ABSTRACT
Mutation-driven evolution of SARS coronavirus-2 (SARS-CoV-2) highlights the need for innovative approaches that simultaneously suppress viral replication and circumvent viral escape routes from host immunity and antiviral therapeutics. Here, we employed genome-wide computational prediction and singlenucleotide resolution screening to reprogram CRISPR-Cas13b against SARS-CoV-2 genomic and subgenomic RNAs. Reprogrammed Cas13b effectors targeting accessible regions of Spike and Nucleocapsid transcripts achieved >98% silencing efficiency in virus free-models. Further, optimized and multiplexed gRNAs suppressed viral replication by up to 90% in mammalian cells infected with replication-competent SARS-CoV-2. Unexpectedly, the comprehensive mutagenesis of guide-target interaction demonstrated that single-nucleotide mismatches do not impair the capacity of a potent single gRNA to simultaneously suppress ancestral and mutated SARS-CoV-2 in infected mammalian cells, including the highly infectious and globally disseminated Spike D614G mutant. The specificity, efficiency and rapid deployment properties of reprogrammed Cas13b described here provide a molecular blueprint of antiviral therapeutics to simultaneously suppress a wide range of SARS-CoV-2 mutants, and is readily adaptable to other emerging pathogenic viruses.
INTRODUCTION
Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), the cause of coronavirus disease 2019 (COVID-19) has caused >52 million infections and over 1.3 million deaths worldwide as of November 20201. A wide range of preventive and therapeutic strategies are the subject of intensive investigation and include vaccines2, engineered monoclonal antibodies3,4, and small molecule antiviral agents5,6. However, the capacity of viruses to evolve in response to host, environmental and therapeutic pressures presents challenges to these conventional approaches.
While SARS-CoV-2 possesses a moderate mutational rate due to the proofreading activity of its RNA-dependent RNA polymerase (RdRP), there are nonetheless reports of emerging SARS-CoV-2 strains that have evolved increased fitness and pathogenicity7,8. The SARS-CoV-2 D614G (Asp614Gly) variant, resulting from a single nucleotide substitution (A to G) in the receptor binding domain of the Spike glycoprotein, has demonstrated increased affinity for the ACE2 receptor and enhanced replication capacity in vitro, potentially contributing to the global spread of this variant8–10. Likewise, analysis of virus phylogenetics globally enabled by the GISAID11 and Nextstrain12 databases revealed recurrent hotspot mutations in several viral subunits that are considered likely to confer selective advantage and/or alter pathogenicity13,14. Also, there are concerns regarding uncontrolled spread and evolution of the virus in farm animals such as minks that could eventually lead to problematic mutations15. These findings emphasize the need for an innovative antiviral approach that can counteract dynamic changes in the SARS-CoV-2 genome and thwart viral escape.
The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas13 is a form of bacterial adaptive immunity that suppresses bacteriophage RNA16–18. Previous reports have demonstrated the potential of certain Cas13 orthologs to silence endogenous and viral RNAs in mammalian cells19–21, however, it remains to be established whether Cas13 is capable of silencing replication-competent SARS-CoV-2 in infected mammalian cells, and potentially, redesigned to suppress mutation-driven viral evolution.
RESULTS
In-silico prediction and design of a genome-wide SARS-CoV-2 gRNA library
We hypothesized that the SARS-CoV-2 RNA genome and its subgenomic transcripts can be silenced with CRISPR-Cas13 in mammalian cells. We opted to use pspCas13b22 due to its long (30-nt) spacer sequence that is anticipated to confer greater specificity than Cas13 orthologs with shorter target sequences. We used the first publicly available genomic sequence of SARS-CoV-2 as the reference genome23 to design pspCas13 gRNAs, and developed a bioinformatics pipeline for in silico design of 29,894 pspCas13 tiled gRNAs covering the entire genome, from 5’ to 3’ end (Suppl. Figure 1 & Suppl. Table 1). We further refined the list of gRNAs by excluding (i) spacer sequences with poly-T repeats (4 or more successive T’s) that prematurely terminate the Pol III-driven transcription of gRNAs (Suppl. Table 2), and (ii) spacers or target sequences with predicted thermodynamically stable RNA-RNA duplexes that should hinder gRNA loading into pspCas13b and target accessibility. We selected 839 spacer sequences that best satisfied the selection criteria (Suppl. Table 3). As all 839 30-nt spacer sequences fully base-pair with the reference SARS-CoV-2 RNA, all are predicted to achieve high targeting efficiency. This database represents a valuable investigative tool to interrogate SARS-CoV-2.
PspCas13b suppresses the Spike transcript with high efficiency and specificity
In a proof-of concept assay, we used the bioinformatics pipeline described above to select gRNAs targeting the transcript of the Spike glycoprotein, which facilitates viral invasion of host cells following binding to the ACE2 surface receptor3,24 A codon-optimized Spike DNA template was cloned in frame with an upstream P2A selfcleavage peptide and enhanced green fluorescent protein (eGFP), enabling cotranscription and translation of Spike and eGFP, which are separated post-translationally by P2A proteolytic self-cleavage. In this reporter assay, pspCas13b-mediated cleavage of the Spike mRNA was predicted to lead to a loss of eGFP fluorescence (Figure 1A). We co-transfected 293 HEK cells with the Spike-eGFP reporter plasmid together with pspCas13 linked to a blue fluorescent protein (BFP) and gRNAs targeting either the Spike transcript (4 gRNAs) or non-targeting (NT) gRNA as a control. Fluorescence microscopy revealed that high silencing efficiency was achieved with all Spike-targeting gRNAs compared to the NT control (Figure 1B & 1C). We achieved similar silencing in VERO cells, a kidney epithelial cell line derived from an African green monkey, commonly used in SARS-CoV-2 research due to its high susceptibility to infection25 (Figure 1B & 1C). gRNA2 achieved the highest silencing efficiency amongst the 4 gRNAs we tested, reaching >99% and >90% reduction in spike transcript levels in 293 HEK and VERO cells, respectively. To demonstrate that the observed silencing was dependent on the cellular expression of gRNA, we transfected 293 HEK cells with increasing amounts of either NT or Spiketargeting gRNA2 plasmids ranging from 0 to 104 pM (0, 0.16, 0.8, 4, and 20ng plasmid in 100 μL volume). While NT gRNA exhibited no effect on eGFP expression, the Spiketargeting gRNA2 showed dose-dependent silencing of the Spike transcript with 50% silencing efficiency (IC50) achieved with 5.16 pM of plasmid gRNA (equivalent to 994pg in 100 μL of media), demonstrating that gRNA availability in the cell is key for efficient degradation of viral RNA (Figure 1D & 1E). This very low IC50 value also highlights the need for intracellular delivery of just a few copies of gRNA template plasmid to achieve effective silencing, thanks to intracellular gRNA amplification by the transcription machinery.
