New Results

Clinical positioning of the IAP antagonist tolinapant (ASTX660) in colorectal cancer

Nyree Crawford, Katie Stott, Tamas Sessler, Christopher McCann, William McDaid, Cheryl Latimer, Jennifer Fox, Joanne M Munck, Tomoko Smyth, Alpesh Shah, Vanessa Martins, Mark Lawler, Philip Dunne, Emma Kerr, Simon S McDade, Vicky Coyle, Daniel B Longley
doi: https://doi.org/10.1101/2020.11.20.391680

Abstract

Cancer cells frequently express elevated levels of Inhibitor of Apoptosis Proteins (IAPs): cIAPI, cIAP2 and XIAP. Elevated expression of cIAP1 and cIAP2 (but not XIAP) significantly correlated with poor prognosis in microsatellite stable (MSS) stage-III colorectal cancer (CRC) patients treated with adjuvant chemotherapy, suggesting their involvement in promoting resistance. Preclinical analysis of the IAP inhibitor tolinapant in CRC cell lines demonstrated robust on-target effects and caspase-8-dependent apoptosis that was inhibited by the caspase-8 paralogs FLIP and, unexpectedly, caspase-10. Importantly, tolinipant-induced apoptosis was augmented by standard-of-care chemotherapy (FOLFOX) in CRC disease models, due (at least in part) to FOLFOX-induced downregulation of Class-I histone deacetylases, leading to acetylation of the FLIP-binding partner Ku70 and downregulation of FLIP. Moreover, this effect could be phenocopied using a Class-I HDAC inhibitor. Further analyses revealed that caspase-8-knockout RIPK3-positive CRC models were sensitive to tolinostat-induced necroptosis, an effect that could be exploited with the FDA-approved caspase inhibitor emricasan. Our study provides evidence for immediate clinical exploration of tolinapant in combination with FOLFOX chemotherapy in poor prognosis MSS CRC with elevated cIAP1/2 expression.

Introduction

Colorectal cancer (CRC) is the second leading cause of cancer-related deaths in the Western world. In stage IV metastatic disease, 5-year and 10-year overall survival rates are <6% and <1% respectively [1]. Fluoropyrimidine-based chemotherapy is the mainstay of standard-of-care (SoC) treatment for CRC in both early and advanced disease. However in early stage disease, the benefit of fluoropyrimidine monotherapy is limited, with overall survival gains of less than 5% [2] and 10-15% [3] reported for Stage II and III disease respectively, with a small additional survival gain for use in combination with oxaliplatin [4]. Improved approaches are therefore urgently needed not only for the treatment of advanced CRC, but also in the adjuvant disease setting for those patients who are destined to relapse but whose disease is resistant to SoC chemotherapy.

Cancer cells are frequently ‘addicted’ to a small number of anti-apoptotic proteins that are necessary for their survival. These include the Inhibitor of Apoptosis Proteins (IAPs), cIAP1, cIAP2 and XIAP [5]. XIAP directly binds to, and inhibits the activation of, caspases-3, −7 and −9 [6]. cIAP1 and cIAP2 act as E3 ubiquitin ligases at Complex I which is formed following binding of the pro-inflammatory cytokine, TNFα, to TNF receptor 1 (TNFR1). cIAP1 and cIAP2 polyubiquitinate RIPK1 resulting in the activation of the canonical nuclear factor-κB (NFκB) signalling pathway [7], which in turn results in the transcription of anti-apoptotic proteins, including cIAP1, cIAP2 and inflammatory cytokines (including TNFα itself) in a pro-survival/inflammatory feedforward loop [8, 9]. Complex I dissociates following deubiquitination of RIPK1 to form the death-inducing platform, Complex IIa composed of FADD, RIPK1, TRADD and procaspase-8 [10]. In the absence of cIAPs, RIPK1 is not polyubiquitinated, and the cell death inducing platform complex IIb (containing of FADD, RIPK1 and caspase-8) is formed, which can also activate cell death. Hence targeting IAPs have potential to both activate cell death and inhibit anti-apoptotic and pro-inflammatory signalling.

Multiple peptidomimetic IAP antagonists based on the endogenous inhibitor SMAC (second mitochondrial activator of caspases) have been explored in the clinical setting. These compounds have inherent selectivity for cIAP1 over XIAP. Tolinapant (ASTX660) (Astex Pharmaceuticals) is a novel, non-peptidomimetic IAP antagonist with balanced nanomolar potency against cIAP1/2 and XIAP that was discovered utilising fragment-based drug design [11]. The first-in-human phase 1 trial of tolinapant indicated a manageable safety profile and had evidence of clinical activity; phase 2 studies are ongoing (NCT02503423) [12].

In this study, we assessed the activity of tolinapant in pre-clinical models of CRC as a single agent and in combination with both SoC chemotherapeutics and novel therapies rationally selected based on mechanistic insights.

Results

Elevated cIAP1 and cIAP2 expression correlates with worse prognosis of MSS stage-III CRC patients treated with adjuvant chemotherapy

Analysis of CRC patients [13] revealed that elevated expression of cIAP1/BIRC2 (HR=0.47; p=0.05) and cIAP2/BIRC3 (HR=0.34; p=0.009)(which are normally distributed (Figure S1A)), but not XIAP/XIAP correlated with worse overall survival (OS) in MSS stage-III patients treated with chemotherapy post-surgery (adjuvant chemotherapy) (Figure 1A and Figure S1B), whereas no significant association between IAP expression and patient survival in stage-II disease, nor in stage-III patients treated by surgery alone (data not shown). While cIAP-1 and cIAP-2 expression were significantly correlated (Pearson’s r = 0.47, p = 1.3e(−8)), not all cIAP1-high tumors were also cIAP2-high (Figure 1C and S1C). Single sample gene set enrichment analyses (ssGSEA) comparing cIAP-1-or cIAP-2-high and -low groups identified significant enrichments for several key inflammatory signalling pathways in both the cIAP1- and cIAP2-high groups, including “TNFα signalling via NFκB” and other inflammatory pathways (Figure 1B/C). Consistent with this, the tumours from the cIAP1- and cIAP2-high groups were enriched for the presence of several key immune cell types, with significant enrichment of CD4+ memory T cells, TH2 cells and M1 polarised macrophages in both groups (Figure 1D/E). In addition to apoptosis signalling, there was also a significant enrichment for KRAS signalling in both the cIAP1- and cIAP2-high groups (Figure 1B). IAP expression was not higher in KRAS mutant tumours (and was not correlated with TP53 or BRAF mutations; Figure S1C/D), indicating that the correlations between cIAP1/2 expression and survival (Figure 1A) are not due to enrichment for KRAS mutant tumours, which have a worse, but not significantly worse prognosis in this MSS stage-III cohort (Figure S1E).

