Skip to main content
bioRxiv
  • Home
  • About
  • Submit
  • ALERTS / RSS
Advanced Search
New Results

The polymicrogyria-associated GPR56 promoter preferentially drives gene expression in developing GABAergic neurons in common marmosets

Ayako Y Murayama, Ken-ichiro Kuwako, Junko Okahara, Byoung-Il Bae, Misako Okuno, Hiromi Mashiko, Tomomi Shimogori, Christopher A Walsh, Erika Sasaki, Hideyuki Okano
doi: https://doi.org/10.1101/2020.10.21.348821
Ayako Y Murayama
1Department of Physiology, Keio University School of Medicine, Tokyo, Japan
2Laboratory for Marmoset Neural Architecture, Center for Brain Science, RIKEN, Wako, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ken-ichiro Kuwako
1Department of Physiology, Keio University School of Medicine, Tokyo, Japan
3Department of Neural and Muscular Physiology, Shimane University School of Medicine, Izumo, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Junko Okahara
2Laboratory for Marmoset Neural Architecture, Center for Brain Science, RIKEN, Wako, Japan
4Center Institute of Experimental Animals, Kawasaki, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Byoung-Il Bae
5Division of Genetics and Genomics, Manton Center for Orphan Disease Research, and Howard Hughes Medical Institute, Boston Children’s Hospital, Boston, MA, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Misako Okuno
2Laboratory for Marmoset Neural Architecture, Center for Brain Science, RIKEN, Wako, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hiromi Mashiko
6Laboratory for Molecular Mechanisms of Brain Development, Center for Brain Science, RIKEN, Wako, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tomomi Shimogori
6Laboratory for Molecular Mechanisms of Brain Development, Center for Brain Science, RIKEN, Wako, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christopher A Walsh
5Division of Genetics and Genomics, Manton Center for Orphan Disease Research, and Howard Hughes Medical Institute, Boston Children’s Hospital, Boston, MA, USA
7Broad Institute of MIT and Harvard, Cambridge, MA, USA
8Departments of Pediatrics and Neurology, Harvard Medical School, Boston, MA, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Erika Sasaki
2Laboratory for Marmoset Neural Architecture, Center for Brain Science, RIKEN, Wako, Japan
4Center Institute of Experimental Animals, Kawasaki, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: esasaki@ciea.jp hidokano@keio.jp
Hideyuki Okano
1Department of Physiology, Keio University School of Medicine, Tokyo, Japan
2Laboratory for Marmoset Neural Architecture, Center for Brain Science, RIKEN, Wako, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: esasaki@ciea.jp hidokano@keio.jp
  • Abstract
  • Full Text
  • Info/History
  • Metrics
  • Preview PDF
Loading

ABSTRACT

GPR56, a member of the adhesion G protein-coupled receptor family, is abundantly expressed in cells of the developing cerebral cortex, including neural progenitor cells and developing neurons. The human GPR56 gene has multiple presumptive promoters that drive the expression of the GPR56 protein in distinct patterns. Similar to coding mutations of the human GPR56 gene that may cause GPR56 dysfunction, a 15-bp homozygous deletion in the cis-regulatory element upstream of the noncoding exon 1 of GPR56 (e1m) leads to the cerebral cortex malformation and epilepsy. To clarify the expression profile of the e1m promoter-driven GPR56 in primate brain, we generated a transgenic marmoset line in which EGFP is expressed under the control of the human minimal e1m promoter. In contrast to the endogenous GPR56 protein, which is highly enriched in the ventricular zone of the cerebral cortex, EGFP is mostly expressed in developing neurons in the transgenic fetal brain. Furthermore, EGFP is predominantly expressed in GABAergic neurons, whereas the total GPR56 protein is evenly expressed in both GABAergic and glutamatergic neurons, suggesting the GABAergic neuron-preferential activity of the minimal e1m promoter. These results indicate a possible pathogenic role for GABAergic neuron in the cerebral cortex of patients with GPR56 mutations.

INTRODUCTION

G protein-coupled receptor 56 (GPR56) is a member of the adhesion G protein-coupled receptor family1,2, and is expressed in multiple tissues including brain, colon, lung, muscle, kidney, pancreas and testis1. In the nervous system, GPR56 is highly expressed in neural progenitor cells, and is also expressed in developing neurons2,3,4,5. Previous studies have clearly demonstrated the crucial roles of GPR56 in cortical development. In the developing brain, neural stem cells proliferate in the ventricular zone (VZ), and their daughter cells migrate along radial glial fibers toward the pial basement membrane, developing into excitatory glutamatergic neurons. Glutamatergic neurons are generated from deep layer (VI) to upper layer (II) in a birthdate-dependent, inside-out manner. In contrast, GABAergic interneurons originate from the VZ of the ganglionic eminence (GE) and migrate tangentially in multiple streams6. Loss of Gpr56 in mice causes many cellular abnormalities in the cerebral cortex, including reduced proliferation of neuronal progenitor cells7, structural aberrations in the radial glial endfeet and pial basement membrane, mislocalization of Cajal–Retzius cells, and overmigration of developing neurons8. Consequently, Gpr56-deficient mice exhibit disorganized cortical lamination and a cobblestone-like malformation8. Collagen III a-1, one of the ligands of Gpr56 expressed in the pial basement membrane, is a key molecule involved in Gpr56-mediated neuronal radial migration in the cortex9. Upon binding of collagen III, Gpr56 associates with Gα12/13 family of G proteins and activates the RhoA pathway in the radially migrating neurons, leading to properly controlled termination of migration9. Gpr56 also plays roles in the proliferation of oligodendrocyte precursor cells and the development and maintenance of peripheral myelin10,11.

Consistent with the defects observed in Gpr56-deficient mice, multiple GPR56 coding mutations in human have been found to cause a devastating cortical malformation called bilateral frontoparietal polymicrogyria, as well as frontal lobe-associated dysfunctions, such as epilepsy2. The human GPR56 gene has at least 17 alternative transcription start sites that may drive transcription of mRNAs with different noncoding first exons; these mRNAs encode identical GPR56 protein with distinct expression profiles in the brain7. A 15-bp deletion within a cis-regulatory element upstream of the transcriptional start site of noncoding exon 1m (e1m) of GPR56 has recently been identified in individuals with polymicrogyria restricted to the regions around the Sylvian fissure7. All patients with this 15-bp deletion suffer from epilepsy from a young age, as well as from intellectual and language difficulties, but without evident motor disabilities. Epilepsy in patients with the GPR56 mutation is often drug-resistant. Recently, Vigabatrin, γ-vinyl-GABA (a structural analogue of GABA), has been reported to be an effective epilepsy treatment for GPR56-mutated patients12. The mechanism of action of Vigabatrin is known to be different from that of GABAAR activators such as benzodiazepines and barbiturates, but other details are unknown. The deleted 15-bp sequence is conserved among placental mammals, suggesting a major regulatory element for GPR56 expression. Given that the patients with the 15-bp deletion in the cis-regulatory element of e1m promoter show a milder and more restricted malformation of the brain compared to patients with coding mutations (which appear to be null mutations), a detailed expression profile of e1m promoter in the cerebral cortex may provide an important insight into the cell types that are responsible for cortical malformation and related symptoms. However, the cell type profile of e1m promoter-driven GPR56 has yet to be characterized.

The common marmoset (Callithrix jacchus) has gained prominence as an experimental animal model in the neuroscience field, due to their human-like behaviors and brain structure13,14,15. Socially, marmosets form a unit of a close-knit family based on a pair of one male and one female, which is not observed in other experimental model primates, and communicates each other closely through vocalization and eye-contact16. In addition, marmoset brain shares structural similarity with human brain, such as the Sylvian fissure and calcarine sulcus, although marmoset is a near-lissencephalic primate17,18,19,20. Furthermore, genetics approaches are available thanks to the generation and successful germline transmission of transgenic marmoset21,22. This technique enables significant advancements potentially useful in the study of neurological and psychiatric disorders13,23.