Like all RNA-guided nucleases, pspCas13b specificity is conferred by basepairing between the target and gRNA spacer sequences26–28. Evaluating the tolerance for mismatches in this interaction is therefore critical to determining both the potential off-target activity of pspCas13b (ie, silencing cellular transcripts), and more importantly, the loss of activity against variant sequences generated by the RdRP during viral replication29,30. Given that pspCas13b specificity is still poorly understood, we opted to determine the degree of variation in base-pairing between target RNA and the spacer of gRNA2 that could be tolerated and still lead to RNA degradation. We designed and cloned 9 constructs that encoded successive 3-, 6-, or 9-nt substitutions across the whole gRNA2 spacer sequence (Figure 1F). The nucleotide substitutions created mismatches (MSM) that perturbed the thermodynamic stability of the RNA-RNA duplex. While a 3-nt mismatches placed internally (position 14-16) or at the 3’end (position 28-30) had minimal impact, 3-nt mismatches at the 5’end reduced the silencing efficacy by ~50%. By comparison, 6-nt mismatches introduced at various locations markedly and consistently reduced silencing, and 9-nt mismatches completely abolished the degradation of the Spike transcript (Figure 1F). Taken together, this experiment indicated that gRNA2 requires >21-nt base-pairing with its target to trigger the necessary CRISPR-Cas conformational change and nuclease activation necessary for target degradation26–28. Conversely, the ability of pspCas13b to tolerate up to 3-nt mismatches underlines its potential to remain effective against the majority of variants with single-nucleotide polymorphisms in the target sequence, conferring protection against potential viral escape mutants such as the D614G mutation in the SARS-CoV-2 Spike protein8, and mutations that compromise the efficacy of therapeutic antibodies against SARS-CoV27.
Next, we questioned whether the RNA target sequence and structure may influence pspCas13b silencing efficiency. To comprehensively evaluate this possibility, we generated 61 single-nucleotide-tiled gRNAs covering the 5’ and 3’ overhangs of the gRNA2 target sequence (Figure 1G). This approach generated single-nucleotide resolution of the RNA landscape that influences pspCas13b silencing. Overall, 95% of gRNAs achieved >50% degradation efficiency, and 70% of gRNAs achieved >75% degradation of the Spike transcript. Notably, the least effective gRNAs were spatially clustered, suggesting that the RNA secondary structure and/or the presence of endogenous RNA binding proteins might limit spatial RNA accessibility. The tiling approach employed results in continuous changes in spacer flanking sequences (PFS). Accordingly, our findings revealed that unlike other CRISPR subtypes, pspCas13b activity appears to be independent of defined PFS or PAM-like (protospacer adjacent motif) motifs that constrain the targeting spectrum of other CRISPR effectors31. These data highlight the high likelihood of efficient silencing with various pspCas13b gRNAs and emphasize the flexibility of this RNA silencing tool for SARS-CoV-2 suppression.
Silencing SARS-CoV-2 nucleocapsid transcript
We next examined whether other SARS-CoV-2 structural components essential for viral assembly can be silenced by pspCas13b. We chose to target the RNA encoding the nucleocapsid protein (NCP) that is critical for viral particle assembly by packaging the RNA genome within the viral envelope32,33. Based on the reference genome sequence23 we designed and cloned the original sequence of the NCP into a reporter vector in frame with a monomeric red fluorescent protein (mcherry) (Figure 2A). We co-transfected 293 HEK and VERO cells with the NCP-mcherry reporter plasmid together with pspCas13-BFP and a NT gRNA or three different gRNAs targeting various regions of the NCP transcript.
Based on mcherry fluorescence intensity, we achieved high silencing efficiency in both cell lines, with all three NCP-targeting gRNAs (Figure 2B & 2C). Of these, gRNA1 exhibited the highest silencing efficiency, achieving >99% and >90% reduction in fluorescence in 293 HEK and VERO cells, respectively. In line with the microscopy data, western blot confirmed that the three NCP-targeting gRNAs efficiently depleted NCP protein, with gRNA1 again the most effective (Figure 2D). As with Spiketargeting gRNAs, titration of the NCP-targeting gRNA1 plasmid (0, 0.83, 4.15, and 20.75 pM, equivalent to 0, 0.16, 0.8, 4, and 20ng per 100 μL of media) into 293 HEK cells demonstrated dose-dependent silencing of the target, whereas NT gRNA had no effect (Figure 2E). The dose-dependent effect of NCP-targeting gRNA1 revealed 50% inhibition of the target (IC50) with 0.725 pM of plasmid gRNA (140 pg in 100 μL of media in 96-well format; R2=0.906) (Figure 2F), whereas the IC50 of Spike-targeting gRNA2 was 5.16 pM (R2=0.86) (Figure 1E). The variation in silencing efficiency (7-fold) observed with these two potent spacer sequences again highlighted that affinity and target accessibility need to be considered when selecting the optimal gRNA for maximal target silencing.
Next, we examined the extent to which mismatches in the spacer-target RNA-RNA hybrid of the highly efficient NCP-targeting gRNA1 would compromise its silencing potency. We designed 29 additional gRNA constructs that incorporated mismatches at the 5’ end, 3’ end, or at internal positions (blue residues, Figure 2G-I). Mismatch length varied from 3 to 30 nucleotides to cover the entire spacer sequence. At the 5’end, mismatches at positions 1-3 or 1-6 were well-tolerated and caused minor reductions in silencing efficiency in 293 HEK cells transfected with 20ng of gRNAs, while altering positions 1-9 reduced silencing by ~30%. However, by titrating the quantity of gRNA delivered, we revealed noticeable loss of silencing efficiency when 1-3, 1-6 or 1-9 mismatches were introduced (suppl. Figure 2). Mismatches longer than 9-nt at the 5’end completely abrogated silencing. Similarly, 3-nt mismatches placed internally (positions 14-16) or at the 3’ end were well tolerated, while 6-nt mismatches reduced silencing by ~30%. Introducing >6-nt mismatches at both internal and 3’ end positions caused complete loss of silencing (Figure 2H & 2I).
pspCas13b silencing tolerates a single-nucleotide mismatch with the target
Viral evolution takes place predominantly through single-nucleotide indels brought about by error-prone polymerases. We investigated whether pspCas13b can tolerate a single-nucleotide mismatch between the spacer and the SARS-CoV-2 RNA target, potentially enabling our silencing technology to remain effective against spontaneous mutations. We re-designed the gRNAs targeting either the Spike (gRNA2) or the nucleocapsid (gRNA1) transcripts to harbour a single-nucleotide mismatch at spacer positions 1, 5, 10, 15, 20, 25, and 30 and compared their silencing efficiency to their fully-matched wildtype counterparts. Overall, we found that a single-nucleotide mismatch at various locations of the spacer was well tolerated, with no appreciable impact on target silencing (Figure 3A & 3B). Among all the constructs we tested, only a single nucleotide mismatch in the first nucleotide of the spacer sequence of gRNA1 targeting Nucleocapsid exhibited a moderate loss of silencing (Figure 3B). In line with the fluorescence data, western blot analysis of Nucleocapsid protein expression confirmed that single-nucleotide mismatch at position 5, 10, 15, 20, 25, and 30 are well tolerated and retain full silencing efficiency, while a mismatch at position 1 led to a partial loss of silencing (Figure 3C). These data highlight the potential of a single pspCas13b gRNA to silence SARS-CoV-2 variants and overcome mutation-driven viral escape.