Figure 1:
Figure 1:

Analysis of MSS, Stage III patients who received adjuvant fluorouracil-based treatment extracted from GSE39582 cohort. A) Kaplan-Meier plots of 5-year overall survival. Graphs comparing the difference in survival probability based on BIRC2 and BIRC3 expression levels alone. Results are shown with the log-rank test, the hazard ratio (HR) with its 95% confidential interval and the Wald test of significance. B-E) Difference of pathway activation by B) ssGSEA and D) cell type profiling by xCELL between cIAP1 or cIAP2 high and low expressing patients was assessed by one-way anova model. Numbers shown are the calculated p values. Heatmap were drawn showing the Z-scores of the significantly different C) ssGSEA pathways and E) immune or stroma infiltration by xCELL.

Sensitivity of CRC cell lines to tolinapant in vitro and in vivo

The analysis of the clinical cohort suggested potential for cIAP1 and cIAP2 as potential therapeutic targets for improving the efficacy of standard-of-care chemotherapy in MSS stage-III disease. We therefore next assessed the cell death inducing activity of the novel IAP antagonist tolinapant by screening a panel of 36 CRC cell lines alone or in the presence of low concentrations of TNFα (Figure 2A); to reflect the enrichment for TNFα signalling in the cIAP1/2-high groups (Figure 1B/C) and the presence of immune cells such as M1 macrophages (Figure 1D/E), which are rich sources of TNFα [14]. In the absence of TNFα, tolinpant had modest growth inhibitory effects across the panel, whereas in the presence of TNFα, a high number of cell lines exhibited significant sensitivity to tolinpant (Figure 2A). These effects were further assessed in a subset of CRC cell line models with a range of sensitivities (Figure S2A), each of which expressed all the components of the TNFR1 Complex-II interactome and XIAP at the protein level (albeit to varying levels; Figure 2B) as well as cell surface TNFR1 (Figure 2C). On-target activity of tolinapant as evidenced by degradation of cIAP1 (the pharmacodynamic (PD) biomarker for IAP antagonists), was confirmed at nM potency in all 5 models (Figure 2D and Figure S2B); whereas cIAP2 was also downregulated (albeit to a lesser extent than cIAP1) by tolinapant in 3/5 models. XIAP was unaffected, consistent with the expected effects of IAP antagonists which disrupt XIAP’s protein-protein interactions with caspases-3, −7 and −9, but do not typically cause XIAP degradation [15]. Downregulation of cIAP1 in response to tolinapant, which is a result of triggering its auto-ubiquitination and degradation via the proteasome [16], was found to be rapid and sustained (Figure S2C). Loss of IAPs has been widely reported to result in the formation of the cell death platform, Complex-II [17]. In the presence of TNFα, tolinapant indeed promoted the formation of complex-II as evidenced by the interaction of caspase-8 with RIPK1; this was also detected in response to tolinapant alone in 3/5 models HCT116, HT29 and LoVo cells albeit to a much lower level than in response to tolinapant/TNFα (Figure 2E and Figure S2D).

Figure 2:
Figure 2:

A) Cell viability assay in 36 CRC cell line panel following 72h treatment with tolinapant(tolin) (10 point assay 0.0005 – 10μM) alone and in combination with TNFα (1ng/ml), represented as relative activity area (%), calculated as (experimental AUC)/max AUC possible). Cell lines categorized as sensitive to tolinapant/TNFα are highlighted in green, intermediate in white and resistant in orange. B) Western blot analysis of basal expression of FLIP(L), FLIP(S), Mcl-1, cIAP1, cIAP2, XIAP, BAX, SMAC, RIPK1, FADD, Procaspase-8, Procaspase-10, RIPK3 and MLKL and β-actin in a panel of CRC cell lines. C) Cell surface expression of TNFR1 in DLD1, SW620, LoVo, HT29 and HCT116 cell lines, represented as % of TNFR1 positive cells compared to an IgG isotype control. D) Western blot analysis of cIAP1, cIAP2, XIAP and β-actin in HCT116, HT29 and DLD-1 cells following treatment with 1μM, 100nM, 10nM, 1nM and 0.1nM tolinapant for 24h. E) Western blot analysis of RIPK1 and procaspase-8 following immunoprecipitation of caspase-8 from HCT116, HT29 and DLD-1 cells treated with 1ng/ml TNFα, 1μM tolinapant and a combination of TNFα/ tolinapant for 3h in the presence of 20μM z-VAD-fmk. An IgG isotype control was used as a control. F) AnnexinV/PI analysis in HCT116, HT29 and DLD-1 cells following treatment with 1ng/ml TNFα, 1μM tolinapant or a combination of TNFα/tolinapant for 24h. G) Tumor volume (mm3) in HCT116, HT29 and DLD-1 xenograft models treated with vehicle and 16mg/kg tolinapant. Data shows mean tumor volume per treatment group per timepoint ± sem (HCT116; Vehicle n=10, tolinapant n=10, HT29; Vehicle n=7, tolinapant n=7, SW620; Vehicle n=10, tolinapant n=12). Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

In agreement with the cell line screen, significant cell death measured by Annexin-V/PI flow cytometry, was observed in response to tolinapant in the presence of TNFα in the HCT116 model (Figure 2F). Similar results were observed in the HT29 model, albeit the extent of cell death at 24h was less; however, lower levels of cell death were observed in the DLD-1 model despite complex-II formation (Figure 2E/F). In the in vivo setting, we hypothesised that murine TNFα (as well as xenograft-derived human TNFα) could potentially drive complex-II formation as murine TNFα can bind the human TNFR1 [18]. Moreover, IAP antagonists have been reported to promote production of TNFα by monocytic cells [19]. Significant albeit limited retardations of tumor growth were observed in HCT116 and HT29 xenografts but not DLD-1, results which were in line with the relative in vitro sensitivity of these models (Figure 2G).

Standard-of-care chemotherapy enhances sensitivity to tolinapant

Having established the effects of tolinapant/TNFα combinations, we next evaluated whether the addition of SoC chemotherapy FOLFOX (5-Fluorouracil plus Oxaliplatin) could increase sensitivity to tolinapant. Statistically significant enhancement of FOLFOX-induced apoptosis was observed in 3/5 models (HCT116, SW620 and HT29) co-treated and tolinapant/TNFα (Figure 3A/B). Indeed, tolinapant alone also significantly enhanced FOLFOX-induced apoptosis in the HCT116 and SW620 models, albeit to a lesser extent than in the tolinapant/TNFα combination group (Figure 3A/B). In contrast, the DLD1 model was relatively resistant to the combination (Figure S3A), whereas interestingly, LoVo cells, which were relatively insensitive to the tolinapant/TNFα combination alone, exhibited significantly increased chemotherapy-induced apoptosis when co-treated with tolinapant alone as well as tolinapant/TNFα (Figure S3A/B). These results were reflected by qualitative assessment of apoptosis by PARP cleavage (Figure 3B/S3B).

