathologist (A.K.) scored the slides in a blinded fashion according to criteria adapted from Rogers 4. Corpus tissue was evaluated for inflammation, epithelial defects, oxyntic atrophy, hyperplasia (tissue thickness), hyalinosis, pseudopyloric metaplasia, mucous metaplasia and dysplasia. The sum of the individual scores for each criterion were summed to generate a histological activity index (HAI) score. Scoring criteria are described below. HAI was not correlated with sex or with age of mice at sacrifice.
Inflammation
Multifocal aggregates of inflammatory cells merit a score of 1. As the aggregates coalesce across multiple high-power fields (40X objective), the score increases to 2. Sheets of inflammatory cells and/or lymphoid follicles in the mucosa or submucosa receive a score of 3. Florid inflammation that extends morally or transmurally is a score of 4.
Epithelial defects
A tattered epithelium with occasional dilated glands is a score of 1. As the epithelium becomes attenuated and ectatic glands become more numerous, the score increases to 2. Inapparent epithelial lining of the surface with few recognizable gastric pits are given a score of 3. Score 4 is reserved for mucosal erosions.
Oxyntic atrophy
The oxyntic mucosa is defined by the presence of chief and parietal cells. Loss of up to half of the chief cells merit a score of 1. In instances with near complete loss of chief cells and minimal loss of parietal cells, a score 2 is assigned. The absence of chief cells with half the expected number of parietal cells is given a score of 3. Score 4 signifies near total loss of both chief and parietal cells.
Surface epithelial hyperplasia
This score indicates elongation of the gastric gland due to increased numbers of surface (foveolar) and/or antral-type epithelial cells. Relative to the expected length of a normal gastric pit, a score of 1 indicates a 50% increase in length. A score of 2 is twice the expected length, a score of 3 is three times the expected length, and a score of 4 is four times the expected length.
Hyalinosis
This mouse-specific gastritis lesion refers to the presence of brightly eosinophilic round or crystalline structures in the murine gastric surface epithelium. The presence of epithelial hyalinosis is given a score of 1 while absence of hyalinosis is a score 0.
Pseudopyloric metaplasia
Pseudopyloric metaplasia is the loss of oxyntic mucosa and replacement with glands of a more antral phenotype. The score indicates the amount of replacement by antralized glands. Less than 25% replacement is a score of 1, 26-50% replacement is a score of 2, 51-75% replacement is a score of 3, and greater than 75% replacement is a score of 4.
Mucous metaplasia
This mouse-specific gastritis lesion is defined as the replacement of oxyntic cells with mucous producing cells that resemble Brunner’s glands of the duodenum. The score is assigned based on the percentage of mucosa affected. A score 1 indicates less than 25% involvement, a score of 2 indicates 26-50% involvement, a score of 3 is 51-75% involvement, and a score of 4 means that greater than 75% of the mucosa is involved.
Dysplasia
Dysplasia indicates a cellular abnormality of differentiation. In score 1 lesions, the glands are elongated with altered shapes, back-to-back forms, and asymmetrical cellular piling. In score 2, the dysplastic glands may coalesce with glandular ectasia, branching, infolding, and piling of cells. Gastric intraepithelial neoplasia (GIN) is given a score of 3 and invasive carcinoma is a score of 4. The dysplasia score describes the most severe lesion(s) in each mouse.
Gene Expression Analysis
RNA was extracted from five 4-µm FFPE stomach sections per mouse using the AllPrep DNA/RNA FFPE Kit (Qiagen) and gene expression was detected using the nCounter Mouse Immunology Panel (NanoString). Gene expression differences were detected using nSolver software (NanoString) and are given in Supplementary Table 2. Volcano plots were constructed by taking the log2 of the fold change and the -log10 of the unadjusted P value for each gene. The Padjusted lines show genes meeting the threshold for significance after correction with the Benjamini-Yekutieli procedure for controlling the false discovery rate. Hierarchical clustering was performed and heat maps were generated through HeatMapper 5 using the average linkage method with Euclidian distance, with log2-transformed gene expression data. Clustering was applied to rows (genes) and columns (mice). To identify the unique gene signature in Hp+/KRAS+ mice, gene expression values were normalized to the geometric mean of the expression in Hp-/KRAS-mice, and all genes were identified for which the geometric mean of the fold change in Hp+/KRAS+ mice was >2 and in Hp+/KRAS- and Hp-/KRAS+ mice was <1.5, or the geometric mean of the fold change in Hp+/KRAS+ mice was <0.5 and in Hp+/KRAS- and Hp-/KRAS+ mice was >0.667.