PspCas13b reduces live SARS-CoV-2 virus replication
A recent study attempted to target a SARS-CoV-2 RNA construct with a Cas13d ortholog but the silencing of live replication-competent SARS-CoV-2 was not examined21. Rather, a genetically engineered H1N1 influenza strain expressing a fluorescent reporter was used. To determine whether our reprogrammed pspCas13b could inhibit SARS-CoV-2 RNA replication, we transfected VERO cells with pspCas13b-BFP and either NT gRNA or the gRNA1 that most efficiency reduced Nucleocapsid RNA levels in virus-free models (Figure 2). We optimised transfection conditions of VERO cells to achieve 25-40% transfection efficiency as measured by flow cytometry analysis (Suppl. Figure 3). 48h post-transfection, we infected the cells with replication-competent SARS-CoV-2 at a Multiplicity Of Infection (MOI) of 0.01 or 0.1, and assayed the culture medium at 1hr, 24hrs, and 48hrs time-points using real-time PCR (RT-PCR) for viral RNA25. We also determined the titre of infectious SARS-CoV-2 by exposing fresh VERO cells to the supernatant and quantifying the cytopathogenic effect (CPE) by light microscopy and manual counting to determine the tissue culture infectious dose that inhibits 50% of virus growth (TCID50) (Figure 4A). In cells transfected with NT gRNA and infected at 0.1 MOI, viral RNA in the supernatant increased ~15-fold at 24h compared to baseline and this level was maintained at 48hrs. By contrast, in the presence of NCP-targeting gRNA1 there was a marked reduction in viral RNA detected (Figure 4B). RT-PCR analysis showed that gRNA1 reduced the viral load by ~90% 24h post-infection compared to the NT gRNA. However, NCP-targeting gRNA1 did not completely abrogate viral replication in this biological replicate, as the viral titre still increased 3-fold between 24 and 48hrs (Figure 4B). This partial inhibition of SARS-CoV-2 replication by pspCas13b is likely explained by a combination of a high viral load (0.1 MOI) that saturates intracellular pspCas13b nucleoproteins, and the limited transfection efficiency in VERO cells (25-40%) (Suppl. Figure 3). Subsequently, viral replication may take place in untransfected cells or cells expressing low levels of pspCas13b and gRNA. Increasing the efficiency of delivery of pspCas13b and its gRNA should result in even greater viral suppression.
In fact, when we infected VERO cells with one order of magnitude lower viral titre (0.01 MOI), viral RNA in the supernatant of cells expressing NT gRNA increased by ~14-fold 48hrs post-infection. By contrast, viral RNAs in the culture medium of cells expressing NCP-1 gRNA remained at the basal level (Figure 4B), demonstrating that pspCas13b and NCP-targeting gRNA1 efficiently suppressed viral replication in infected mammalian cells. In line with RT-PCR, the infectivity assay confirmed that the NCP-targeting gRNA1 greatly reduced the release of infectious virus (measured as TCID50 / mL) in the supernatant (Figure 4C).
The emergence of new viral strains of SARS-CoV-2, potentially with enhanced fitness, poses a formidable challenge to any single antiviral or antibody therapy7. Likewise, targeting SARS-CoV-2 with a single gRNA may have limited efficacy due to viral adaptation and/or poor accessibility to viral RNA in vivo due to intrinsic RNA folding and/or interference from RNA-binding proteins. We postulated that simultaneously targeting several regions of SARS-CoV-2 viral RNAs with multiplexed gRNAs would mitigate these effects, and reduce the likelihood of viral adaptation. We transfected VERO cells with four pools of gRNAs each containing four different guides targeting either SARS-CoV-2 structural proteins Spike and NCP, or non-structural protein NSP7 and NSP8 that act as co-factors critical for the RdRP6,29,30. We again infected the VERO cells with SARS-CoV-2, and quantified viral RNA and infectious virus in the culture supernatant. We found that all four gRNAs pools markedly reduced viral RNA (Figure 4D), and infectious virus (Figure 4E,) in the supernatant at both 0.1 and 0.01 MOI.
Likewise, when we challenged VERO cells with 0.1 and 0.01 MOI of SARS-CoV-2 virus 72h post-transfection of pspCas13b and various gRNAs, we achieved ~80% and ~90% suppression of viral loads with all tested gRNAs, respectively (Figure 4F & Suppl. Figure 4). These results indicate that SARS-CoV-2 viral suppression from a single pspCas13b transfection can persist beyond 5 days post-transfection, and 3 days post-infection.
To the best of our knowledge, this is the first study that definitively demonstrates the effective and specific targeting of replication-competent SARS-CoV-2 in infected mammalian cells, using CRISPR-Cas13.
pspCas13b suppresses mutation-driven SARS-CoV-2 evolution
A single nucleotide substitution in the receptor binding domain (RBD) of the Spike protein led to the global emergence of SARS-CoV-2 D614G variant with increased ACE-2 affinity and infective potential8,9. Based on the single-nucleotide mismatch data described above (Figure 3A & 3B), we hypothesized that gRNAs designed against ancestral Spike D614 genomic sequence should remain effective against the D614G mutant RNAs despite a single-nucleotide mismatch at the spacer-target interface. To test this, we cloned part of the D614G Spike coding sequence (1221 bp; D614G SARS-CoV-2 genomic region between 22,760—23,980) into the mcherry reporter system, and assessed the silencing efficiency of 6 tiled gRNAs targeting this frequently mutated hotspot. The spacer sequences of all 6 tiled gRNAs tested are designed to fully match the ancestral Spike sequence (D614) and harbour one nucleotide mismatch with the Spike transcript of D614G mutant at spacer positions 5, 10, 15, 20, 25, and 30 (Figure 5A). The data showed that all 6 gRNAs significantly degraded the D614G mutant transcript (P<0.0001). Interestingly, gRNAs with a single-nucleotide mismatch at spacer position 15, 20, 25, or 30 were highly effective and exhibited >98% silencing efficiency against the D614G mutant transcript. By contrast, gRNAs with a mismatch at position 5 or 10 showed a reduced silencing efficiency estimated at approximatively 85-88% removal of the D614G mutant transcript (Figure 5A). These data suggest that pspCas13 and the D614G targeting gRNAs with a single-nucleotide mismatch at positions 15, 20, 25, and 30 are likely to remain effective against both ancestral and D614G mutant in infected cells. Thus, the mismatch tolerance molecular mechanism described here is expected to confer pspCas13d resilience against spontaneous single-nucleotide mutations that drive viral escape in SARS-CoV-2 and other pathogenic viruses.
To test the mismatch tolerance of our Cas13b system against various replication-competent SARS-CoV-2 viral strains, we transfected VERO cells with NT gRNA, NCP-1 targeting gRNA (positive control), or 4 tiled gRNAs (10, 15, 20, 30) fully matching the ancestral Spike sequence D614 (see the schematic illustration in Figure 5A & 5B). 48 hours post-infection, VERO cells expressing pspCas13-BFP and various gRNAs were infected with either the ancestral or D614G mutant SARS-CoV-2, and the viral loads in supernatants were quantified by RT-PCR 1h (initial viral input), 24h and 48h post-infection (Figure 5B). The comparison of viral loads in the supernatant of cells infected with either the ancestral or D614G in the control groups (NT) showed 7.7, 4.2, and 2.3-fold higher viral loads in the D614G samples at timepoints 1h, 24h, and 48h, respectively (Figure 5C, 5E & 5G). These data revealed that the initial D614G viral load used here was more than 7 times higher than the ancestral strain.