Figure 3:
Figure 3:

A) AnnexinV/PI analysis in HCT116, SW620 and HT29 cells treated with 1ng/ml TNFα, 1μM tolinapant or a combination of tolinapant/TNFα in the presence and absence of 5μM 5FU and 1μM oxaliplatin (OX) for 72h. B) Western blot analysis of PARP, cIAP2, cIAP1, XIAP, FLIP(L), FLIP(S) and β-actin in HCT116, SW620 and HT29 cells treated with 5μM 5FU and 1μM oxaliplatin(FOLFOX), 1μM tolinapant and a combination of FOLFOX/tolinapant (COMBO) for 24h and 48h. C) Pictures from AKP and AK organoids treated with 1μM tolinapant/1ng/ml TNFα (tolin/TNF), 5μM 5FU and 1μM oxaliplatin (FF) or combination (COMBO) for 72h. Diameter in arbitrary units (AU) from AKP (n=75 for each treatment group) and AK (n=75 for each treatment group) organoids treated with 1μM tolinapant/1ng/ml TNFα (tolin/TNF), 5μM 5FU and 1μM oxaliplatin (FOLFOX) or combination (COMBO) for 72h. D) Cell viability assays in AKP and AK organoids treated with 1μM tolinapant/1ng/ml TNFα (tolin/TNF), 5μM 5FU and 1μM oxaliplatin (FOLFOX) or combination (COMBO) for 72h. E) Western blot analysis of basal expression of cIAP1, p53 and β-actin in AK and AKP organoids. Western blot analysis of cIAP1 and β-actin in AK and AKP organoids treated with 1μM tolinapant for 24h. F) Tumor volume (mm3) of AKP organoids transplanted into C57BL/6 mice treated with Vehicle (n=3), 5FU(10mg/kg) + oxaliplatin(1mg/kg) (FOLFOX)(n=4), tolinapant(16mg/kg)(n=4) and combination(n=4). Data shows mean tumor volume per treatment group per timepoint ± sem. G) Densitometry from Western blot analysis of cIAP1 normalised to β-actin in AKP organoids transplanted into C57BL/6 mice and treated with Vehicle and 16mg/kg tolinapant. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

We extended these studies to Apc-null, Kras-mutant murine CRC organoid models [20-22]. We also examined the impact of p53 status given the high frequency of its mutation in advanced CRC. We observed striking combinatorial effects when both p53-proficient “AK” and p53-deficient “AKP” organoids were co-treated with FOLFOX and tolinapant/TNFα (Figure 3C/3D). cIAP1 expression was similar in the 2 organoid models, and tolinapant effectively targeted murine cIAP1 (Figure 3E). Taking the AKP model into the in vivo setting in immune-competent syngeneic mice, we found that the combination treatment of FOLFOX/tolinapant resulted in significant tumor regression compared to the individual treatments (Figure 3F), and in vivo on-target activity of tolinapant was confirmed (Figure 3G).

FLIP downregulation in response to FOLFOX sensitises CRC cells to tolinapant

We and others have previously demonstrated the importance of the caspase-8 paralog and regulator FLIP/CFLAR as a key mediator of resistance to IAP inhibitors in multiple cancers [23, 24]. Intriguingly, protein expression of the caspase-8 inhibitory short FLIP splice form (FLIP(S)) and XIAP were significantly reduced following FOLFOX treatment in all 5 models (Figure 3B and Figure S3B). However, as tolinapant is also active against XIAP [25], we hypothesized that the impact of FOLFOX on FLIP was more likely to be responsible for the enhanced effects of tolinapant in FOLFOX-treated CRC cells, particularly in the HCT116 and SW620 KRAS mutant models where FLIP downregulation and the extent of synergy were most marked. Moreover, high FLIP mRNA expression corresponded with resistance to tolinapant/TNFα in the extended cell line panel (Figure 2A/4A), further supporting the importance of FLIP in modulating response to tolinapant in CRC cells. Somewhat surprisingly, models with high caspase-8 mRNA expression were also more resistant to tolinapant/TNFα, although this can be at least in part explained by the close correlation between caspase-8 and FLIP mRNA expression which are encoded on the same genomic locus (Figure 4A). Consistent with a role for FLIP in mediating resistance to tolinapant/TNFα, RNAi-mediated downregulation of FLIP significantly enhanced the induction of apoptosis by tolinapant/TNFα in all but the LoVo model as assessed in short-term cell death (Figure 4B) and longer-term cell viability (Figure 4C) assays; moreover, these results were confirmed qualitatively by Western blot analysis of PARP cleavage (Figure 4D/S3C).

Figure 4:
Figure 4:

A) Expression of Caspase-8 and FLIP mRNA (log2(TPM (transcripts per million) + 1) in CRC cell lines categorised as sensitive or resistant to tolinapant/TNFα in the cell line screen in Figure 2A. B) AnnexinV/PI analysis in HCT116, SW620, HT29, DLD-1 and LoVo cells transfected with Control (SCR) and FLIP(T) siRNA for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. C) Cell viability assays in HCT116, SW620, HT29, DLD-1 and LoVo cells transfected with Control (SCR) and FLIP(T) siRNA for 6h prior to treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. D) Western blot analysis of PARP, FLIP(L), FLIP(S), cIAP1 and β-actin and in HCT116, SW620 and HT29 cells transfected with Control (SCR) and FLIP(T) siRNA for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Together these results suggest that FLIP acts as a key mediator of resistance to tolinapant in CRC cells, consistent with downregulation of FLIP being a major contributor to the enhanced efficacy of tolinapant in FOLFOX-treated cells. To formally assess this, we made use of HCT116 cell line models stably expressing retroviral trans-genes encoding either FLIP(L), FLIP(S) or a FADD binding deficient mutant form of FLIP(S) (F114A) compromised in its ability to inhibit procaspase-8 homodimerization (Figure 5A) [26]. Overexpression of FLIP(S), the more potent caspase-8 inhibitory form of FLIP [27], significantly abrogated apoptosis induced by FOLFOX in combination with tolinapant/TNFα (Figure 5B), whereas expression of the FLIP(L) trans-gene failed to protect HCT116 cells from apoptosis induced by FOLFOX in combination with tolinapant/TNFα (likely due in part to the relatively small degree of FLIP(L) overexpression in this model; Figure 5A). Overexpression of the F114A mutant of FLIP(S) failed to confer protection, indicating that it is FLIP(S)’s interaction with FADD that blocks caspase-8-dependent apoptosis in response to FOLFOX combination with tolinapant/TNFα.