In the present study, we generated a transgenic marmoset expressing a 0.3-kbp human GPR56 e1m promoter-driven EGFP (enhanced green fluorescence protein) and provide evidence for preferential activity of the e1m promoter in GABAergic neurons in the developing cerebral cortex, whereas the total GPR56 protein is evenly expressed in GABAergic and glutamatergic neurons as well as progenitor cells. These findings imply a possible role for GABAergic neurons in GPR56 mutation-associated epilepsy.

RESULTS

Production of transgenic marmosets expressing EGFP under the control of human GPR56 e1m promoter

To investigate how mutations or deletions within a cis-regulatory element upstream of the e1m of human GPR56 leads to symptoms in patients, we sought to characterize the cells expressing GPR56 under the control of this cis-regulatory element in marmoset. For this purpose, we generated transgenic marmosets expressing enhanced green fluorescence protein (EGFP) driven by the cis-regulatory element. A previous study reported that 0.3 kb sequence upstream of the human e1m acts as a minimum promoter of the GPR56 during embryonic stage7. The relevant human and marmoset sequences share 92.4% identity, while human and mouse sequences share 62.1% identity in this region (Fig. S1). Regarding the 15-bp element, human and marmoset differ by two bases, while human and mouse differ by one base (Fig. S1). We constructed self-inactivating lentiviral vector harboring this 0.3 kb sequence followed by EGFP coding sequence (referred to hereafter as 0.3k hGPR56 e1m-EGFP vector) (Fig. 1A). Marmoset zygotes were obtained by in vitro fertilization (IVF). Forty-one zygotes were injected with high titer lentiviral vector carrying the 0.3k hGPR56 e1m-EGFP, of which 27 (65.9%) developed beyond the 4-cell stage (Table 1). Because the hGPR56 e1m promoter was not active in marmoset preimplantation embryos, the transgene-positive embryos could not be selected by EGFP fluorescence (Fig. S2A), all 27 embryos developed beyond the 4-cell stage were transplanted into 11 recipient females at various developmental stages (Table 1). Five recipient females became pregnant (45.5%) and ultimately two newborns (7.4%. two singletons; one female (I651TgF)) and one male (I757TgM) were delivered naturally at full term (Fig. 1B).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table 1. Summary of production of founder (F0) transgenic marmosets.
Figure 1.
  • Download figure
  • Open in new tab
Figure 1. Generation of 0.3k hGPR56 e1m-EGFP transgenic marmosets.

(A) Schematic diagram of the lentiviral vector. CMV; Cytomegalovirus promoter, ψ; packaging signal, RRE; rev responsive element, cPPT; central polypurine tract, WPRE:Woodchuck hepatitis virus Posttranscriptional Regulatory Element, hGPR56; 0.3-kbp human GPR56 e1m cis-element (minimal promoter). (B) The transgenic founder infants; I651TgF (female) and I757TgM (male). (C) Detection of genomic integration of transgene by genomic PCR. EGFP encoding sequence was amplified using template genomic DNA purified from hair cells of or placentas delivered with infants. Beta-actin amplifications were used as control. (D) Detection of transgene expression by RT-PCR. EGFP encoding sequence was amplified from cDNA templates prepared from RNAs purified from hair cells or placentas delivered with them with (RT+) or without (RT−) reverse transcriptase. Beta-actin amplifications were used as control.

Transgene integration in the genome

We first examined the genomic integration of the transgene in the infant marmosets. The presence of transgene was tested by PCR using genomic DNA purified from placenta delivered with I651TgF and I757TgM and hair roots of I651TgF and I757TgM. Integrated transgene was detected in all samples (Fig. 1C). Furthermore, EGFP transcripts were detected in hair cells of both infants and in placenta delivered with I651TgF, but not in placenta delivered with I757TgM (Fig. 1D). To identify the chromosomal transgene integration sites, fluorescence in situ hybridization (FISH) was performed. There were 27 transgene integration sites on chromosomes 1, 2, 3, 4, 9, 10, 11, 13, 15, 17, 18, 21 and 22 in the peripheral blood cells of I651TgF, while I757TgM had 13 transgene integration sites on chromosomes 1, 2, 4, 6, 7, 11, 13, 15, 16 and 17 (Fig. S2B). These results indicate that I757TgM and I651TgF are transgenic marmosets harboring functional 0.3k hGPR56 e1m-EGFP transgene in their genome.

Germline transmission of the transgene

After sexual maturation, the female animal (I651TgF) was mated with a non-transgenic male and 19 embryos were obtained by uterine flushing. Sixteen of these were transferred into eight surrogate mothers(Table 2), and then three F1 fetuses at E95, two at E113, and one at E126 were obtained by caesarean section. EGFP fluorescent signals were detected in all fetuses (Fig. 3A, Fig. 4A, Fig. S3A, B), implying that transgenes were transmitted through oocytes of I651TgF. As for I757TgM, the presence of transgene was detected in the sperm sample by genomic PCR (Fig. S3C). On the other hand, we paired the male transgenic marmoset, I757TgM, with wild-type female and performed uterine flushing to obtain embryos. Although the sperm concentration and motility were normal in the semen of I757TgM, no zygotes were obtained from the I757TgM line for unknown reasons (Table 2).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table 2. Summary of embryo production from F1 transgenic marmosets.
Figure 2.
  • Download figure
  • Open in new tab
Figure 2. Expression of GPR56 mRNA in the brain of wild type marmoset embryo.

(A) Coronal sections of transgenic marmoset brain at the fourteenth embryonic week (EW) were hybridized with anti-sense (a-e) or sense probe (c) for GPR56 mRNA. Cerebral cortex (Cx), caudate nucleus (Cd), ventricular zone of the caudate (vCd), subventricular zone of the caudate (svCd), thalamus (Th), hippocampus (HIP), pons, midbrain (MB), ventricular zone (VZ), inter subventricular zone (iSVZ), outer subventricular zone (oSVZ), and intermediate zone (IZ) are indicated. Scale bars =1 mm. (B) Enlarged image of the area marked by a square in panel b in (A). (C) Enlarged image of the area marked by a square in panel d in (A). Scale bar in B and C = 200 μm.

Figure 3.
  • Download figure
  • Open in new tab
Figure 3. Expression of hGPR56 e1m-driven EGFP in transgenic marmoset embryo.

(A) EGFP signals in the Dorsal view (a-c), ventral view (d-f), lateral view (g-i), and median view (j-l) of the whole brain of wild type (left panels) and transgenic marmoset (middle and right panels) at E95. Thalamus (Th), hypothalamus (Hy), midbrain (MB), cerebellum (Cb), medulla oblongata (MO), cerebral cortex (Cx), and olfactory bulb (OB) are shown. (B) Immunofluorescent staining of coronal sections from the anterior to posterior (d) of the transgenic marmoset brain (E95) for EGFP. Lines on the schema indicate the position of each section. Cingulate gyrus (CG), early caudate (Cd), early putamen (Pu), hippocampus (HIP). Scale bars in A and B = 1 mm. (C) Coronal section of cerebral cortex of the transgenic marmoset brain (E95) stained for DNA (Hoechst) and EGFP. Cortical plate (CP), subplate (SP), IZ, oSVZ, iSVZ, and VZ are indicated. Scale bar = 200 μm. (D) Enlarged image of the area marked by a square in the panel of (B), with indication for Cd, ventricular zone of Cd (vCd), and subventricular zone of Cd (svCd).

Figure 4.
  • Download figure
  • Open in new tab
Figure 4. hGPR56 e1m-EGFP expression in the cerebral cortex.