As anticipated, all SARS-CoV-2 targeting gRNAs tested showed no significant viral suppression against the ancestral nor the D614G strains 1-hour post-infection. The absence of viral suppression with targeting gRNAs at this early timepoint of infection was anticipated because pspCas13b-mediated viral suppression requires intracellular viral replication that had not yet occurred.
In the positive control groups, NCP-1 gRNA is used to target a fully matching sequence within the Nucleocapsid RNA that is conserved in both ancestral and D614G strains. Consistent with the data in Figure 2 and Figure 4, NCP-1 gRNA again showed a very high silencing efficiency, and suppressed 84-88% and 73-74% of replication-competent ancestral and D614G viruses, respectively, at both 24 and 48h timepoints (Figure 5F & 5H). The moderate loss of viral suppression in cells infected with the D614G mutant is likely due to the 7-fold higher initial viral load (Figure 5C, 5E & 5G). Among the 4 tiled gRNAs targeting the ancestral D614 position in Spike’s RNA, 3 of them (15, 20, and 30) showed efficient viral suppression reaching 78-84% and 44-60% in cells infected with the ancestral and D614G strains respectively, at both 24 and 48h timepoints (Figure 5F & 5H). Again, the moderate reduction in D614G suppression with these 3 gRNAs is likely attributable to the initial higher viral load of this D614G strain. Last, the fourth gRNA we tested (harbouring a mismatch with the D614G mutation at spacer position 10) showed the lowest affinity and viral suppression potential with 62-71% suppression of the ancestral strain, and only 3-7% suppression of the D614G, which was not statistically significant at 24 nor at 48h (Figure 5F & 5H). This result is congruent with the data obtained from virus-free model (Figure 5A), where the gRNA harbouring a single-nucleotide mismatch with D614G at spacer position 10 exhibited the lowest silencing efficiency among the 4 gRNAs tested. This correlation highlights the predictive power of the virus-free model we developed, and emphasises its utility to tractably screen and select the best performing gRNAs. Overall, the data in Figure 5 provide strong evidence that optimized single gRNAs are likely to retain efficacy against spontaneous pointmutations that arise during viral replication and can efficiently silence ancestral and emerging SARS-CoV-2 mutants, including the D614G.
DISCUSSION
The remarkable capability of RNA viruses to adapt to selective host and environmental pressure is highly dependent on their ability to generate genomic diversity through the occurrence of de novo mutations34. Mutation-driven viral evolution can generate drug resistance, immune escape, and potentially increased efficiency of transmission and pathogenicity, all of which are detrimental to the host. Although our understanding of SARS-CoV-2 mutation-driven escape mechanisms remains limited, several reports have demonstrated the emergence of new strains, which possess increased infective potential8 or are resistant to monoclonal antibody therapy7. In this study, we leveraged a novel technology and employed two key strategies to silence SARS-CoV-2 RNA and counteract its intrinsic ability to escape standard therapies through the generation of de novo mutations.
Firstly, the gRNA multiplexing approach to target various regions of viral RNA simultaneously mitigates the risk of target inaccessibility35 and potential viral escape through genomic rearrangement or polymorphisms7,8,14,36 (Figure 4, Suppl. Figure 4 & Figure 5). Given the moderate mutation rate of SARS-CoV-2, it is extremely unlikely that the virus would accumulate simultaneous mutations in various regions to escape a cocktail of 4 gRNAs without compromising its fitness. This multiplexed targeting is comparable to other combination therapeutic strategies that have proven to be effective against other viruses including HIV37. Compared to inhibitors of protein function that typically require years of modelling, design, and screening, the advantage of viral RNA targeting with pspCas13b lies in its design-flexibility, predictive efficacy and specificity, and the short time needed to generate the relevant gRNAs. The specificity, high silencing efficiency, and rapid deployment properties of pspCas13b that we have demonstrated are indicative of the translational potential of this technology to reshape the battle against SARS-CoV-2 and provide a means of evolving therapy in concert with viral genomic changes. Likewise, other Cas13 orthologs may also offer similar properties3,16,19,28,38,39.
Secondly, our comprehensive mutagenesis analysis revealed that the positively-charged central channel of pspCas13b can tolerate single-nucleotide mismatches within the RNA-RNA hybrid created by spacer-target base-pairing26,27 (Figure 1, 2 & 3). We demonstrated that a single gRNA can simultaneously silence parental and emerging SARS-CoV-2 strains (Figure 5). The mismatch tolerance mechanism shown here revealed that a single gRNA will likely remain effective against future viral mutants that acquire de novo single-nucleotide indels as a result of genome replication by the error-prone RdRP of SARS-CoV-2.
Given the high degree of tolerance to single-nucleotide mismatch and the use of gRNA multiplexing, we postulate that a reprogrammed pspCas13b can act as a universal tool to silence various SARS-CoV-2 strains that would escape conventional antiviral therapeutics, including single monoclonal antibodies7 or small inhibitor molecules. A key step in enabling clinical translation of this approach will be to develop a safe and effective delivery strategy such as lipid nanoparticle formulations for systemic, and possibly, mucosal delivery40. Importantly, a CRISPR-Cas13 based approach is also readily adaptable and expandable to other pathogenic viruses beyond SARS-CoV-2, and may therefore represent a new and powerful approach to antiviral therapeutics.
Data availability
All data are available in the main text and suppl materials. All key plasmids generated in this study will be deposited in Addgene upon publication. The bioinformatic code for the design of single-nucleotide tiled gRNAs and filtering strategies will be made available upon request and will be published in a separate manuscript.
Authors contribution
M.F conceived the study. M.F, J.A.T and S.R.L supervised the study. M.F, J.A.T, S.R.L, W.Z, W.H, and J.M.L.C designed the experiments and discussed all data. M.F, W.H, and J.M.L.C cloned all constructs, optimized and performed virus-free silencing assays and analysed the data. W.Z performed all SARS-CoV-2 infection assays with help from R.R. W.Z analysed data from infectivity assays. M.F and W.Z extracted viral RNAs, performed RT-PCR, and analysed the data. A.K performed the computational analysis of SARS-CoV-2 guide and target RNAs with input from M.F. I.V, P.G.E, and J.S discussed the project and the data. M.F generated figures and wrote the manuscript. J.A.T and S.R.L revised and edited the manuscript. All authors read, commented, edited, and approved the manuscript.
Competing interests
S.R.L is a member of advisory boards of Merck and Gilead and has received investigator-initiated industry funded grants from Merck, Gilead and Viiv. None of this support is relevant to the work in this manuscript. The other authors declare no conflict of interest.
METHODS
Design and cloning of pspCas13b guide RNAs
Individual guides were cloned into the pC0043-PspCas13b22 crRNA backbone (addgene#103854, a kind gift from Feng Zhang lab), which we refer to as gRNA backbone. This vector contains pspCas13b gRNA direct repeat (DR) sequence and two BbsI restriction sites for spacer cloning. 20μg of DNA backbone was digested by BbsI (NEB#) following the manufacturer’s instructions (2h at 37C). The digested backbone was gel purified using NucleoSpin™ Gel and PCR Clean-up Kit (Thermo Fisher 12), aliquoted, and stored in −20C°.