Figure 5:
Figure 5:

A) Western blot analysis of FLIP(L), FLIP(S) and β-actin in HCT116 cells retrovirally overexpressing (o/e) pbabe empty vector (EV), pbabe FLIP(S), pbabe FLIP(S) F114A and pbabe FLIP(L). B) AnnexinV/PI analysis of in HCT116 cells retrovirally overexpressing (o/e) pbabe empty vector (EV), pbabe FLIP(S), pbabe FLIP(S) F114A and pbabe FLIP(L) following treatment with 1μM tolinapant/1ng/ml TNFα, 5μM 5FU and 1μM oxaliplatin (FOLFOX) or combination for 48h. C) Western blot analysis of PARP, cIAP1, FLIP(L), FLIP(S), Procaspase-8, Procaspase-10 and β-actin in HCT116 WT and HCT116 Caspase 8 KO cells treated with 1μM tolinapant/1ng/ml TNFα (tolin/TNFα), 5μM 5FU and 1μM oxaliplatin (FF) or combination for 48h. D) AnnexinV/PI analysis in HCT116 WT and HCT116 Caspase 8 KO cells treated with 1μM tolinapant/1ng/ml TNFα, 5μM 5FU and 1μM oxaliplatin (FOLFOX) or combination for 72h. E) Western blot analysis of Procaspase-10, PARP, cleaved caspase-3, FLIP(L), FLIP(S), cIAP1 and β-actin in HCT116 and DLD1 cells transfected with Control (SCR) and caspase-10(siC10) siRNA for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. F) Caspase3/7 activity assay in HCT116 cells transfected with Control (SCR) and caspase-10 siRNA (siC10) for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα (tolin/TNFα) for a further 24h. G) Western blot analysis of Procaspase-10, procaspase-8 and β-actin in HCT116 WT, HCT116 Caspase 8 KO, HCT116 Caspase 10 KO and HCT116 Caspase8/Caspase10 DKO cells. H) AnnexinV/PI analysis in HCT116 WT and HCT116 Caspase 8 KO, HCT116 Caspase 10 KO and HCT116 Caspase8/Caspase10 DKO cells treated with 1μM tolinapant/1ng/ml TNFα, 5μM 5FU and 1μM oxaliplatin (FOLFOX) or combination for 48h.

Compared to a HCT116 caspase-8 CRISPR knockout model in which cell death induced by the tolinapant/TNFα-FOLFOX combination was almost completely abrogated (Figure 5C/D), significant cell death was still observed in response to the combination in the FLIP(S) overexpressing model (Figure 5B), suggesting that additional factors other than FLIP downregulation contribute to the effects of the combination. The role of caspase-8’s other paralog caspase-10/CASP10 as a regulator of apoptotic cell death is controversial, with both pro- and anti-apoptotic roles described [28-30]. We found that co-treatment of HCT116 cells with tolinapant/TNFα/FOLFOX dramatically reduced the levels of procaspase-10 expression (Figure 5C). Loss of the pro-form of procaspases can be indicative of activation and suggested participation of procaspase-10 in the overall mechanism of apoptosis induction. However, in the absence of procaspase-8, relatively little decrease of procaspase-10 was observed (Figure 5C). In contrast to the protective effect of loss of procaspase-8, we found that rather than attenuating cell death, siRNA-mediated downregulation of procaspase-10 significantly enhanced PARP cleavage and executioner caspase activation in response to tolinapant/TNFα (Figure 5E/F). To further investigate this, we generated CRISPR models with either procaspase-8, procaspase-10 or both knocked out (Figure 5G). In agreement with the RNAi results, knockout of procaspase-10 enhanced apoptosis induction in response to tolinapant/TNFα in the presence of caspase-8 (Figure 5H). These results reveal a hitherto unreported role for procaspase-10 in inhibiting the apoptotic response to IAP antagonists. Furthermore, this is consistent with SW620 cells, which exhibit the lowest levels of procaspase-10 expression, being the most sensitive to tolinapant/TNFα, while DLD-1 cells, with the highest levels of procaspase-10, are highly resistant (Figure 2B and Figure 2F). Indeed, siRNA-mediated depletion of procaspase-10 also enhanced the sensitivity of DLD-1 cells to tolinapant/TNFα (Figure 5E).

Mechanism of FLIP downregulation in response to FOLFOX

Mechanistically, the effects of FOLFOX on FLIP expression were not due to suppression of transcription; indeed, mRNA expression of FLIP(S) was upregulated at 24h by ~2-fold and FLIP(L) was upregulated by ~5-fold at 48h (Figure 6A). Inhibition of histone deacetylases (HDACs) has previously been reported by us and others to result in reduced expression of both splice forms of FLIP, at transcriptional and post-translational levels and augment cell death induced by activators of extrinsic cell death [30-32]. It was therefore notable that FOLFOX treatment downregulated expression of the Class-I HDACs (HDAC-1, −2 and −3) as did tolinapant/TNFα (Figure 6B). Moreover, down-regulation of HDAC1 and HDAC3 by both FOLFOX and tolinapant/TNFα was attenuated in CASP8-null cells, indicating that these effects are caspase-8-dependent and therefore potentially consequences of apoptosis initiation. In contrast, FOLFOX-mediated downregulation of HDAC2 was caspase-8-independent, suggesting that this is an event upstream of apoptosis initiation.

Figure 6:
Figure 6:

A) qPCR analysis of FLIP(L) and FLIP(S) normalised to 18S in HCT116 cells treated with 5μM 5FU and 1μM oxaliplatin for 24h and 48h, relative to untreated control. B) Western blot analysis of HDAC1, HDAC2, HDAC3 and β-actin in HCT116 WT and HCT116 Caspase 8 KO cells treated with 1μM tolinapant/1ng/ml TNFα (tolin/TNFα), 5μM 5FU and 1μM oxaliplatin (FF) or combination for 48h. C) Western blot analysis of Ku70 following immunoprecipitation of Acetylated Lysine (AcK) from HCT116 cells treated with 5μM 5FU and 1μM oxaliplatin (FOLFOX) for 24h. An IgG isotype control was used as a control. D) Western blot analysis of Ku70, FLIP(L), FLIP(S), Procaspase-10, PARP, cIAP1, CIAP2, XIAP and β-actin and in HCT116 cells transfected with Control (SCR) and Ku70 siRNA (siKU70) for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα (tolin/TNFα) for a further 24h. E) Caspase3/7 activity assay in HCT116 cells transfected with Control (SCR) and Ku70 siRNA (siKU70) for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα (tolin/TNFα) for a further 24h. F) Western blot analysis of Ku70 following immunoprecipitation of Acetylated Lysine (AcK) from HCT116 cells treated with 2.5μM entinostat for 24h. An IgG isotype control was used as a control. G) Western blot analysis of PARP, cIAP1, FLIP(L), FLIP(S), Hyper Acetyl H4 and β-actin in HCT116 and HT29 cells treated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. H) AnnexinV/PI analysis in HCT116, HT29 and SW620 cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. I) Cell viability assay in HCT116 cells retrovirally overexpressing (o/e) pbabe empty vector (EV), pbabe FLIP(S) and pbabe FLIP(L) following pretreatment with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. J) Tumor volume (mm3) in a MC38 syngeneic model treated with Vehicle, entinostat (15mg/kg), tolinapant (16mg/kg) and entinostat/tolinapant combination. Data shows mean tumor volume per treatment group per timepoint ± sem, n=10 for each treatment group.

We previously found that HDAC inhibitors modulate FLIP expression at the post-transcriptional level by inducing acetylation of Ku70, a central component of the non-homologous end-joining (NHEJ) DNA damage repair pathway [32]. In its non-acetylated form, Ku70 binds FLIP and inhibits its proteasomal degradation; however its acetylation in response to HDAC inhibitors blocks this interaction, leading to FLIP degradation. It was therefore notable that FOLFOX caused significant Ku70 acetylation (Figure 6C). Moreover, silencing Ku70 not only resulted in decreased levels of FLIP, it also enhanced apoptosis induced by tolinapant/TNFα as assessed by PARP cleavage (Figure 6D) and executioner caspase activation (Figure 6E).