(A) Immunofluorescent staining of coronal sections from the anterior (a) to posterior (e) of the transgenic marmoset brain at E113 for EGFP (green) and pan-GPR56 (magenta). Lines on the schema indicate the position of each section. Scale bar = 1mm. (B) Coronal section of cerebral cortex of the transgenic marmoset brain at E113 stained for Hoechst (Blue), hGPR56 e1m-EGFP (green), and pan-GPR56 (magenta), CTIP2 or GABA (cyan). The section stained for CTIP2 is the one 50 μm anterior to the other sections. Cortical plate (CP) consisting of layers I to VI, SP, IZ, oSVZ, iSVZ, and VZ are indicated. Scale bar = 200μm. (C) Distribution of GPR56 (magenta), hGPR56 e1m-EGFP (green), and CTIP2 or GABAs (cyan) positive cells in layer V of the cortical plate. Representative hGPR56 e1m-EGFP positive cells with (filled arrowheads) or without (open arrowheads) expression of CTIP2 or GABAs are marked. The panels furthest to the right display orthogonal views of a hGPR56 e1m-EGFP positive cell marked by the arrow. Orthogonal views of other hGPR56 e1m-EGFP positive cells are shown in Figure S5A. We used ZEN 2009 software (version: 6.0.0.303, Carl Zeiss, Oberkochen, Germany) to construct orthogonal views. Scale bar = 50 μm. (D) Ratio of hGPR56 e1m-EGFP positive cells in each CP layer of transgenic marmoset no.1 and no.2. (E) Ratio of CTIP2+ or GABA+ cells among the hGPR56 e1m-driven EGFP+ cells in layer V of transgenic marmosets no.1 and no.2. (F) Ratio of CTIP2+ or GABA+ cells among the pan-GPR56+ cells in layer V of transgenic marmosets no.1 and no.2.

Expression pattern of endogenous GPR56 and 0.3k hGPR56 e1m-driven EGFP in the embryonic brain

GPR56 is expressed in various tissues including brain in human and mouse7. We confirmed broad expression of GPR56 in embryonic marmoset brain by in situ hybridization. At the 10th, 12th and 14th embryonic week (EW), strong GPR56 signals were detected in VZ, mainly consisting of neural stem cells. At the 14th EW, GPR56 was also strongly expressed in outer subventricular zone (oSVZ), where the highly proliferative progenitor cells called basal radial glia reside (Fig. 2 and Fig. S4) 24,25,26. These results suggest abundant GPR56 mRNA expression in immature neural cells.

In the F1 fetus brain at E95, 0.3k hGPR56 e1m-driven EGFP protein expression was observed in restricted areas, such as thalamus, hypothalamus, midbrain, cerebral cortex (Fig. 3A). In order to determine the EGFP expression pattern in more detail, we prepared brain slices from E95 transgenic marmoset embryos in the coronal plane and stained them with anti EGFP antibody. The signals were mainly detected in cerebral cortex, cingulum, early caudate nucleus, early putamen, hippocampus, and hypothalamus (Fig. 3B). In the cerebral cortex, EGFP signals were found in a subpopulation of cells in the cortical plate, as well as in most of the nerve fibers in the subplate and intermediate zone (Fig. 3C). Interestingly, only a few EGFP-positive cells were sparsely distributed in inner subventricular zone (iSVZ) and oSVZ in the cerebral cortex and subventricular zone of the early caudate nucleus and no EGFP-positive cell was found in VZ in the cerebral cortex or VZ of the early caudate nucleus (Fig. 3D), despite the high expression of endogenous GPR56 mRNA in these zones (Fig 2). Taken together, these results suggest that 0.3k hGPR56 e1m contains a cis-element that promotes predominant expression of GPR56 in the GE and in a subset of developing neurons in the cortical plate of the marmoset fetus brain.

EGFP expressed predominantly in GABAergic neurons

To determine the cell types that express 0.3k hGPR56 e1m-driven EGFP in developing cortex, we performed immunohistochemistry with the cerebral sections at E113, as all layers in CP became distinguishable at this developmental stage. We first confirmed the reactivity of anti-pan-GPR56 antibody with marmoset GPR56 by immunofluorescence using COS cells expressing marmoset GPR56 (Fig. S5). Then, we stained coronal sections with anti-EGFP and anti-pan-GPR56 antibodies and overviewed the sections from rostral to caudal. Similar to at stage E95, EGFP signals were mainly detected in cerebral cortex, cingulum, caudate nucleus, putamen, globus pallidus, hippocampus, hypothalamus and cerebellum, while the pan-GPR56 signals were also strongly observed in VZ and oSVZ (Fig. 4A and 4B). In the cortical plate, 89.6%±1.1(mean±SEM) of the EGFP positive cells (1278 cells in the 10 sections derived from 2 embryos) were positive for pan-GPR56 staining. Next, we examined the distribution of EGFP-positive cells in each cortical layer of two transgenic marmosets, no.1 and no.2. EGFP-positive cells were detected in all layers at various ratios, and were most abundant in the layer V (Fig. 4D and Table S1). We evaluated the ratio of excitatory and inhibitory neurons among EGFP-positive cells by staining GABA and CTIP2, markers for GABAergic inhibitory neurons and for glutamatergic excitatory neurons in deep layer (layer V and VI) 27, respectively (Fig. 4B, 4C, 4E, 4F, Fig. S6 and Table S2). In layer V of E113 marmosets, on average, 70.0% and 28.1% of 0.3k hGPR56 e1m-driven EGFP cells were GABA-positive and CTIP2-positive, respectively (Fig. 4E and Table S2). In contrast, among pan-GPR56 positive cells in layer V of marmosets at E113, 40.3% and 49.1% on average were GABA-positive and CTIP2-positive, respectively (Fig. 4F and Table S2). These results suggest that the hGPR56 e1m drives protein expression preferentially in GABAergic neurons rather than glutamatergic neurons in layer V. In other layers of cortical plate, EGFP-positive cells contained a higher percentage of GABAergic neurons than pan-GPR56 positive cells (Fig. S7, Table S3 and S4). At E89, an earlier stage, pan-GPR56 positive cells included almost all Nkx2.1 positive progenitor cells in presumptive MGE (medial ganglionic eminence), from which GABAergic neurons originate (Fig. S8A)28. At E95, EGFP positive migrating neurons were observed beneath and within the intermediate zone (Fig. S8B). These findings are consistent with the fact that hGPR56 e1m drives protein expression preferentially in GABAergic neurons. Furthermore, we examined the subtype of the EGFP-positive GABAergic interneurons by analyzing the expression of the principal subtype markers, such as parvalbumin (PV), somatostatin (SST), or calretinin (CR) (Fig. 5A). Of the EGFP-expressing cells in layer V, 50.0% (n=152) on average was PV-positive, 20.0% (n=236) was SST-positive, and 21.9% (n=321) was CR-positive neuron (Fig. 5B and Table S5). While at E113, PV-positive, SST-positive, and CR-positive neurons were found at 34.7% (n=471), 9.2% (n=218), and 10.6% (n=405) of whole cells in layer V, respectively (Fig. 5C and Table S6). These results suggest that the subtype distribution PV:SST:CR among EGFP-positive cells in layer V did not differ significantly from that of the entire cell population in layer V. Taken together, we conclude that cis-element within a hGPR56 e1m region contributes to promote GPR56 expression in broad subtypes of GABAergic neurons.

Figure 5.
  • Download figure
  • Open in new tab
Figure 5. Subtype marker expression in the hGPR56e1m-EGFP positive GABAergic interneurons.

(A) Distribution of hGPR56e1m-EGFP and PV, SST or Calretinin in the cortical plate of the transgenic marmoset brain (E113). Scale bar = 1 mm. Enlarged images of the area marked by rectangles in top panels are shown in the lower panels. The dashed ellipses indicate the positive cells of each subtype marker of GABAergic neuron. Scale bars = 50 μm. (B) Ratio of PV+, CR+, or STT+ cells among the hGpr e1m-driven EGFP+ cells in the layer V of transgenic marmoset no.1 and no.2. (C) Ratio of PV+, CR+, or STT+ cells among the cells in the layer V of transgenic marmoset no.1 and no.2.