For gRNA cloning, a forward and reverse single-stranded DNA oligos containing CACC and CAAC overhangs respectively, were ordered from Sigma (100μM). 1.5μL of 100uM the forward and reverse DNA oligos were annealed in 47μL annealing buffer (5ul NEB buffer 3.1 and 42μL H2O) by 5min incubation at 95C° and slow cooldown in the heating block overnight. 1μL of the annealed oligos were ligated with 0.04ng digested pspCAs13b gRNA backbone in 10μL of T4 ligation buffer (3 hours, RT). All pspCas13b gRNA spacer sequences used in this study are listed in the Table below.
Cloning of pspCas13b-NES-HIV-T2A-BFP
The original pspCas13b (addgene#103862) is a gift from Feng Zhang lab22. A new pspCas13 plasmid was designed by fusing a 3xFlag-T2A-BFP tag to the Cas13 C-terminus using EcoRI and NheI enzymatic restriction. 5μg of pUC19 vector encoding a Psp-Cas13b-3’end-3xFlag-T2A-BFP sequence was generated by DNA synthesis (IDT). Psp-Cas13b-3’end-3xFlag-T2A-BFP and the original pC0046-EF1a-PspCas13b-NES-HIV plasmids were digested by EcoRI/NheI restriction enzymes (1 hour, 37C°), followed by column clean up with NucleoSpin™ Gel and PCR Clean-up Kit (Macherey-Nagel). The digestion efficiency was verified by 1% agarose gel. The Psp-Cas13b-3’end-3xFlag-T2A-BFP fragment with the correct size was gel purified using NucleoSpin™ Gel and PCR Clean-up Kit. The two fragments were ligated using T4 ligase (3 hours, RT), and transformed into Stbl3 chemically competent bacteria. Positive clones were screened by PCR and Singer sequenced (AGRF, AUSTRALIA).
Cloning of SARS-CoV-2 Spike, Spike D614G, and Nucleocapsid cDNA
A mammalian expression plasmid containing a codon-optimized sequence of the Spike protein was obtained through Genscript plasmid sharing platform (Ref# MC_0101087), and was a kind gift from Dr. Haisheng Yu lab.
The coding sequence of NCP and part of Spike D614G sequence was designed according to the first SARS-CoV-2 genome23. The Genscript DNA synthesis platform provided the two sequences that were subsequently cloned into MSCV-IRES-mcherry vector in frame with 3xHA tag using BamHI digestion, gel purification, and ligation with T4 DNA ligase. The ligated product was transformed into chemically competent bacteria (Top10) and positive clones were screened by PCR and Singer sequencing (AGRF, AUSTRALIA).
Plasmid amplification and purification
TOP10 (for all gRNA, Spike, D614G Spike, and NCP cloning) and Stbl3 (for Cas13 cloning) bacteria were used for transformation. 5-10μL ligated plasmids were transformed into 30 μL of chemically competent bacteria by heat shock at 42C° for 45 seconds, followed by 2min on ice. The transformed bacteria were incubated in 500μL LB broth media containing 75μg/mL ampicillin for 1 hour at 37C° in a shaking incubator (200 rpm). The bacteria were pelleted by centrifugation at 8,000 rpm for 1minute at room temperature (RT), re-suspended in 100 μL of LB broth, and plated onto a prewarmed 10 cm LB agar plate containing 75μg/mL ampicillin, and incubated at 37C° overnight. Next day, single colonies were picked and transferred into bacterial starter cultures and incubated for ~6 hours for mini-prep or maxi-prep DNA purification according to the standard manufacturer’s protocol. All gRNAs and pspCas13b clones that are generated in this study were verified by Sanger sequencing (AGRF, AUSTRALIA).
Cell culture
HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies), Penicillin/-Streptomycin, and -L-Glutamine (Life Technologies). HEK293 FT and VERO cells were maintained at confluency between 20%-80% in 37C° incubators with either 10% (HEK293 FT) or 5% (VERO). Cells were routinely tested and were mycoplasma negative.
RNA silencing assays by transient transfection
All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK, cells were plated at approximately 30,000 cells/100μL/96-well in tissue culture treated flat-bottom 96-well plates (Corning) 18 hours prior to transfection. For each well, a total of 100ng DNA plasmids (22ng of pspCas13b-BFP construct, 22ng gRNA plasmid and 56ng of the target gene) were mixed with 0.2μL P3000 reagent in Opti-MEM Serum-free Medium (Life Technologies) to a total of 5μL (mix1). Separately, 4.7μL of Opti-MEM was mixed with 0.3μL Lipofectamine 3000 (mix2). Mix1 and mix2 are added together and incubated for 20 minutes at room temperature, then 10μL of transfection mixture was add to each well. Similar protocol was used for VERO cells transfection except 20,000 cells/well were seeded in a 96-well plate and transfected with a double volume of transfection mixture (20μL). The tables below summarize the transfection protocol used in 96, 24, and 6-well plates for both 293 HEK FT and VERO cells.
After transfection, cells were incubated at 37C° and 5% CO2, and the transfection efficiency was monitored by either fluorescence microscopy or FACS analysis.
Fluorescence microscopy analysis
For RNA silencing experiments, the fluorescence intensity was monitored using EVOS M5000 FL Cell Imaging System (Thermo Fisher). Pictures were taken 48 hours (293 HEK) and 72 hours (VERO) post-transfection, and the fluorescence intensity of each image was quantified using a lab-written macro in ImageJ software. Briefly, all images obtained from a single experiment are simultaneously processed using a batch mode macro. First, images are converted to 8-bit, threshold adjusted, converted to black and white using Convert to Mask function, and fluorescence intensity per pixel measured using Analyze Particles function. Each single mean fluorescence intensity was obtained from four different field of views for each gRNA, and subsequently normalized to the non-targeting (NT) control gRNA. Two-fold or higher reduction in fluorescence intensity is considered as biologically relevant.
Cell flow cytometry
For monitoring cell transfection/transduction efficacy, cells were re-suspended in 200μL 1x PBS containing 2% FBS for flow cytometry analysis. All samples were analyzed by an LSR II (BD Biosciences), FORTESSA X20 (BD Biosciences) or FACSymphony (BD Biosciences). All flow cytometry profiles were analyzed using FlowJo V10 software (Tree Star Inc).