Multiplex Immunohistochemistry for Immune Cell Detection
Slides were baked for 60 minutes at 60°C and then dewaxed and stained on a Leica BOND RX system (Leica, Buffalo Grove, IL) using Leica BOND reagents for dewaxing (Dewax Solution), antigen retrieval/antibody stripping (Epitope Retrieval Solution 2), and rinsing (Bond Wash Solution). Antigen retrieval and antibody stripping steps were performed at 100°C with all other steps at ambient temperature. Endogenous peroxidase was blocked with 3% H2O2 for 5 minutes followed by protein blocking with 10% normal mouse immune serum diluted in TCT buffer (0.05M Tris, 0.15M NaCl, 0.25% Casein, 0.1% Tween 20, 0.05% ProClin300 pH 7.6) for 10 minutes. Primary and secondary antibodies are given in Supplementary Table 1. The first primary antibody (position 1) was applied for 60 minutes followed by the secondary antibody application for 10 minutes and the application of the tertiary TSA-amplification reagent (PerkinElmer OPAL fluor) for 10 minutes. A high stringency wash was performed after the secondary and tertiary applications using high-salt TBST solution (0.05M Tris, 0.3M NaCl, and 0.1% Tween-20, pH 7.2-7.6). Undiluted, species-specific Polymer HRP was used for all secondary applications, either Leica’s PowerVision Poly-HRP anti-Rabbit Detection or ImmPress Goat anti-Rat IgG Polymer Detection Kit (Vector Labs) as indicated in Table S1. The primary and secondary antibodies were stripped with retrieval solution for 20 minutes before repeating the process with the second primary antibody (position 2) starting with a new application of 3% H2O2. The process was repeated until seven positions were completed. For the eighth position, following the secondary antibody application, Opal TSA-DIG was applied for 10 minutes, followed by the 20 minute stripping step in retrieval solution and application of Opal 780 fluor for 10 minutes with high stringency washes performed after the secondary, TSA DIG, and Opal 780 fluor applications. The stripping step was not performed after the final position. Slides were removed from the stainer and stained with DAPI for 5 minutes, rinsed for 5 minutes, and coverslipped with Prolong Gold Antifade reagent (Invitrogen/Life Technologies). Slides were cured overnight at room temperature, then whole slide images were acquired on the Vectra Polaris Quantitative Pathology Imaging System (Akoya Biosciences). The entire tissue was selected for imaging using Phenochart and multispectral image tiles were acquired using the Polaris. Images were spectrally unmixed using Phenoptics inForm software and exported as multi-image TIF files, which were analyzed with HALO image analysis software (Indica Labs). DAPI was used to detect individual cells and then cells expressing each marker were automatically detected based on signal intensity, and reported as a percentage of DAPI-positive cells.
Immunofluorescence Microscopy of Epithelial Phenotypes
Stomach sections were prepared as described above. To validate the antibodies used to detect intestinal metaplasia, the entire intestinal tract from duodenum to colon was removed from an untreated C57BL/6 mouse. The cecum was discarded and the unflushed intestinal tract was rolled as a “Swiss roll,” fixed in 10% neutral-buffered formalin, paraffin-embedded and sectioned. Tissue sections were deparaffinized with Histo-Clear solution (National Diagnostics) and rehydrated in decreasing concentrations of ethanol. Antigen retrieval was performed by boiling slides in 10 mM sodium citrate (Fisher) or Target Retrieval Solution (Agilent Dako) in a pressure cooker for 15 minutes. Slides were incubated with Protein Block, Serum-Free (Agilent Dako) for 90 minutes at room temperature. Primary antibodies (Supplementary Table 3) were diluted in Protein Block, Serum Free, or Antibody Diluent, Background Reducing (Agilent Dako), and applied to the slides overnight at 4°C. Secondary antibodies were diluted 1:500 in Protein Block, Serum Free and slides were incubated for one hour at room temperature protected from light. Slides were mounted in ProLong Gold antifade reagent with DAPI (Invitrogen) and allowed to cure for 24 hours at room temperature before imaging. Slides were imaged on a Zeiss LSM 780 laser-scanning confocal microscope using Zen software (Zeiss) and three to five representative images of the corpus were taken.