DISCUSSION

In this study, we examined the role of human GPR56 e1m minimum promoter by using marmoset as a nonhuman primate model. We developed transgenic marmosets in which EGFP is expressed under the control of human GPR56 e1m minimum promoter, and examined the profile of EGFP positive cells, especially within the cerebral cortex. In developing marmoset brain, 0.3k hGPR56 e1m-EGFP showed restricted expression pattern within the endogenous GPR56 expressing regions. While endogenous GPR56 expressed in immature cells including neural stem cells and progenitors, 0.3k hGPR56 e1m-EGFP expression was rarely detected in such immature cells but detected mainly in developing neurons. These results are consistent with the expression patterns of endogenous mouse Gpr56 and 0.3k hGPR56 e1m-driven reporter gene in the transgenic mice7. We further showed that EGFP in layer V was preferentially expressed in GABAergic neurons. It is well known that, in the developing brain, the anti-CTIP2 antibody preferentially labels a relatively narrow population of cells in layer V of the cerebral cortex. Our present study showed that EGFP+ cells in layer V contained a higher percentage of GABAergic neurons and a lesser percentage of CTIP2+ cells than pan-GPR56+ cells, where the summed percentage of CTIP2+ cells and GABA+ cells was similar (about 90%) to the EGFP+ cells in layer V (Fig. 4E and F). Our data indicates that, even if all of the GABA− EGFP+ cells in layer V were glutamatergic neurons, EGFP+ cells should contain a higher percentage of GABAergic neurons than that of glutamatergic neurons in layer V (Fig. 4E). GPR56 is classified into adhesion GPRs29 that are involved in cell proliferation and migration in the developing brain. Among the genes that mainly contribute to the cell migration of neocortex, homeobox transcription factor DLX families and ARX, which is regulated under DLX, are also involved in differentiation of GABAergic inhibitory neurons at embryonic stages30,31. Similar to the case for DLX and ARX, our result suggested that GPR56 expression regulated under the control of the e1m minimal promoter may also contribute to migration and development of GABAergic neurons.

We examined the distribution of principle each subtypes of GABAergic interneurons among the 0.3k hGPR56 e1m-EGFP positive neurons, and showed that the ratio of PV-positive cells was about two times higher than those of SST-or CR-positive cells. These ratios are roughly consistent with those among the GABAergic neurons in marmoset cortical layer V (Fig. 5B and C). Therefore, it appears that e1m cis-element drives GPR56 expression in GABAergic neurons irrespective of subtype. This may indicate that GPR56 driven by e1m cis-element plays a role in the earlier development of GABAergic neuron before its subtype determination32. Taken together, our results support the idea that 15bp deletion within e1m cis-element may reduce the expression of GPR56 in GABAergic neurons in human developing brain.

The preferential expression of e1m-driven EGFP in inhibitory interneurons, and in the early developing ganglionic eminence and later early caudate nucleus is most simply explained by the observation that most inhibitory interneurons originally derive from the several GE’s, including the medial, caudal, and lateral ganglionic eminences. Thus, the e1m element may drive EGFP expression in the progenitor cells of interneurons in the GE during development, as well as in the inhibitory interneurons derived from these structures. In fact, studies in mice suggest that disruption of the e1m element causes a prominent loss of expression in developing GE7, consistent with some of our observations here. On the other hand, mutation of the e1m element in mice also disrupts transgene expression in lateral cerebral cortical cells as well, which is less well illustrated by our marmoset transgene. The splice structure of GPR56 is quite dynamic between mouse and primates, and some of these changes may be responsible for these species differences; alternatively they may reflect technical differences in the precise elements of the transgenes used. Since the anti pan-GPR56 antibody recognizes all of the GPR56 isoforms, it is expected that all EGFP-positive cells would also be labeled with the panGPR56 antibody. Indeed, nearly 90% of the EGFP positive cells were positive for pan-GPR56 staining. The remaining EGFP positive cells were negative for the pan-GPR56 signal. This could be explained by the difference in sensitivity between anti-GFP and anti-panGR56 antibodies, although some other regulatory elements may be required to fully recapitulate endogenous marmoset GPR56 gene expression. Until now, only a few genes have been found, in which mutations in non-cording regions cause epilepsy. For example, the product of SCN1A gene is voltage-gated sodium channel Nav1.1 that expresses in GABAergic neuron33,34,35. Mutations in its promoter region are reported to reduce SCN1A transcription, which causes SCN1A haploinsufficiency. Accordingly, the reduced sodium currents in GABAergic inhibitory neurons may cause hypoexcitability of inhibitory neurons, leading to epilepsy36. It is unclear how the deletion within the hGPR56 e1m non-coding region led to epilepsy. An attractive hypothesis would be that, in the case of GPR56, the 15-bp deletion in the cis-regulatory element upstream of the non-coding exon 1m produces intact GPR56 protein7, but leads to inaccurate temporal and/or spatial expression of GPR56 in GABAergic neurons along with any potential effects on the development of glutamatergic neurons. Dysfunction of GABAergic neuron development is frequently associated with epilepsy such as with mutations in DLX and ARX30,31. In human, exon 1m of GPR56 gene is highly expressed in fetal brain compared to the adult brain7. Therefore, pathogenic mechanisms of epilepsy associated with patients with a 15-bp deletion within e1m region may be explained in part by the developmental abnormality or dysfunction of GABAergic neurons. Indeed, vigabatrin, a GABA-transaminase inhibitor that is used as a antiepileptic drug, has been reported to relieve symptoms in patients with mutations in GPR56 gene12. Further understanding of the function of GPR56 in GABAergic neurons will help to reveal the precise pathogenic mechanism of epilepsy associated with mutations of GPR56 gene.

Methods

Animals

Experimental procedures were approved by the Animal Care and Use Committees of RIKEN (H30-2-214(3)) and CIEA (11028, 14029, and 15020), and were performed in accordance with their guidelines. Adult common marmosets were obtained from marmoset breeding colonies in CIEA and RIKEN for experimental animals.

Plasmid constructs and lentiviral production

To construct the 0.3k hGPR56 e1m-EGFP lentivirus vector plasmid, human GPR56 e1m promoter (0.3k hGPR56 e1m) was obtained from the plasmid pGL3E-hGPR56 e1m-LacZ7. CMV promoter sequence of the lentiviral backbone vector, pCS-CDF-CG-PRE (RDB04379, RIKEN, Tsukuba, Japan; a gift from Hiroyuki Miyoshi), was replaced with the 0.3k hGPR56 e1m promoter. Packaging plasmids, pCAG-HIVgp (mRDB04394) and pCMV-VSV-G-RSV-Rev (RDB04393), were also gifts from Hiroyuki Miyoshi. Lentiviral vector was produced following previously described procedures37. In particular, we transfected 30 μg of 0.3 k hGPR56 e1m-EGFP plasmid along with 20 μg HIVgp and 20 μg VSV-G-RSV-Rev packaging plasmids into semi-confluent HEK293T cells in a T175 flask coated with poly-ornitine, using GeneJuice Transfection Reagent (Merck Millipore) according to the manufacturer’s instructions. Six to twelve hours after the transient transfection and the culture at 37° C in a 5% CO2 incubator, the medium was replaced with 30 ml FreeStyle 293 Expression Medium (Thermo Fisher Scientific). After 3 days, the culture supernatant containing viral particles was collected, filtered through a membrane with a 0.22 μ m pore size (EMD Millipore, Darmstadt, Germany), and concentrated by ultracentrifugation at 25,000g for 2 hours at 4°C. The viral pellet was then resuspended in 10 μl of ISM1.

In vitro fertilization, early embryo collection, and transplantation

In vitro fertilization (IVF) was performed as previously described21,22. Donor females’ ovaries were stimulated by intramuscularly injected with human follicle-stimulating hormone (rhFSH, 25IU; FOLYRMON-P injection, Fuji Pharma Co, Tokyo, Japan) for nine days and human chorionic gonadotropin (hCG, 75IU; Gonatropin, ASKA Pharmaceutical Co, Tokyo, Japan) intramuscular injection on day ten then oocytes were collected via follicular aspiration. Collected oocytes were incubated for 24 h at 38°C, 5% CO2, 90% N2 for in vitro maturation. After incubation, only matured oocytes (metaphase II) were collected and used for IVF. Ejaculated semen was collected non-invasively as described previously38. One-cell stage fertilized embryos with two pronuclei were placed in 0.25 M sucrose supplemented PB1 medium (LSI Chemical Medience Corporation, Tokyo, Japan) and the viruses were injected into the perivitelline space using an Eppendorf FemtoJet Express and a Narishige micromanipulator. After cultured beyond 4-cell stage, embryos were transferred to recipient females that had been paired with vasectomized males. After embryo transfer, the recipients were monitored for pregnancy by measuring their plasma progesterone until the pregnancies could be monitored by ultrasound through an abdominal wall.