Western Blot
Cells were washed three times with ice-cold PBS+/+ and lysed on ice in lysis buffer (50Mm Tris, 150mM NaCl, 1% NP-40, 2% SDS, pH 7.5). Samples were sonicated on low power, two-second pulses, and centrifuged at 16,000g for 10 minutes, 4 °C. Supernatant was transferred to a new tube. Protein concentrations were quantified using the BCA assay (ThermoFisher Scientific) according to the manufacturer’s instructions. 10μg proteins diluted in 1x Bolt LDS sample buffer and 1x Bolt sample reducing agent were denaturated at 95 °C for 5 minutes. Samples were resolved by Bolt Bis-Tris Plus 4-12% gels in 1x MES SAS and transferred to PVDF membranes by a Trans-Blot Semi-Dry electrophoretic transfer cell (Bio-Rad) at 20 Volt for 30 minutes. Membranes were incubated in blocking buffer (5% (w/v) skin milk powder in PBST with 0.1% Tween 20) for 1 hour at RT and probed overnight with primary antibody (anti-HA, mAb #2367, Cell Signaling Technology) at 4 °C. Blots were washed three times in PBST with 0.1% Tween20, followed by incubation with HRP-conjugated secondary antibody (Rabbit Anti-Mouse Immunoglobulins/HRP #p0260, Dako) for 1 hour at RT. Membranes were washed in PBST (0.1% Tween20) three times and incubated in appropriate strength ECL detection reagent. Chemiluminescence was detected using Invitrogen iBright Imaging Systems (Thermo Fisher Scientific).
VERO cells infection assays
VERO cells were transfected in 24-well plates and incubated for 48 h as described above. VERO cells expressing pspCas14b-BFP and various gRNAs were then infected in a level 3 containment laboratory with 200 μL of the ancestral or D614G SARS-CoV-2 virus isolate, a kind gift from Dr. Julian Druce25 (Victoria Infectious Disease Reference Lab, VIDRL) at MOI of 0.1 or 0.01 in DMEM containing Penicillin/Streptomycin, L-Glutamine and 1 μg / mL TPCK-treated trypsin (LS003740, Worthington) to facilitate Spike cleavage and cell entry of the virus. After 1-hour incubation at room temperature, Virus production in supernatant was assessed by real-time PCR (RT-PCR) and infectivity assays at various time points.
RNA extraction, cDNA synthesis and RT-PCR
Viral RNA from 140 μL cell culture supernatant was extracted using the QIAamp Viral RNA Mini kit (#52906, Qiagen) following the manufacturer’s instructions. SARS-CoV-2 RNA was converted to cDNA using the SensiFAST cDNA kit (#BIO-65053, BioLine) with 10 μL of RNA extract per reaction following the manufacturer’s instructions. Quantitative RT-PCR reaction targeting RdRP gene was performed in triplicate in a Mx3005P QPCR System (Agilent) using PrecisionFAST qPCR Master Mix (PFAST-LR-1, Integrated Science). Total reaction mixture contains 2.5 μL cDNA, 0.75 μM forward primer (5’-AAA TTC TAT GGT GGT TGG CAC AAC ATG TT-3’, 0.75 μM reverse primer (5’-TAG GCA TAG CTC TRT CAC AYT T-3’) and 0.15 μM TaqMan Probe (5’-FAM-TGG GTT GGG ATT ATC-MGBNFQ-3’).
Infectivity assays
For titration of the 50% tissue culture infectious dose (TCID50) of SARS-CoV-2, VERO cells were plated in 96-well plates at 20,000 cells per well in MEM containing 5% heat-inactivated fetal bovine serum, Penicillin/Streptomycin, L-Glutamine and 15 mM HEPES (Life Technologies). The cells were incubated overnight in a 5% CO2 environment at 37°C, washed once with PBS and then cultured in serum-free MEM containing Penicillin/Streptomycin, L-Glutamine, 15 mM HEPES and 1 μg / mL TPCK-treated trypsin. A 10-fold initial dilution of samples with one freeze-thaw cycle was made in quadruplicate wells of the 96-well plates followed by 6 serial 10-fold dilutions. The last row served as negative control without addition of any sample. After a 4-day incubation, the plates were observed for the presence of cytopathogenic effect (CPE) using an inverted optical microscope. Any sign of CPE was categorized as positive results. The endpoint titres were calculated by means of a simplified Reed & Muench method41.
Data analysis
Data analyses and visualization (graphs) were performed in GraphPad Prism software version 7. Specific statistical tests, numbers of biological replicates are mentioned in respective figure legends. The silencing efficiency of various gRNAs was analyzed using one-way Anova followed by Dunnett’s multiple comparison test where we compare every mean to a control mean as indicated in the figures (95% confidence interval). Unpaired Student’s t-test (95% confidence interval) was used to compare the viral titre between ancestral and D614G. The P values (P) are indicated in the figures. P<0.05 is considered as statistically significant.
Spacer sequence of gRNAs used in this study
cDNA sequences of constructs used in this study
PspCasl3b-3xFLAG-T2A-BFP
atgaacatccccgctctggtggaaaaccagaagaagtactttggcacctacagcgtgatggccatgctgaacgctcagaccgtgct ggaccacatccagaaggtggccgatattgagggcgagcagaacgagaacaacgagaatctgtggtttcaccccgtgatgagccac ctgtacaacgccaagaacggctacgacaagcagcccgagaaaaccatgttcatcatcgagcggctgcagagctacttcccattcct gaagatcatggccgagaaccagagagagtacagcaacggcaagtacaagcagaaccgcgtggaagtgaacagcaacgacatct tcgaggtgctgaagcgcgccttcggcgtgctgaagatgtacagggacctgaccaaccactacaagacctacgaggaaaagctgaa cgacggctgcgagttcctgaccagcacagagcaacctctgagcggcatgatcaacaactactacacagtggccctgcggaacatg aacgagagatacggctacaagacagaggacctggccttcatccaggacaagcggttcaagttcgtgaaggacgcctacggcaag aaaaagtcccaagtgaataccggattcttcctgagcctgcaggactacaacggcgacacacagaagaagctgcacctgagcggag tgggaatcgccctgctgatctgcctgttcctggacaagcagtacatcaacatctttctgagcaggctgcccatcttctccagctacaat gcccagagcgaggaacggcggatcatcatcagatccttcggcatcaacagcatcaagctgcccaaggaccggatccacagcgaga agtccaacaagagcgtggccatggatatgctcaacgaagtgaagcggtgccccgacgagctgttcacaacactgtctgccgagaa gcagtcccggttcagaatcatcagcgacgaccacaatgaagtgctgatgaagcggagcagcgacagattcgtgcctctgctgctgc agtatatcgattacggcaagctgttcgaccacatcaggttccacgtgaacatgggcaagctgagatacctgctgaaggccgacaag acctgcatcgacggccagaccagagtcagagtgatcgagcagcccctgaacggcttcggcagactggaagaggccgagacaatg cggaagcaagagaacggcaccttcggcaacagcggcatccggatcagagacttcgagaacatgaagcgggacgacgccaatcct gccaactatccctacatcgtggacacctacacacactacatcctggaaaacaacaaggtcgagatgtttatcaacgacaaagagga