We also found that entinostat, a Class-I histone deacetylase inhibitor potently induced acetylation of Ku70 (Figure 6F) and resulted in downregulation of FLIP(L) and FLIP(S) in all 5 CRC cell lines (Figure S4A). Consistent with the effects of FOLFOX and siFLIP, treatment with entinostat resulted in significant sensitisation of HCT116, HT29 and SW620 cells to apoptotic induction by tolinapant/TNFα (Figure 6G/H). Similar results were observed in DLD-1 cells; however, LoVo cells remained resistant to tolinapant/TNFα (Figure S4B/C), consistent with their lack of sensitization by FLIP silencing (Figure 4B and Figure S3C). Overexpression of either FLIP(L) or FLIP(S) (Figure 6I) abrogated the sensitisation of HCT116 cells to tolinapant/TNFα by entinostat (Figure 6H), indicating that entinostat-mediated sensitization is more FLIP-dependent than FOLFOX-mediated sensitization, which was only inhibited by the more highly overexpressed and more potent caspase-8 inhibitor FLIP(S) (Figure 5B). Moreover, HCT116 and DLD-1 cells deficient in caspase-8 were resistant to cell death induced by the entinostat/tolinapant/TNFα combination (Figure S4D) as was an HCT116 FADD-deficient model (Figure S4E).

MC38 murine CRC cancer cells were relatively resistant to tolinapant/TNFα, but were sensitized by FLIP downregulation using siRNA (Figure S5A/B/C). Moreover, pre-treatment with entinostat enhanced sensitivity to tolinapant/TNFα in vitro (Figure S5D), and the combination of entinostat/tolinapant was well tolerated in vivo (Figure S5E) and resulted in significant tumor retardation compared to either monotherapy (Figure 6J). Furthermore, in both the AKP and AK mouse organoid models, entinostat also enhanced the tolinapant/TNFα-induced reduction in organoid size, with the combined effects more marked in the p53-deficient AKP model (Figure S5F/G). Overall, these results indicate that Class-I HDAC inhibitors are potential combination partners for tolinapant in CRCs in which FLIP inhibits efficacy.

Loss or inhibition of caspase-8 leads to necroptosis induction in response to tolinapant/TNFα in RIPK3 positive CRC models

Entinostat was also shown to sensitise HT29 WT cells to tolinapant/TNFα (Figure 7A); however, unlike the rescue that was observed in HCT116 and DLD-1 cells (Figure S4D), CRISPR-knockout of caspase-8 in HT29 cells resulted in enhanced sensitivity to tolinapant/TNFα (and tolinapant alone), even in the absence of entinostat (Figure 7A). This effect was abrogated by the necroptosis inhibitor, necrosulfonamide, but not by the pan-caspase inhibitor zVAD, indicating that it is due to the induction of necroptosis rather than apoptosis (Figure S6A). Necroptosis is a pro-inflammatory, RIPK1/RIPK3-dependent, but caspase-independent form of programmed cell death. Of the human CRC cell lines profiled for tolinapant activity, only HT29 and SW620 cells expressed RIPK3 at the protein (Figure 2B) and mRNA levels (Figure S6B). Necroptosis induction was also observed in SW620 CASP8 KO cells (Figure S6C). These results were further supported by Western blot analyses, which demonstrated phosphorylation of RIPK1, RIPK3 and the effector of necroptosis, MLKL (mixed lineage kinase domain-like) in caspase-8-deficient HT29 (Figure 7B) and SW620 cells (Figure S6D). Moreover, direct assessment of cell death (propidium iodide positivity) further confirmed that the mechanism of cell death induced by tolinapant/TNFα in caspase-8-deificent HT29 (Figure 7C) and SW620 cells (Figure S6E) was via necroptosis. Furthermore, FADD-deficient HT29 cells were also sensitive to tolinapant/TNFα, a cell death phenotype that was not rescued through inhibition of caspases (Figure S6F).

Figure 7:
Figure 7:

A) Cell viability assays in HT29 Caspase 8 WT and HT29 Caspase 8 KO cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. B) Western blot analysis of PARP, p-MLKL(Ser358), Total MLKL, p-RIPK3(Ser227), Total RIPK3, p-RIPK1(Ser166), Total RIPK1, cIAP1, Caspase 8 and β-actin in HT29 Caspase 8 WT and HT29 Caspase 8 KO cells 24h following treatment with 1μM tolinapant and 1ng/ml TNFα. C) Propidium Iodide analysis in HT29 Caspase 8 WT and HT29 Caspase 8 KO cells pretreated for 30 minutes with 10μM z-VAD and 2μM necrosulfonamide then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. D) AnnexinV/PI analysis in HT29 cells pretreated with 10μM z-VAD, 5μM emricasan or 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. E) Western blot analysis of p-MLKL(Ser358), Total MLKL, p-RIPK3(Ser227), Total RIPK3, p-RIPK1(Ser166), Total RIPK1, cIAP1 and β-actin in HT29 cells pretreated with 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. F) Pictures from AK and AKP organoids pretreated with 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 48h. G) Western blot analysis of p-RIPK3(Thr231/Ser232), Total RIPK3, cIAP1 and β-actin in AKP organoids pretreated with 10μM Necrostatin-1 and 10μM emricasan (Emri) for 30 minutes before the addition of 1μM tolinapant and 1ng/ml TNFα (tolin/TNF) for 24h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Notably, the pan-caspase inhibitor zVAD induced necroptotic cell death in response to tolinapant/TNFα in parental HT29 cells (Figure 7C and S7A), but was less efficient at doing so in SW620 cells (Figure S6C/E). zVAD also sensitized AK and AKP mouse organoids to tolinapant/TNFα (Figure S7B). We therefore investigated the potential of caspase inhibition as a combination partner for tolinapant in RIPK3-positive CRC using emricasan (IDN-6556), a pan-caspase inhibitor already under evaluation in clinical trials in chronic liver disease [33, 34]. Pre-treatment of HT29 or SW620 cells with emricasan resulted in marked sensitisation to necroptosis induced by tolinapant/TNFα (Figure 7D/E and Figure S7C-E) and was considerably more efficacious than zVAD. These findings were mirrored in the AK and AKP mouse organoid models, where significant combinatorial effects and necroptotic pathway activation were also observed (Figure 7F/G and Figure S7F).

Discussion

CRC is the second leading cause of cancer deaths in the Western world, with resistance to programmed cell death contributing to treatment failure [35]. Multiple IAPs are overexpressed in CRC and correlate with therapy resistance and poorer survival rates, making them an attractive target for cancer therapy [36, 37]. Here, we report that stage-III chemotherapy-treated patients with MSS colorectal tumours with elevated expression of cIAP1 or cIAP2 (but not XIAP) have a poor prognosis. This finding makes cIAP1/2-high MSS CRC an attractive subpopulation for IAP-targeted therapeutics.