Caesarean section

To collect transgenic fertilized embryos from transgenic female I651TgF, subjected to embryo transfer, were paired with intact males for natural embryo collection by nonsurgical uterine flushing. To obtain transgenic embryos at stages E95, 113 and 126, Caesarian Sections were performed in a similar manner as previously described39. The pregnant mothers were pre-anesthetized with 0.04 mg/kg medetomidine (Domitor; Nippon Zenyaku Kogyo, Fukushima, Japan), 0.40 mg/kg midazolam (Dormicam; Astellas Pharma Inc, Tokyo, Japan) and 0.40 mg/kg butorphanol (Vetorphale; Meiji Seika Pharma Co, Tokyo, Japan). For maintenance anesthesia during the operation, animals were inhaled 1-3% isoflurane (Forane; Abbott Japan, Tokyo, Japan) via a ventilation mask. After the operation, 0.20 mg/kg antisedan (Atipamezole; Nippon Zenyaku Kogyo, Fukushima, Japan) was injected as an α2 adrenergic receptor antagonist. On the other hand, to obtain wild type embryos, caesarian sections were performed as previously described26. The pregnant mothers were intramuscularly injected with 10 μg/head of atropine sulfate (0.5 mg/ml; Mitsubishi Tanabe Pharma Corporation, Osaka, Japan) followed by with 10 mg/kg of ketamine hydrochloride (Daiichi Sankyo, Tokyo, Japan). 1-3% isoflurane was used for maintenance anesthesia. The embryo and placenta were removed from the uterine by midline laparotomy and then the uterus, abdominal muscles, and skin were sutured. Embryos were anesthetized on ice deeply, dissected in PBS, and the whole brain was removed from the skull.

Genomic PCR

Genomic DNA was extracted from tissues of wild type (negative control), CMV-EGFP transgenic (positive control) and 0.3k hGPR56 e1m–EGFP transgenic marmosets using AllPrep DNA/RNA Micro Kit (QIAGEN, Hilden, Germany). For sperm genomic PCR, the CMV-EGFP plasmid (pEGFP; Clontech, CA, USA) was used as a positive control, and the genomic DNA extracted from marmoset ES cells was used as a negative control. They were subject to PCR for transgene detection using the EGFP5-4 (5’-CAAGGACGACGGCAACTACAAGACC-3’) and EGFP3-3es (5’-GCTCGTCCATGCCGAGAGTGA-3’) primers. To detect ß-actin gene, nested PCR was carried out using the first primer set ß-actin 003 (5’-TGGACTTCGAGCAGGAGAT-3’) and ß-actin 006R (5’-CCTGCTTGCTGATCCACATG-3’). PCR was performed for 35 cycles of denaturation at 98 °C for 10 sec, annealing at 65 °C for 10 sec, and elongation at 72 °C for 30 sec.

RT–PCR

To detect the transgene expression, total RNA was prepared from each tissue and was reverse-transcribed by the SuperScript III First-Ftrand Synthesis System (Thermo Fisher Scientific). PCR was performed using the EGFP5-4 (5’-CAAGGACGACGGCAACTACAAGACC-3’) and EGFP3-3es (5’-GCTCGTCCATGCCGAGAGTGA-3’) primers to detect EGFP gene expression in the tissues, as previous described21. To detect ß-actin expression for internal transcript control, the nested PCR was carried out using the first primer set ß-actin 003 (5’-TGGACTTCGAGCAGGAGAT-3’) and ß-actin 006R (5’-CCTGCTTGCTGATCCACATG-3’). All PCR was performed for 35 cycles of denaturation at 98°C for 10 sec, annealing at 65°C for 10 sec, and elongation at 72°C for 30 sec.

Karyogram analysis

Fluorescent in situ hybridization (FISH) was performed as previously reported (Sasaki et al., 2009) (Chromosome Science Labo Inc, Sapporo, Japan). Peripheral blood samples were obtained from each founder animals. DNA fragment corresponding to a part of the 0.3k hGPR56 e1m-EGFP was used to produce Cy3-dUTP-labelled probe by the Nick translation method. The common signals among many cells were determined as the insertion sites of hGPR56 e1m-EGFP DNA.

in situ hybridization

To generate hybridization probe, about 500 bp cDNA fragment corresponding to 3’ non-coding region of marmoset GPR56 mRNA was PCR amplified using a cDNA pool derived from marmoset embryonic brain as a template and a set of primers, 5’-ATTCCAATGCTATTTTGCGGGACGTG-3’ and 5’-CAGTTTGTTAGGCAATAACAACAG-3’. Single-color chemiluminescence in situ hybridization (ISH) was performed as previously described40. The embryonic brains were drop-fixed in 4% PFA in 100 mM sodium phosphate buffer (PB) pH 7.4 at 4°C more than 24 hours, then replaced into 30% sucrose in 4% PFA in PB. Sections at 40 μm thickness by microtome (Leica, Wetzlar, Germany) were mounted on glass slides and fixed in 4% PFA in PBS for 15 min at room temperature (RT), and treated with proteinase K (Roche, Basel, Switzerland) for 30 min at 37°C. Sections were then fixed again and hybridized with digoxigenin (DIG)-labeled probes (Roche, Basel, Switzerland) at 72°C overnight in hybridization solution (50% formamide, 5xSSC, 1% SDS, 500μg/ml yeast tRNA, 200 μg/ml acetylated BSA, and 50 μg/ml heparin). After washing out excess probe, sections were blocked with 10% lamb serum in TBST for 1 hour at RT and incubated with alkaline phosphatase conjugated to DIG antibody (Roche, Basel, Switzerland) in TBST. Color was developed with a combination of 3.5 mg/ml chromagens nitroblue tetrazolium (Nacalai, Kyoto, Japan) and 1.75 mg/ml 5-bromo-4-chloro-3-indolylphosphate (Nacalai, Kyoto, Japan) in NTMT (100 mM NaCl, 100 mM Tris-HCl (pH 9.5), 50 mM MgCl2, 1% Tween 20). Images were taken with an Olympus VS-100 virtual slide system with a 10x objective lens or with a KEYENCE digital microscope, BZ-X700, with a 4x objective lens.

Transfection and immunocytochemistry

To clone the cDNA of marmoset GPR56, marmoset cDNA library was generated. Total RNA was prepared from marmoset brain and was reverse-transcribed by the SuperScript III First-Ftrand Synthesis System (Thermo Fisher Scientific). Marmoset GPR56 cDNA was amplified by PCR using the primer set marGPR56 5’ end (f)-ATGACTGCCCAGTGCCTCCT and marGPR56 3’ end (r)-GATGCGGCTGGACGAGGTGCT and then re-amplified using the primers marGPR56 HindIII kozak (f)-CCCAAGCTTGCCACCATGACTGCCCAGTGCCTCCT and marGPR56 SpeI 1xHA (r)-GGACTAGTTTAAGCGTAATCTGGAACATCGTATGGGTAGATGCGGCTGGACGAGGTGCT and subcloned into the pCAG-neo. 0.2 μg of the resulting hemagglutinin (HA)-tagged marmoset GPR56 expression vector (pCAG-neo-1xHA-GPR56) was transfected into COS-7 cells cultured in a well of 8 well chamber slide glass using GeneJuice Transfection Reagent (Merck Millipore) according to the manufacturer’s instructions, and the cells were cultured at 37°C in 5% CO2 incubator for 27 hrs. Immunostaining was performed as previously described41. Briefly, cultured cells were fixed with 4% PFA-PBS for 20 min at 4°C. The fixed cells were permeabilized with 0.3% Triton X-100-PBS for 15 min at room temperature (RT), incubated with TNB blocking buffer (PerkinElmer) for 1 hr at RT and subsequently incubated with primary antibodies: pan-GPR56 (clone H11) (Millipore MABN310, 1:150) and HA-Tag (3F10) (Merck AB_2314622, 1:1000) overnight at 4°C, followed by incubation with fluorescent-dye-conjugated secondary antibodies: goat secondary antibodies coupled to Alexa 488 (Molecular Probes, 1:200) or Alexa 555 (1:400) for 1.5 hr at RT. Nuclei were counterstained with Hoechst 33258 (10 mg/ml, Sigma-Aldrich). Images were acquired by Carl Zeiss LSM700 confocal microscope using Plan-Apochromat 20x/0.8 M27 objective (Zeiss, 420650-9901), C-Apochromat 63x/1.2W Korr UV-VIS-IR M27 objective (Zeiss, 421787-9970).