cagcgccccactgctgcccgtgatcgaggatgatagatacgtggtcaagacaatccccagctgccggatgagcaccctggaaattc cagccatggccttccacatgtttctgttcggcagcaagaaaaccgagaagctgatcgtggacgtgcacaaccggtacaagagactg ttccaggccatgcagaaagaagaagtgaccgccgagaatatcgccagcttcggaatcgccgagagcgacctgcctcagaagatcc tggatctgatcagcggcaatgcccacggcaaggatgtggacgccttcatcagactgaccgtggacgacatgctgaccgacaccgag cggagaatcaagagattcaaggacgaccggaagtccattcggagcgccgacaacaagatgggaaagagaggcttcaagcagatc tccacaggcaagctggccgacttcctggccaaggacatcgtgctgtttcagcccagcgtgaacgatggcgagaacaagatcaccgg cctgaactaccggatcatgcagagcgccattgccgtgtacgatagcggcgacgattacgaggccaagcagcagttcaagctgatgt tcgagaaggcccggctgatcggcaagggcacaacagagcctcatccatttctgtacaaggtgttcgcccgcagcatccccgccaat gccgtcgagttctacgagcgctacctgatcgagcggaagttctacctgaccggcctgtccaacgagatcaagaaaggcaacagagt ggatgtgcccttcatccggcgggaccagaacaagtggaaaacacccgccatgaagaccctgggcagaatctacagcgaggatctg cccgtggaactgcccagacagatgttcgacaatgagatcaagtcccacctgaagtccctgccacagatggaaggcatcgacttcaa caatgccaacgtgacctatctgatcgccgagtacatgaagagagtgctggacgacgacttccagaccttctaccagtggaaccgca actaccggtacatggacatgcttaagggcgagtacgacagaaagggctccctgcagcactgcttcaccagcgtggaagagagaga aggcctctggaaagagcgggcctccagaacagagcggtacagaaagcaggccagcaacaagatccgcagcaaccggcagatga gaaacgccagcagcgaagagatcgagacaatcctggataagcggctgagcaacagccggaacgagtaccagaaaagcgagaa agtgatccggcgctacagagtgcaggatgccctgctgtttctgctggccaaaaagaccctgaccgaactggccgatttcgacggcg agaggttcaaactgaaagaaatcatgcccgacgccgagaagggaatcctgagcgagatcatgcccatgagcttcaccttcgagaa aggcggcaagaagtacaccatcaccagcgagggcatgaagctgaagaactacggcgacttctttgtgctggctagcgacaagagg atcggcaacctgctggaactcgtgggcagcgacatcgtgtccaaagaggatatcatggaagagttcaacaaatacgaccagtgca ggcccgagatcagctccatcgtgttcaacctggaaaagtgggccttcgacacataccccgagctgtctgccagagtggaccgggaa gagaaggtggacttcaagagcatcctgaaaatcctgctgaacaacaagaacatcaacaaagagcagagcgacatcctgcggaag atccggaacgccttcgatcacaacaattaccccgacaaaggcgtggtggaaatcaaggccctgcctgagatcgccatgagcatcaa gaaggcctttggggagtacgccatcatgaagggatcccttcaactgcctccacttgaaagactgacactggactataaggaccacg acggagactacaaggatcatgatattgattacaaagacgatgacgataagggcggcgggtccggaggagagggcagaggaagtc tcctaacatgcggtgacgtggaggagaatcctggcccaatgagcgagctgattaaggagaacatgcacatgaagctgtacatgga gggcaccgtggacaaccatcacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaa ggtggtcgagggcggccctctccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacc cagggcatccccgacttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaggacgggggcgtgct gaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggcc ctgtgatgcagaagaaaacactcggctgggaggccttcaccgagaccctgtaccccgctgacggcggcctggaaggcagaaacga catggccctgaagctcgtgggcgggagccatctgatcgcaaacatcaagaccacatatagatccaagaaacccgctaagaacctc aagatgcctggcgtctactatgtggactacagactggaaagaatcaaggaggccaacaacgagacctacgtcgagcagcacgag gtggcagtggccagatactgcgacctccctagcaaactggggcacaagcttaattga
Black: PspCas13b
Green:3xFlag
Red: T2A tag
Blue: BFP
Coding sequence of codon optimized Spike protein-P2A-EGFP
atgttcgtgtttctggtgctgctgcctctggtgagctcccagtgcgtgaacctgaccacacggacacagctgccccctgcctacacca acagcttcacaaggggcgtgtactaccccgacaaggtgtttagatctagcgtgctgcactccacacaggatctgtttctgcctttcttt tctaacgtgacctggttccacgctatccacgtgtccggcaccaacggaacaaagaggttcgacaacccagtgctgccctttaacgat ggcgtgtacttcgcctccaccgagaagtctaacatcatcagaggctggatctttggaaccacactggacagcaagacacagtccct gctgatcgtgaacaacgccaccaacgtggtcatcaaggtgtgcgagttccagttttgtaacgatccattcctgggcgtgtactaccac aagaacaacaagtcttggatggagagcgagtttcgcgtgtactcctctgccaacaactgtacatttgagtacgtgtcccagcccttcc tgatggacctggagggcaagcagggaaacttcaagaacctgcgggagttcgtgtttaagaacatcgatggctactttaagatctact ccaagcacaccccaatcaacctggtgcgcgacctgccacagggcttctctgccctggagccactggtggatctgcccatcggaatca acatcaccaggtttcagacactgctggccctgcacagaagctacctgacaccaggcgacagctcctctggatggaccgctggagct gctgcctactacgtgggctacctgcagccccggaccttcctgctgaagtacaacgagaacggaaccatcacagacgctgtggattg cgccctggaccccctgtctgagaccaagtgtacactgaagagctttaccgtggagaagggcatctaccagacaagcaacttccggg tgcagcctaccgagtccatcgtgcgctttcccaacatcacaaacctgtgcccttttggagaggtgttcaacgctacccgcttcgcctcc gtgtacgcttggaaccggaagcgcatctccaactgcgtggccgactactctgtgctgtacaacagcgccagcttcagcaccttcaag tgctacggcgtgagcccaacaaagctgaacgacctgtgctttaccaacgtgtacgctgattccttcgtgatcaggggagacgaggtg cgccagatcgctcccggccagacaggaaagatcgctgactacaactacaagctgcctgacgatttcaccggctgcgtgatcgcctg gaactctaacaacctggatagcaaagtgggcggaaactacaactacctgtacaggctgtttagaaagtctaacctgaagccattcg agcgggacatctccacagagatctaccaggctggctctaccccatgcaacggagtggagggcttcaactgttacttccctctgcaga gctacggattccagccaacaaacggcgtgggataccagccctaccgcgtggtggtgctgtcttttgagctgctgcacgctcctgctac agtgtgcggaccaaagaagagcaccaacctggtgaagaacaagtgcgtgaacttcaactttaacggactgaccggcacaggagtg ctgaccgagtctaacaagaagttcctgccttttcagcagttcggccgggacatcgccgataccacagacgctgtgcgcgaccctcag accctggagatcctggatatcacaccatgctccttcggcggagtgtctgtgatcacaccaggaaccaacacaagcaaccaggtggc cgtgctgtaccaggacgtgaactgtaccgaggtgcccgtggctatccacgccgatcagctgacccctacatggagggtgtactctac cggcagcaacgtgttccagacaagagccggctgtctgatcggagctgagcacgtgaacaacagctacgagtgcgacatccctatcg gcgccggaatctgtgcttcctaccagacccagacaaactccccaaggagagccaggtctgtggctagccagtccatcatcgcctac accatgagcctgggcgccgagaactccgtggcttactccaacaactctatcgctatccctaccaacttcacaatctccgtgaccacag agatcctgccagtgagcatgaccaagacatccgtggactgcacaatgtacatctgtggagattccaccgagtgctctaacctgctgc tgcagtacggctctttctgtacccagctgaacagagccctgacaggaatcgctgtggagcaggacaagaacacacaggaggtgttc gcccaggtgaagcagatctacaagaccccacccatcaaggactttggcggattcaactttagccagatcctgcccgatcctagcaa gccatccaagaggtcttttatcgaggacctgctgttcaacaaggtgaccctggctgatgccggcttcatcaagcagtacggcgattgc ctgggagacatcgctgccagagacctgatctgtgcccagaagtttaacggactgaccgtgctgcctccactgctgacagatgagatg atcgctcagtacacatctgctctgctggccggcaccatcacaagcggatggaccttcggcgctggagctgccctgcagatcccctttg ccatgcagatggcttacagattcaacggcatcggagtgacccagaacgtgctgtacgagaaccagaagctgatcgccaaccagttt aactccgctatcggcaagatccaggactctctgagctccacagctagcgccctgggaaagctgcaggatgtggtgaaccagaacgc tcaggccctgaacaccctggtgaagcagctgtctagcaacttcggcgccatctcctctgtgctgaacgatatcctgagcaggctgga caaggtggaggctgaggtgcagatcgacaggctgatcacaggaagactgcagtccctgcagacctacgtgacacagcagctgatc agggctgctgagatcagggcttctgccaacctggctgccaccaagatgagcgagtgcgtgctgggccagtccaagagagtggactt