Pre-clinically, IAP antagonists, including tolinapant, synergise with multiple anti-cancer therapies, including radiotherapy, chemotherapy, TRAIL receptor agonists and hypomethylating agents as well as showing promise in combination with PD-1/PD-L1 blockade [38, 39]. Overall, despite demonstrating potent on-target activity through rapid and sustained downregulation of cIAP1, CRC cell lines showed a limited response to tolinapant alone, although sensitivity was significantly enhanced in many cell lines in the context of a modelled pro-inflammatory microenvironment (co-treatment with TNFα). Moreover, we found that tolinapant/TNFα enhanced cell death induced by FOLFOX, the SoC regimen for CRC, in several human and mouse CRC models in vitro, with preclinical anti-tumour activity also demonstrated in vivo, suggesting its potential in combination with SoC chemotherapy.

Mechanistically, FOLFOX downregulated expression of FLIP, a pseudo-enzyme paralog of caspase-8 leading to enhanced caspase-8-dependent cell death in response to tolinapant. FLIP negatively regulates apoptosis induction from complex II by inhibiting procaspase-8 homo-dimerization, a prerequisite for the latter’s activation to its apoptosis-inducing catalytic form [17, 40]. The caspase-8/FLIP(L) heterodimer also has catalytic activity, which can inhibit necroptotic signalling from complex IIa/b through the cleavage and inactivation of RIPK1/3 [41]. We and others have previously identified FLIP as a mediator of resistance to IAP antagonist therapy in multiple cancers, including mesothelioma and castrate-resistant prostate cancer [23, 24]. Class-I HDACs (HDAC1/2/3) have been found to be overexpressed in CRC and promote resistance to chemotherapy [42]. Here, we found that FOLFOX treatment resulted in downregulation of the Class-I HDACs and acetylation of their substrate Ku70, an essential component of the non-homologous end-joining DNA damage repair machinery that repairs double-strand breaks, including those induced by DNA damaging chemotherapy, such as FOLFOX [43]. We have previously reported that Ku70 binds to and enhances FLIP stability when in its non-acetylated form [32], a finding corroborated by others [44]. Consistent with this, silencing Ku70 resulted in FLIP downregulation and enhancement of tolinapant/TNFα-induced cell death. Moreover, the oral Class-I HDAC inhibitor, entinostat, which is well-tolerated in humans, also acetylated Ku70 and downregulated FLIP expression resulting in sensitisation to tolinapant in the majority of CRC models. Of note, this combination was well-tolerated in vivo and retarded the growth of the MC38 murine CRC model, suggesting potential for Class-I HDAC inhibitors as combination partners for IAP inhibitors in CRC.

Procaspase-10 shares significant homology with procaspase-8: they are 46% identical in their catalytic domains [45], and overexpression of procaspase-10 splice forms 10A and 10D has been shown to re-sensitize caspase-8-deficient cells to TRAIL [28]. However, caspase-10 has also been shown to inhibit caspase-8 activation by the Fas/CD95 death receptor, supporting earlier studies in which it was shown that the caspase-8/-10 heterodimer is inactive [29, 46]. Our mechanistic studies are consistent with an inhibitory role for procaspase-10 in regulating apoptosis signalling from the death complexes induced by tolinapant/TNFα. To our knowledge, this is the first study to identify caspase-10 as an inhibitor of Complex-IIa/b.

Necroptosis induced by TNFα signalling is a caspase-independent form of programmed cell death, dependent on RIPK1, RIPK3 and MLKL [47-49]. Necroptosis, unlike apoptosis, results in the activation of inflammatory responses through the release of damage associated molecular patterns (DAMPS) from dying cells, which promote anti-tumor immunity through recruitment of inflammatory cells, maturation of dendritic cells and elicit cross priming of CD8+ T cells [50, 51]. RIPK3 expression is lost in multiple cancers, including many CRCs, and correlates with cancer progression [52-54]. Loss of RIPK3 expression and necroptosis resistance is correlated with BRAF gain-of-function mutations, AXL overexpression and RIPK3 promoter hypermethylation [55]. CRISPR-mediated knockout of caspase-8 or FADD in RIPK3-positive CRC models resulted in dramatic induction of necroptosis by tolinapant/TNFα. Thus, if clinical resistance to FOLFOX/tolinapant combination therapy emerges due to procaspase-8 or FADD mutations, BRAF inhibitors, AXL inhibitors or epigenetic modifying agents that upregulate RIPK3 expression may make these resistant tumor cells sensitive to tolinapant-induced necroptosis.

Emricasan is an orally active caspase inhibitor that is well-tolerated in humans [33, 56]. We found that tolinapant and emrciasan co-treatment potently activated necroptosis in the presence of TNFα, but only in RIPK3-positive CRC models. Compared to zVAD, emricasan is a more potent inhibitor of the enzymatic activity of the caspase-8/FLIP(L) heterodimer that cleaves RIPK1 [57]. Our data suggest that tolinapant/emricasan combinations may be effective in pro-inflammatory, RIPK3-positive CRCs.

Multiple IAP antagonists, including tolinapant, are currently in clinical trials, and single agent clinical response was observed predominantly in lymphoma for tolinapant while responses in solid tumours were more limited [12]. Here, we have highlighted the potential of combining tolinapant with FOLFOX in CRC. This is relevant to the majority of patients with CRC as MSS is the predominant disease subgroup in which FOLFOX remains the mainstay of treatment in the neoadjuvant, adjuvant and advanced disease settings. We have also identified FLIP as an intrinsic resistance mechanism to IAP antagonist therapy in CRC, the inhibitory effects of which can be overcome (at least in a subset of disease models) by FOLFOX treatment and the clinically relevant Class-I HDACi, entinostat. Moreover, in RIPK3-positive CRC, the clinically well-tolerated caspase inhibitor, emricasan induces necroptotic cell death. Of note, this may be the preferred mode of cell death in the predominantly immune-cold MSS disease setting due to potent pro-inflammatory effects of necroptosis.

In summary, we have identified three potential combination partners that overcome intrinsic resistance mechanisms to IAP antagonists in definable subsets of CRC, the most immediately actionable of which is of course the combination with SoC chemotherapy, FOLFOX. Such a combination could be particularly beneficial as neoadjuvant treatment of stage-III, cIAP1/2-high MSS disease, which has a particularly poor prognosis when treated adjuvantly with FOLFOX alone.

Materials and Methods

Data analysis

MSS stage III treated CRC patient cohort has been extracted from the GSE39582[13] data sets, downloaded from the National Center for Biotechnology Information Gene Expression Omnibus and the expression matrix was processed by collapsing to one probeset per gene using MaxMean from the WGCNA package [58]. The IAP mRNA levels were normally distributed, high and low level of expression was determined using a median split. Kaplan-Meier estimators and Cox proportional hazards regression analysis were assessed using the survival and survminer R packages. Tumour cell type profiling based on gene signature method has been performed by xCELL [59]. The single-sample gene set enrichment analysis (ssGSEA) method was implemented through GenePattern web-tool [60] using the Hallmark gene set molecular signature [61]. Heatmaps were generated after mean z-score normalization. Gene level cell line expression values were assessed from Cancer Cell Line Encyclopaedia (CCLE), curated by the Broad institute [62].