Immunohistochemistry and image acquisition

After dissection, the whole brains were immediately put into 4% PFA in 120mM PB for 24 hours at 4°C, and then were replaced into 30% sucrose in PB at 4°C. After slicing them 50 μm thick with a microtome, immunofluorescence was performed as follows. Antigen retrieval was performed in 0.01 M sodium citrate buffer (pH 6.0) supplemented with 10% (vol/vol) glycerol for 30 min at 85°C, and the samples were left for 30 min back to RT Sections were then washed in PBS, permeabilized in 0.3% Triton-X 100 (wt/vol) in PBS for 30 min at RT, and blocked by TN Blocking buffer (TSA Plus Fluorescence System; PerkinElmer, MA, USA). Primary antibodies were incubated for more than 18 hr at 4°C, and the secondary antibodies were incubated overnight at 4°C.

The following primary antibodies were used: rat monoclonal antibodies to CTIP2 (Abcam ab18465 (25B6), 1:200), somatostatin (Millipore MAB354, 1:50); rabbit polyclonal antibodies to GABA (SIGMA A2052, 1:200), calretinin (Abcam ab16694, 1:100), somatostatin (Abcam ab108456, 1:100), NMDAR1 (Abcam ab17345, 1:100); rabbit monoclonal antibody to TTF1/Nkx2.1 (Abcam ab76013 (clone EP1584Y), 1:100); mouse monoclonal antibodies to pan-GPR56 (Millipore MABN310 (clone H11, IgG1), 1:150); goat polyclonal antibodies to GFP (Rockland 600-101-215, 1:300), Parvalbumin (Swant, 1:600); chick polyclonal antibody to GFP (Aves GFP-1020, 1:300). Donkey or goat secondary antibodies coupled to Alexa 488, Alexa 555 or Alexa 647 were used (Molecular Probes, 1:400). For antibodies against GFP56 and Parvalbumin, TSA Plus Fluorescence System (PerkinElmer, MA, USA) was used to enhance the signal. All sections were counterstained with Hoechst33258 (Sigma, 1:1000). Sections were mounted in PermaFluor (Thermo Fisher Scientific) and kept at 4°C. The images were acquired by Carl Zeiss LSM700 confocal microscope using a Plan-Apochromat 10X/0.45 M27 objective (Zeiss, 420640-9900), C-Apochromat 63x/1.2W Korr UV-VIS-IR M27 objective (Zeiss, 421787-9970), and α Plan-Apochromat 100x/1.46 Oil DIC M27 objective (Zeiss, 440782-9800). We used ZEN 2009 software (version: 6.0.0.303, Carl Zeiss, Oberkochen, Germany) to acquire z-stack images with a z-interval of either 1–6 μm (10x) or 0.5–1.05 μm (63x, 100x). Section images were taken by an automatic tiling scan system. The images were processed by image J (version: 2.0.0-rc-69/1.52p, U.S. National Institute of Health) and Photoshop CS6 (13.0.6×64, Adobe Inc., CA, USA).

Determination of layers in the cerebral cortex and cell counting

Each zone in cerebral cortex was defined by the density and direction of nuclei stained with Hoechst 33258 as previously reported26. Moreover, in the cortical plate, each layer was defined by the stained patterns of Hoechst 33258 and pan-GPR56 (clone H11). Layer I was identified as a cell-sparse layer. Layer II was identified by radically aligned nuclear packing. The nuclei in layer III also exhibited radial morphology but sparsely rather than in layer II. Layer IV was defined as a densely packed cell layer. Layer V was defined as a relatively cell-sparse layer between the layer IV and VI, and by the expression pattern of CTIP2, which is known to express at high levels in neocortical neurons of layer V27. VI was identified as a cell-dense layer located beneath the V. For the identification and quantification of the labeled cells, cell counts were done manually. We first checked 10–13 z-sections within a z-stack of each single channel image and manually marked positive cells on the z-projected image. Then, two z-projected images were merged, and the numbers of overlapping marks were counted as double positive cells. Cell counting was confined to the dorsolateral telencephalon.

Author Contributions

A.Y.M. designed the research, conducted the experiments, and wrote the manuscript. K.K., J.O., M.O., and H.M. contributed to the experiments. K.K. and B.I.B. edited the manuscript. T.S. and E.S. conducted experiments. C.A.W., E.S. and H.O. supervised and edited the manuscript.

Competing interests

The authors declare no competing financial interests.

Supplementary Information

Supplementary Figure S1.
  • Download figure
  • Open in new tab
Supplementary Figure S1.

Alignment of 0.3 Kbp e1m sequence of human, marmoset, and mouse. Bases that differ from human sequence are shown in black. The percentages at the end of each sequence indicate the identity to the human sequence. The 15-bp elements are enclosed in orange squares.

Supplementary Figure S2.
  • Download figure
  • Open in new tab
Supplementary Figure S2.

(A) Bright field images of marmoset early embryos cultured in vitro for 2 (a), 4 (b), 6 (c), or 7 (d) days after lentivector infection. (e) The image of green fluorescence field of (c). hGPR56 e1m promoter did not work 7-day cultured early embryos. Scale bar = 100 μ m. (B) Genome integration analysis by fluorescence in situ hybridization. The karyograms were prepared from the peripheral blood cells of each founder marmosets, I651TgF and I757TgM. Two sets of the chromosomes from each marmoset are shown as the representatives; #005 and #007 from I651TgF. #0008 and #022 from I757TgM.

Supplementary Figure S3.
  • Download figure
  • Open in new tab
Supplementary Figure S3.

(A) Brains of the E95 fetuses (no.2 and no.3) derived from I651TgF were observed for EGFP fluorescence. Lateral view of the whole brain is shown. Frontal lobe (FL), temporal lobe (TL), cerebral cortex (Cx), midbrain (MB), cerebellum (Cb) and olfactory bulb (OB) are indicated. Scale bar = 1 mm. (B) EGFP fluorescence (green) and immunohistochemistry for GFP (magenta) of the cerebral cortex at E126. DNA was counterstained with Hoechst (blue). Scale bar = 50 μm. (C) Detection of genomic integration of transgene by genomic PCR. Genomic DNA prepared from sperm of I757TgM or wild-type marmoset ES cells (negative control), and pEGFP plasmid (positive control) was used as a template.

Supplementary Figure S4.
  • Download figure
  • Open in new tab
Supplementary Figure S4.

Expression of GPR56 mRNA in the brain of wild type marmoset embryo. Coronal sections of marmoset brain at the (A) 10th and (B) 12th embryonic week (EW) are hybridized with anti-sense probe for GPR56 mRNA. Scale bar = 1 mm. Lines on the schema indicate the position of each section.

Supplementary Figure S5.
  • Download figure
  • Open in new tab
Supplementary Figure S5.

COS cells transfected with HA-tagged marmoset GPR56 expression vector were fxed and stained with anti HA-Tag antibody (magenta), anti pan-GPR56 antibody (green), and Hoechst (blue). Scale bar = 50 μm.

Supplementary Figure S6 (related to Figure 4C).
  • Download figure
  • Open in new tab
Supplementary Figure S6 (related to Figure 4C).
  • Download figure
  • Open in new tab
Supplementary Figure S6 (related to Figure 4C).

(A) Orthogonal views of hGPR56 e1m-EGFP positive (magenta) and pan-GPR56 positive (green) cells in Figure 4C, excluding the one whose orthogonal view image is shown in Figure 4C. Upper (a) and Lower (b) pannels correspond to the Figure 4C a and b, respectively. The left most panels are identical to the GPP panels shown in Figure 4C, but e1m EGFP positive cells are numbered. The cell No. 1 is identical to the cell marked by the arrow in Figure 4C. Z-stack position of each orthogonal view panels is shown in parenthesis. Asterisk indicates blood vessel. (B) Serial z-sections showing the expression of each marker. Orthogonal views and serial z-sections were obtained using ZEN 2009 software (version: 6.0.0.303, Carl Zeiss, Oberkochen, Germany). Scale bars = 10μm.