ttgtggcaagggataccacctgatgagcttcccacagtccgcccctcacggagtggtgtttctgcacgtgacctacgtgccagctcag gagaagaacttcaccacagctcccgccatctgccacgatggcaaggcccactttcctcgggagggcgtgttcgtgagcaacggaac ccactggtttgtgacacagcgcaacttctacgagccacagatcatcaccacagacaacacattcgtgtccggcaactgtgacgtggt catcggaatcgtgaacaacaccgtgtacgatcctctgcagccagagctggactcttttaaggaggagctggataagtacttcaaga accacaccagccctgacgtggatctgggcgacatctctggaatcaacgccagcgtggtgaacatccagaaggagatcgaccggct gaacgaggtggctaagaacctgaacgagtccctgatcgatctgcaggagctgggcaagtacgagcagtacatcaagtggccctgg tacatctggctgggcttcatcgccggactgatcgctatcgtgatggtgaccatcatgctgtgctgtatgacaagctgctgttcctgcct gaagggctgctgttcttgtggaagctgctgtaagtttgacgaggacgatagcgagcctgtgctgaagggcgtgaagctgcactacac caagcttggatccggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacctatgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccg gcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccacc ctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatg cccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcg acaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacta caacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggac ggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctga gcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcact cacggcatggacgagctgtacaagtaa
Blake: Codon-optimized Spike sequence
Blue: P2A tag
Green: EGFP
Coding sequence of Nucleocapsid protein-3xHA
atgtctgataatggaccccaaaatcagcgaaatgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccagaat ggagaacgcagtggggcgcgatcaaaacaacgtcggccccaaggtttacccaataatactgcgtcttggttcaccgctctcactca acatggcaaggaagaccttaaattccctcgaggacaaggcgttccaattaacaccaatagcagtccagatgaccaaattggctact accgaagagctaccagacgaattcgtggtggtgacggtaaaatgaaagatctcagtccaagatggtatttctactacctaggaact gggccagaagctggacttccctatggtgctaacaaagacggcatcatatgggttgcaactgagggagccttgaatacaccaaaag atcacattggcacccgcaatcctgctaacaatgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacg cagaagggagcagaggcggcagtcaagcctcttctcgttcctcatcacgtagtcgcaacagttcaagaaattcaactccaggcagc agtaggggaacttctcctgctagaatggctggcaatggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttg agagcaaaatgtctggtaaaggccaacaacaacaaggccaaactgtcactaagaaatctgctgctgaggcttctaagaagcctcg gcaaaaacgtactgccactaaagcatacaatgtaacacaagctttcggcagacgtggtccagaacaaacccaaggaaattttggg gaccaggaactaatcagacaaggaactgattacaaacattggccgcaaattgcacaatttgcccccagcgcttcagcgttcttcgg aatgtcgcgcattggcatggaagtcacaccttcgggaacgtggttgacctacacaggtgccatcaaattggatgacaaagatccaa atttcaaagatcaagtcattttgctgaataagcatattgacgcatacaaaacattcccaccaacagagcctaaaaaggacaaaaag aagaaggctgatgaaactcaagccttaccgcagagacagaagaaacagcaaactgtgactcttcttcctgctgcagatttggatga tttctccaaacaattgcaacaatccatgagcagtgctgactcaactcaggccggtagttcctacccatacgatgttccagattacgct tatccctacgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaa
Black: Nucleocapsid protein
Blue: 3xHA tag
Coding sequence of Spike D614G-3XHA
atgtttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagat gattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttagg aagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggtttta attgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaact tctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaa caggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtc cgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaa ccaggttgctgttctttatcagggtgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttat tctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccat tggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctac actatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaa attctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgca atatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcaca agtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattggtagttcctacccatacgatgt tccagattacgcttatccctacgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaa
Black: part of the Spike sequence
Blue: 3xHa tag
Supplementary Figures legends
Supplementary Table 1. Single-nucleotide increment spacer sequence (DNA) of gRNAs covering the entire genome of SARS-CoV-2. The 30-nt spacer sequences were generated using inhouse script written in Python and are complementary to the target RNA. For each gRNA, we provide the matching location in the SARS-CoV-2 genome, the predicted secondary structure of the spacer and target sequences, and the corresponding predicted minimum free energy (kcal/mol). The data in this table are unfiltered and unranked.
Supplementary Table 2. Single-nucleotide increment spacer sequence of gRNAs covering the entire genome of SARS-CoV-2 are listed. The 30-nt spacer sequences are complementary to the target, and were generated using inhouse code written in Python. For each gRNA, we provide the matching coordinate in the SARS-CoV-2 genome, the predicted secondary structure of the spacer and target sequences, and the predicted minimum free energy (kcal/mol). The data in this table are filtered to remove spacer sequences that include 4 or more successive T residues that would prematurely terminate Pol III-driven spacer transcription and generate non-functional gRNAs. The gRNAs are ranked based on predicted secondary structures in the target and spacer sequence.
Supplementary Table 3. Top scoring 839 gRNAs with a predicted open secondary structure in the spacer and target sequences. These gRNAs are designed to fully base-pair with various regions of SRAS-CoV-2 genome and are predicted to achieve high silencing efficiency, given that Cas13b efficacy is governed by target accessibility.
Supplementary Table 4. All gRNAs used in this study are listed.
Suppl. Table 1
Suppl. Table 2
Suppl. Table 3
Acknowledgements
The authors thanks all lab members from the Trapani, Lewin, Voskoboinik, Subbarao, and Chirlmin Joo labs and VIDRL for facilitating experiments and discussions. This work was supported by the National Health and Medical Research Council (NHMRC) of Australia through a program grant to J.A.T, a program grant and practitioner fellowship to S.R.L. MF is supported by a PeterMac strategic plan funding in partnership with Childhood Cancer Institute Australia (CCIA).