Compounds

Tolinapant was obtained from Astex Pharmaceuticals (Cambridge, UK). Entinostat, necrosulfonamide and emricasan (IDN-6556) were supplied by Selleckchem (Houston, TX). Z-VAD-fmk was purchased from Calbiochem (Gibbstown, NJ). TNFα was supplied by Prospec (Rehovot, Israel). 5FU and oxaliplatin were obtained from Belfast City Hospital Pharmacy.

Cell Culture

LoVo, HCT116, DLD-1, SW620 and HT29 cells were purchased as authenticated stocks from ATCC (Teddington, UK). HT29, LoVo and Mc38 cells were maintained in DMEM medium (Invitrogen, Paisley, UK) supplemented with 10% fetal bovine serum (Invitrogen, Paisley, UK). HCT116 and SW620 cells were maintained in McCoys5A medium (Invitrogen, Paisley, UK) supplemented with 10% fetal bovine serum (Invitrogen, Paisley, UK). DLD-1 cells were maintained in RPMI medium (Invitrogen, Paisley, UK) supplemented with 10% fetal bovine serum (Invitrogen, Paisley, UK).

VillinCreER;Apcfl/fl;KrasG12D/+;Trp53fl/fl (AKP) and VillinCreER;Apcfl/fl;KrasG12D/+ (AK) organoids were obtained through Dr. Emma Kerr/Prof Owen Sansom (CRUK Career Development Fellowship Ref: A26045). Organoids were cultured in ADF complete media: Advanced DMEM/F12 media (Invitrogen, Paisley, UK), supplemented with 10mM HEPES (Sigma), 2nM L-Glutamine (Invitrogen, Paisley, UK), N2 supplement (Invitrogen, Paisley, UK), B27 supplement (Invitrogen, Paisley, UK), 50ng/ml recombinant human EGF (Peprotech) and 100ng/ml Recombinant murine Noggin (Peprotech). Organoids were harvested in cell recovery solution (Corning, Germany), washed with PBS and organoid pellet resuspended in 1:1 ratio Matrigel (Corning, Germany):Media and cultured in complete media.

Measuring diameter of organoids

Organoids were cultured and treated as detailed. Pictures of the organoids were taken with an EVOS XL core cell imaging system (Thermo Fisher Scientific) with x10 magnification. Diameter of organoids, in arbitrary units (AU), were determined utilising ImageJ software.

Cell line screen

36-cell line screen was carried out by Chempartner (China). Each cell line was tested once in duplicate following incubation with 10 different concentration of tolinapant (0.0005 – 10μM) alone and in combination with TNFα (1ng/ml) for 72h. Cell viability was assessed by CellTitreGlo.

Western Blotting

Western Blotting was carried out as described previously [23]. Mcl-1, XIAP, BAX, SMAC, RIPK1, RIPK3, MLKL, Acetylated Lysine, pMLKL(Ser358), pRIPK3(Ser227), pRIPK1(Ser166) and PARP antibodies were purchased from Cell Signaling Technology (Danvers, MA). cIAP1, cIAP2 and Caspase-8 antibodies were purchased from Enzo (Exeter, UK). FLIP antibody was from AdipoGen (San Diego, CA) and Hyperacetylated H4 was from Millipore (Gillingham, UK). FADD antibody was purchased from BD Biosciences, Caspase-10 from MBL (Woburn, MA), Ku70 from Santa Cruz (Dallas, Texas) and β-actin from Sigma.

siRNA transfections

ON-TARGET plus SMART pool Murine cFLIP siRNA and SCR, cFLIP(L), cFLIP(S), cFLIP(T) and caspase-10 siRNA’s was purchased from Dharmacon (Chicago, IL). siRNA transfections were carried out with Lipofectamine RNAiMAX (Invitrogen, Paisley, UK) transfection reagent according to manufacturer’s instructions. siRNA sequences: SCR: UUCUCCGAACGUGUCACGU, FLIP(L): AACAGGAACTGCCTCTACTT, FLIP(S): AAGGAACAGCTTGGCGCTCAA, FLIP(T): AAGCAGTCTGTTCAAGGAGCA. Ku70 siRNA transfections were carried out as previously described [32].

Quantitative PCR (qPCR)

RNA was extracted using High Pure RNA Isolation kit (Roche, Burgess Hill, UK) according to manufacturer’s instructions. cDNA was synthesised using Transcriptor First Strand cDNA synthesis kit (Roche, Burgess Hill, UK) according to manufacturer’s instructions. qPCR was carried out using Syber green on LC480 light cycler (Roche, Burgess Hill, UK) according to manufacturer’s instructions. Primer sequences: cFLIP(L): F:CCTAGGAATCTGCCTGATAATCGA, R:TGGGATATACCATGCATACTGAGATG, FLIP(S): F:ATTTCCAAGAATTTTCAGATCAGGA, R:GCAGCAATCCAAAAGAGTCTCA, 18S: F:GTAACCCGTTGAACCCCATT, R:CCATCCAATCGGTAGTAGCG, RIPK3: GCCTCCACAGCCAGTGAC, TCGGTTGGCAACTCAACTT, Murine cFLIP: F:GCAGAAGCTCTCCCAGCA, R:TTTGTCCATGAGTTCAACGTG, Murine 18S: F:GCAATTATTCCCCATGAACG, R:GGGACTTAATCAACGCAAGC.

Cell Line Generation

HCT116 cells overexpressing cFLIP(S) or cFLIP(L) were generated as previously described [23]. HCT116, DLD1, LoVo, HT29 and SW620 caspase-8 CRISPR cell lines were generated by retroviral infection with pLentiCRISPR with guideRNA AAGTGAGCAGATCAGAATTG, a kind gift from Prof. Galit Lahav [63]. HCT116 and HT29 FADD CRISPR cell lines were generated by retroviral infection with pLentiCRISPR with guideRNA GCGGCGCGTCGACGACTTCG. Mixed population cell lines were established following selection with 1μg/ml puromycin. Cells were clonally selected for complete knockdown by Western blot analysis. HCT116 Caspase10 CRISPR cell lines were generated as previously described [30].

Immunoprecipitations

Caspase-8 and Acetylated Lysine immunoprecipitations were carried out as previously described [23, 32].

Cell surface flow cytometry

TNFR1 cell surface staining was carried out a previously described [23].

Cell viability assay

2D cell viability was assessed using CellTiter-Glo Luminescent Assay (Promega, Madison, WI) according to manufacturer’s instructions. 3D cell viability was determined with CellTitre-Glo 3D Cell Viability Assay (Promega, Madison, WI), according to manufacturer’s instructions.

AnnexinV/PI Staining

FITC-tagged AnnexinV (BD-Biosciences), PI(Sigma) and Hoesch stain (Invitrogen) were used to assess cell death. AnnexinV/PI staining was assessed by high content microscopy on an Array Sacn XTI microscope (Thermo Scientific).