Supplementary Figure S7.
  • Download figure
  • Open in new tab
Supplementary Figure S7.

(A) Ratio of GABA+ cells among the hGPR56 e1m-driven EGFP+ (green) or pan-GPR56+ cells (magenta) in each layer of the cerebral cortex of transgenic marmoset no.1 (dark colors) and no.2 (light colors).

Supplementary Figure S8.
  • Download figure
  • Open in new tab
Supplementary Figure S8.

(A) Immunofluorescent staining of coronal section of the marmoset brain at E89 for Nkx2.1 and GPR56. Cerebral cortex (Cx), stratum (St), presumptive lateral ganglionic eminence (pLGE) and presumptive medial ganglionic eminence (pMGE) are indicated. Scale bar = 200μm. (B) Migrating neurons expressing hGPR56 e1m-driven EGFP (arrows) in the cerebral cortex of the transgenic marmoset at E95. Subventicular zone (SVZ), intermediate zone (IZ) and caudate (Cd) are indicated. Enlarged image of the area marked by a square in panel a (scale bar=50μm) is shown in panel b (scale bar=100μm).

Supplementary Figure S9.
  • Download figure
  • Open in new tab
Supplementary Figure S9.

(A) Gels scan data of Fig. 1C (a) and 1D (b and c). (B) Gel scan data of Fig. S3C.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S1.

The percentage of hGPR56 e1m-EGFP+ cells in each layer. Roman numerals are the number of each layer. The number in the parentheses is the number of sections analyzed.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S2.

The percentage of CTIP2 or GABA immunolabeled neurons among the pan-GPR56 or hGPR56 e1m-EGFP expressing neurons in layer V. Dash means no data.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S3.

The percentage of GABA+ cells that coexpress hGPR56e1m-EGFP in each layer. Dash means no data.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S4.

The percentage of GABA+ cells that coexpress pan-GPR56 in each layer. Dash means no data.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S5.

The percentage of PV, SST and CR immunolabeled neurons among the hGPR56 e1m-EGFP+ cells in layer V. Dash means no data.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Supplementary Table S6.

The percentage of PV, SST and CR neurons in layer V. Dash means no data.

Acknowledgements

We thank Hiroyuki Kanki and Fumiko Ozawa for their contributions to the preparation of probes for in situ hybridization. We appreciate Dr. Takuya Shimazaki and Prof. Miho Ohsugi for their advice in the preparation of the manuscript. We also appreciate Prof. Douglass Sipp and Ms. Jaimi Nakajima for proofreading this manuscript. This work was supported by Funding Program for World-leading Innovative R&D on Science and Technology (FIRST) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), and Brain Mapping by Integrated Neurotechnologies for Disease Studies (Brain/MINDS) from Japan Agency for Medical Research and Development (AMED) (JP19dm0207001, 18dm0207065h0001, 18dm0207002h0005) to T.S., E.S., and H.O. This work was also supported by a grant from Brain science research projects of Center for Novel Science Initiatives of National Institutes of Natural Sciences (NINS) to A.Y.M.

Footnotes

  • Ken-ichiro Kuwako and Junko Okahara are joint second authors.