Quantitation of Staining
Three to five representative images of corpus tissue per mouse used for staining analysis and the median value was reported for each mouse. Investigators were blinded to the treatment groups. KI-67, GS-II, CD44v10 (orthologous to human CD44v9 and referred to herein as “CD44v”) and TROP2 markers were quantified from fluorescently immunolabelled tissue sections by custom-made scripts developed in MATLAB 2019a. Scripts can be found on Github at https://github.com/salama-lab/stomach-image-quantitation.
After background subtraction and denoising in each channel, positive pixels for DAPI, GS-II, CD44v or TROP2 were identified by image binarization using the Otsu method and morphological filtering. When appropriate, individual glands were segmented using the cytokeratin signal, which is predominant in glandular structures, or using the complement image of the collagen VI signal, which is excluded from glandular structures. For GS-II quantification, the fractional area of cytokeratin staining positive for GS-II was recorded. For TROP2 quantification, the fractional area of each gland fragment identified by collagen VI labelling was recorded, and gland fragments with ≥10% TROP2-positive pixels were considered TROP2-positive. To identify GS-II and CD44v double-positive regions, the GS-II binary mask was first dilated by a few pixels, since GS-II is cytoplasmic and CD44v is membrane-bound. The resulting number of overlapping pixels per image was then recorded. To assess KI-67 staining, individual KI-67-positive nuclei were identified using a watershed algorithm after distance transformation of the binarized signal, and then normalized by dividing by the total number of DAPI-positive pixels in the image.
TFF3, MUC2, and dual-positive TROP2/KI-67 staining were manually assessed. To assess TFF3 staining, images were scored manually using a semi-quantitative scale with the following criteria: 0 = no staining, 1 = 1-25% of glands are positive, 2 = 26-50% of glands are positive, 3 = 51-75% of glands are positive, 4 = >75% of glands are positive for TFF3. Positive TFF3 signal manifests as moderately bright, cell-associated staining with goblet cell-like morphology. Overly bright staining without distinct goblet-like morphology, and/or staining within the gland lumen (not cell-associated), was observed near the top of the glands in Hp-/KRAS-(healthy control) mice and was considered false-positive staining. To assess MUC2 staining, glands were detected by cytokeratin staining, and MUC2+ and MUC2-glands were manually counted. To assess gland fragments dual positive for TROP2 and KI-67, regions of TROP2+ staining that contained KI-67+ nuclei were counted and expressed as a percentage of all TROP2+ glands.
Type IV Secretion System Activity
Hp strain PMSS1 was recovered from infected mice after euthanasia by serial dilution plating, described above, and five or six individual colonies per mouse were expanded and frozen at -80°C. Colonies were then grown and used in co-culture experiments with AGS cells (from a human gastric adenocarcinoma cell line; ATCC CRL-1739) as previously described 6. The input strain of PMSS1 (freezer stock) served as a positive control and a PMSS1ΔcagE mutant 6 served as a negative control. Infections were performed in triplicate and supernatants were collected after 24 hours of co-culture. IL-8 was detected using a human IL-8 enzyme-linked immunosorbent assay (ELISA) kit from BioLegend.
Statistical Analyses
Volcano plots and heat maps were constructed from data generated by nSolver software (NanoString). Other statistics were performed in GraphPad Prism v7.01. Comparisons of three or more groups were performed with the Kruskal-Wallis test followed by Dunn’s multiple test correction. P < 0.05 was considered statistically significant. For histopathological evaluation of stomach sections and quantitation of staining, experimenters were blinded to the treatment groups.
Acknowledgement
The authors wish to acknowledge Savanh Chanthaphavong and Louis Kao for assistance with experimental histopathology and Alicia M. Meyer for assistance with mouse experiments.
Footnotes
Disclosures: the authors declare that no conflict of interest exists.