References

  1. ↵
    Liu, M. et al. GPR56, a novel secretin-like human G-protein-coupled receptor gene. Genomics 55, 296–305, doi:10.1006/geno.1998.5644 (1999).
    OpenUrlCrossRefPubMedWeb of Science
  2. ↵
    Piao, X. et al. G protein-coupled receptor-dependent development of human frontal cortex. Science 303, 2033–2036, doi:10.1126/science.1092780 (2004).
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Iguchi, T. et al. Orphan G protein-coupled receptor GPR56 regulates neural progenitor cell migration via a G alpha 12/13 and Rho pathway. The Journal of biological chemistry 283, 14469–14478, doi:10.1074/jbc.M708919200 (2008).
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Bai, Y., Du, L., Shen, L., Zhang, Y. & Zhang, L. GPR56 is highly expressed in neural stem cells but downregulated during differentiation. Neuroreport 20, 918–922, doi:10.1097/WNR.0b013e32832c92d7 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  5. ↵
    Jeong, S. J., Luo, R., Li, S., Strokes, N. & Piao, X. Characterization of G protein-coupled receptor 56 protein expression in the mouse developing neocortex. J Comp Neurol 520, 2930–2940, doi:10.1002/cne.23076 (2012).
    OpenUrlCrossRefPubMed
  6. ↵
    Guo, J. & Anton, E. S. Decision making during interneuron migration in the developing cerebral cortex. Trends in cell biology 24, 342–351, doi:10.1016/j.tcb.2013.12.001 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  7. ↵
    Bae, B. I. et al. Evolutionarily dynamic alternative splicing of GPR56 regulates regional cerebral cortical patterning. Science 343, 764–768, doi:10.1126/science.1244392 (2014).
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Li, S. et al. GPR56 regulates pial basement membrane integrity and cortical lamination. J Neurosci 28, 5817–5826, doi:10.1523/jneurosci.0853-08.2008 (2008).
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Luo, R. et al. G protein-coupled receptor 56 and collagen III, a receptor-ligand pair, regulates cortical development and lamination. Proc Natl Acad Sci U S A 108, 12925–12930, doi:10.1073/pnas.1104821108 (2011).
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Giera, S. et al. The adhesion G protein-coupled receptor GPR56 is a cell-autonomous regulator of oligodendrocyte development. Nature communications 6, 6121, doi:10.1038/ncomms7121 (2015).
    OpenUrlCrossRefPubMed
  11. ↵
    Ackerman, S. D., Garcia, C., Piao, X., Gutmann, D. H. & Monk, K. R. The adhesion GPCR Gpr56 regulates oligodendrocyte development via interactions with Galpha12/13 and RhoA. Nature communications 6, 6122, doi:10.1038/ncomms7122 (2015).
    OpenUrlCrossRefPubMed
  12. ↵
    Bellusci, M. et al. Vigabatrin efficacy in GPR56-associated polymicrogyria: The role of GABAA receptor pathway. Epilepsia 57, 1337–1338, doi:10.1111/epi.13453 (2016).
    OpenUrlCrossRef
  13. ↵
    Izpisua Belmonte, J. C. et al. Brains, genes, and primates. Neuron 86, 617–631, doi:10.1016/j.neuron.2015.03.021 (2015).
    OpenUrlCrossRefPubMed
  14. ↵
    Okano, H. et al. Brain/MINDS: A Japanese National Brain Project for Marmoset Neuroscience. Neuron 92, 582–590, doi:10.1016/j.neuron.2016.10.018 (2016).
    OpenUrlCrossRefPubMed
  15. ↵
    Okano, H. & Kishi, N. Investigation of brain science and neurological/psychiatric disorders using genetically modified non-human primates. Current opinion in neurobiology 50, 1–6, doi:10.1016/j.conb.2017.10.016 (2018).
    OpenUrlCrossRef
  16. ↵
    Miller, C. T. et al. Marmosets: A Neuroscientific Model of Human Social Behavior. Neuron 90, 219–233, doi:10.1016/j.neuron.2016.03.018 (2016).
    OpenUrlCrossRefPubMed
  17. ↵
    Tokuno, H., Tanaka, I., Umitsu, Y., Akazawa, T. & Nakamura, Y. Web-accessible digital brain atlas of the common marmoset (Callithrix jacchus). Neurosci Res 64, 128–131, doi:10.1016/j.neures.2009.02.003 (2009).
    OpenUrlCrossRefPubMed
  18. ↵
    Tokuno, H., Tanaka, I., Umitsu, Y. & Nakamura, Y. Stereo Navi 2.0: software for stereotaxic surgery of the common marmoset (Callithrix jacchus). Neurosci Res 65, 312–315, doi:10.1016/j.neures.2009.08.004 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  19. ↵
    Hikishima, K. et al. Atlas of the developing brain of the marmoset monkey constructed using magnetic resonance histology. Neuroscience 230, 102–113, doi:10.1016/j.neuroscience.2012.09.053 (2013).
    OpenUrlCrossRefPubMed
  20. ↵
    Sawada, K. et al. Fetal sulcation and gyrification in common marmosets (Callithrix jacchus) obtained by ex vivo magnetic resonance imaging. Neuroscience 257, 158–174, doi:10.1016/j.neuroscience.2013.10.067 (2014).
    OpenUrlCrossRefPubMed
  21. ↵
    Sasaki, E. et al. Generation of transgenic non-human primates with germline transmission. Nature 459, 523–527, doi:10.1038/nature08090 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Park, J. E. et al. Generation of transgenic marmosets expressing genetically encoded calcium indicators. Sci Rep 6, 34931, doi:10.1038/srep34931 (2016).
    OpenUrlCrossRefPubMed
  23. ↵
    Huang, L., Merson, T. D. & Bourne, J. A. In vivo whole brain, cellular and molecular imaging in nonhuman primate models of neuropathology. Neuroscience and biobehavioral reviews 66, 104–118, doi:10.1016/j.neubiorev.2016.04.009 (2016).
    OpenUrlCrossRef
  24. ↵
    Hansen, D. V., Lui, J. H., Parker, P. R. & Kriegstein, A. R. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature 464, 554–561, doi:10.1038/nature08845 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  25. ↵
    Fietz, S. A. et al. OSVZ progenitors of human and ferret neocortex are epithelial-like and expand by integrin signaling. Nat Neurosci 13, 690–699, doi:10.1038/nn.2553 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  26. ↵
    Kelava, I. et al. Abundant occurrence of basal radial glia in the subventricular zone of embryonic neocortex of a lissencephalic primate, the common marmoset Callithrix jacchus. Cerebral cortex 22, 469–481, doi:10.1093/cercor/bhr301 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    Molyneaux, B. J., Arlotta, P., Menezes, J. R. & Macklis, J. D. Neuronal subtype specification in the cerebral cortex. Nature reviews. Neuroscience 8, 427–437, doi:10.1038/nrn2151 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  28. ↵
    Nobrega-Pereira, S. et al. Postmitotic Nkx2-1 controls the migration of telencephalic interneurons by direct repression of guidance receptors. Neuron 59, 733–745, doi:10.1016/j.neuron.2008.07.024 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  29. ↵
    Liebscher, I. et al. New functions and signaling mechanisms for the class of adhesion G protein-coupled receptors. Annals of the New York Academy of Sciences 1333, 43–64, doi:10.1111/nyas.12580 (2014).
    OpenUrlCrossRefPubMed
  30. ↵
    Cobos, I. et al. Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy. Nat Neurosci 8, 1059–1068, doi:10.1038/nn1499 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  31. ↵
    1. Michael, A. Rogawski.,
    2. Antonio, V. Delgado-Escueta.,
    3. Jeffrey, L. Noebels.,
    4. Massimo, Avoli. and
    5. Richard, W. Olsen.
    Marsh, E. D. & Golden, J. A. Developing Models of Aristaless-related homeobox mutations in Jasper’s Basic Mechanisms of the Epilepsies [Internet]. 4th edition (eds. Michael, A. Rogawski., Antonio, V. Delgado-Escueta., Jeffrey, L. Noebels., Massimo, Avoli. and Richard, W. Olsen.) https://www.ncbi.nlm.nih.gov/books/NBK98176/ (National Center for Biotechnology Information, 2012).
  32. ↵
    Lim, L., Mi, D., Llorca, A. & Marin, O. Development and Functional Diversification of Cortical Interneurons. Neuron 100, 294–313, doi:10.1016/j.neuron.2018.10.009 (2018).
    OpenUrlCrossRefPubMed
  33. ↵
    Nakayama, T. et al. Deletions of SCN1A 5’ genomic region with promoter activity in Dravet syndrome. Human mutation 31, 820–829, doi:10.1002/humu.21275 (2010).
    OpenUrlCrossRefPubMed
  34. ↵
    Higurashi, N. et al. A human Dravet syndrome model from patient induced pluripotent stem cells. Mol Brain 6, 19, doi:10.1186/1756-6606-6-19 (2013).
    OpenUrlCrossRefPubMed
  35. ↵
    Gao, Q. W. et al. A Point Mutation in SCN1A 5’ Genomic Region Decreases the Promoter Activity and Is Associated with Mild Epilepsy and Seizure Aggravation Induced by Antiepileptic Drug. Molecular neurobiology 54, 2428–2434, doi:10.1007/s12035-016-9800-y (2017).
    OpenUrlCrossRef
  36. ↵
    Holmes, G. L. & Noebels, J. L. The Epilepsy Spectrum: Targeting Future Research Challenges. Cold Spring Harbor perspectives in medicine 6, doi:10.1101/cshperspect.a028043 (2016).
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Naka, H., Nakamura, S., Shimazaki, T. & Okano, H. Requirement for COUP-TFI and II in the temporal specification of neural stem cells in CNS development. Nat Neurosci 11, 1014–1023, doi:10.1038/nn.2168 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  38. ↵
    Takahashi, T. et al. Birth of healthy offspring following ICSI in in vitro-matured common marmoset (Callithrix jacchus) oocytes. PLoS One 9, e95560, doi:10.1371/journal.pone.0095560 (2014).
    OpenUrlCrossRefPubMed
  39. ↵
    Sato, K. et al. Generation of a Nonhuman Primate Model of Severe Combined Immunodeficiency Using Highly Efficient Genome Editing. Cell stem cell 19, 127–138, doi:10.1016/j.stem.2016.06.003 (2016).
    OpenUrlCrossRefPubMed
  40. ↵
    Mashiko, H. et al. Comparative anatomy of marmoset and mouse cortex from genomic expression. J Neurosci 32, 5039–5053, doi:10.1523/JNEUROSCI.4788-11.2012 (2012).
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Kuwako, K. I. & Okano, H. The LKB1-SIK Pathway Controls Dendrite Self-Avoidance in Purkinje Cells. Cell reports 24, 2808–2818.e2804, doi:10.1016/j.celrep.2018.08.029 (2018).
    OpenUrlCrossRef
Back to top
PreviousNext
Posted October 22, 2020.
Download PDF
Email

Thank you for your interest in spreading the word about bioRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Enter multiple addresses on separate lines or separate them with commas.
The polymicrogyria-associated GPR56 promoter preferentially drives gene expression in developing GABAergic neurons in common marmosets
(Your Name) has forwarded a page to you from bioRxiv
(Your Name) thought you would like to see this page from the bioRxiv website.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
The polymicrogyria-associated GPR56 promoter preferentially drives gene expression in developing GABAergic neurons in common marmosets
Ayako Y Murayama, Ken-ichiro Kuwako, Junko Okahara, Byoung-Il Bae, Misako Okuno, Hiromi Mashiko, Tomomi Shimogori, Christopher A Walsh, Erika Sasaki, Hideyuki Okano
bioRxiv 2020.10.21.348821; doi: https://doi.org/10.1101/2020.10.21.348821
Reddit logo Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools
The polymicrogyria-associated GPR56 promoter preferentially drives gene expression in developing GABAergic neurons in common marmosets
Ayako Y Murayama, Ken-ichiro Kuwako, Junko Okahara, Byoung-Il Bae, Misako Okuno, Hiromi Mashiko, Tomomi Shimogori, Christopher A Walsh, Erika Sasaki, Hideyuki Okano
bioRxiv 2020.10.21.348821; doi: https://doi.org/10.1101/2020.10.21.348821

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Subject Area

  • Neuroscience
Subject Areas
All Articles
  • Animal Behavior and Cognition (4229)
  • Biochemistry (9118)
  • Bioengineering (6753)
  • Bioinformatics (23948)
  • Biophysics (12103)
  • Cancer Biology (9498)
  • Cell Biology (13746)
  • Clinical Trials (138)
  • Developmental Biology (7618)
  • Ecology (11666)
  • Epidemiology (2066)
  • Evolutionary Biology (15479)
  • Genetics (10621)
  • Genomics (14298)
  • Immunology (9468)
  • Microbiology (22808)
  • Molecular Biology (9083)
  • Neuroscience (48896)
  • Paleontology (355)
  • Pathology (1479)
  • Pharmacology and Toxicology (2566)
  • Physiology (3826)
  • Plant Biology (8319)
  • Scientific Communication and Education (1467)
  • Synthetic Biology (2294)
  • Systems Biology (6172)
  • Zoology (1297)