In vivo experiments

2×106 HCT116, HT29 and DLD-1 cells in PBS:Matrigel(Corning, Germany) suspension were implanted single flank into 8-10 week old male BALB/c nude mice. When tumors of approx.100mm3 were established, mice were randomized and treated with vehicle and tolinapant. Tolinapant was administered orally with H2O as a vehicle daily, one week on, one week off, one week on.

Mc38 syngeneic experiment was carried out by Crown Bioscience (Loughborough, UK). Mc38 cells were injected subcutaneously injected into C57BL-6 mice (single flank). When tumors of approx.100mm were established, mice were randomized and treated orally with vehicle, entinostat(15mg/kg), tolinapant(16mg/kg) or combination of entinostat and tolinapant. The vehicle for entinostat was 30% cyclodextrin and for tolinapant was H2O. Mice were treated for a total of three weeks with entinostat administered twice a week and tolinapant daily on a one week on, one week off, one week on schedule.

50 AKP organoids in PBS:Matrigel(Corning, Germany) suspension were subcutaneously injected into C57BL-6J mice and treatment stated when average tumor size ~150mm3. Mice were treated with 10mg/kg 5FU (vehicle:PBS) and 1mg/kg oxaliplatin (vehicle:H2O) intraperitoneally and 16mg/kg tolinapant (vehicle:H2O) orally. Mice were treated for three weeks: once a week with oxaliplatin, daily with 5FU and tolinapant daily with a one week on, one week off, one week on schedule.

All procedures were carried out in accordance with the Animals (Scientific Procedures) Act, 1986 under project licences PPL 2590b and PPL 2874 and maintained as previously described [24]. Tumor volume was assessed using digital calipers, three times a week. Tumor volume was calculated by the following formula: shortest tumor diameter2 × longest tumor diameter × 0.5.

Statistical Analysis

Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Conflicts of interest

DBL has received funding support from Astex Pharmaceuticals and acted as an advisor on the development of tolinapant. JMM, TS, AS and VM are all employees of Astex Pharmaceuticals.

Supplementary Figure Legends

Supplementary Figure 1: Additional analysis of MSS, Stage III patients who received adjuvant fluorouracil-based treatment extracted from GSE39582 cohort. A) Distribution of BIRC2, BIRC3 and XIAP gene expression across the cohort. Red lines show the average, while the blue lines denotes the median value that have been used to determine High and Low category for each gene. B) Kaplan-Meier plots of 5-year overall survival comparing the difference in survival probability based on XIAP expression levels. C) Distribution of BRAF, KRAS, p53 mutations (wild type = WT and mutant=MT) in BIRC2 and BIRC3 High or Low patients. D) Difference of BIRC2, BIRC3 and XIAP expression values in KRAS mutant (M) and wild type (WT) patients. E) Effect of KRAS mutation in patients. Kaplan-Meier plots of 5-year overall is shown with the log-rank test, the hazard ratio (HR) with its 95% confidential interval and the Wald test of significance.

Supplementary Figure 2: A) Mutational and microsatellite instability status of DLD-1 SW620, LoVo, HT29 and HCT116 CRC cell lines. wt (wild type), MSI (microsatellite instability), MSS (microsatellite stable). Adapted from Ahmed, D., et al (2013)[64]. B) Western blot analysis of cIAP1, cIAP2, XIAP and β-actin in LoVo and SW620 cells following treatment with 1μM, 100nM, 10nM, 1nM and 0.1nM tolinapant for 24h. C) Western blot analysis of c-IAP1, cIAP2, XIAP, FLIP(L), FLIP(S), procaspase-8, RIPK1 and β-actin in HCT116 and LoVo cells at 1h, 3h, 6h,10h and 24h following treatment with 1μM tolinapant. D) Western blot analysis of RIPK1 and procaspase-8 following immunoprecipitation of caspase-8 from LoVo and SW620 cells treated with 1ng/ml TNFα, 1μM tolinapant and a combination of TNFα/tolinapant for 3h in the presence of 20μM z-VAD-fmk. An IgG isotype control was used as a control.

Supplementary Figure 3: A) AnnexinV/PI analysis in DLD-1 and LoVo cells treated with 1ng/ml TNFα, 1μM tolinapant or a combination of TNFα/tolinapant in combination with 5μM 5FU and 1μM oxaliplatin (OX) for 72h. B) Western blot analysis of PARP, cIAP2, cIAP1, XIAP, FLIP(L), FLIP(S) and β-actin in DLD-1 and LoVo cells treated with 5μM 5FU and 1μM oxaliplatin(FOLFOX), 1μM tolinapant and a combination of FOLFOX/tolinapant (COMBO) for 24h and 48h. C) Western blot analysis of PARP, FLIP(L), FLIP(S), cIAP1 and β-actin and in DLD-1 and LoVo cells transfected with Control (SCR) and FLIP(T) siRNA for 24h prior to treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Supplementary Figure 4: A) Western blot analysis of FLIP(L), FLIP(S), cIAP1, Hyper Acetyl H4 and β-actin in HCT116 HT29, SW620, DLD-1 and LoVo cells treated with 0.5μM, 1μM, 2.5μM, 5μM entinostat for 24h. B) AnnexinV/PI analysis in DLD-1 and LoVo cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h C) Western blot analysis of PARP, cIAP1, FLIP(L), FLIP(S), Hyperacetylated Histone 4 (H4) and β-actin in SW620, DLD-1 and LoVo cells treated cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. D) Western blot analysis of PARP, Caspase-8, FLIP(L), FLIP(S), cIAP1, Acetyl Histone 4(H4) and β-actin in HCT116 and DLD-1 WT and Caspase-8 KO cells pretreated with 2.5μM entinostat(Ent) for 24h then addition of 1μM tolinapant and 1ng/ml TNFα for a further 24h. E) AnnexinV/PI assay in HCT116 WT and HCT116 FADD KO cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant (tolin) and 1ng/ml TNFα (TNF) for a further 24h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Supplementary Figure 5: A) Western blot analysis of cIAP1 and β-actin in MC38 cells treated with 1μM, 100nM, 10nM, 1nM and 0.1nM tolinapant for 24h. B) Cell viability assay in MC38 cells 72h following treatment with 1μM tolinapant, 1ng/ml TNFα and a combination of tolinapant/TNF. C) Cell viability assay in MC38 cells transfected with scrambled control (SCR) or FLIP (mFLIPsi) siRNA for 24h followed by treatment with 1μM tolinapant and 1ng/ml TNFα for a further 24h. qPCR analysis for FLIP normalised to 18S in Mc38 cells transfected with scrambled control (SCR) and FLIP(mFLIPsi) siRNA for 24h. D) Cell viability assays in MC38 cells pretreated with 2.5μM entinostat for 24h then addition of 1μM tolinapant and 1ng/ml TNFα or a combination of tolinapant/TNF for a further 48h. E) Analysis of body weight in MC38 syngeneic model illustrated as % of weight relative to initiation of treatment. F) Pictures of AKP and AK organoids pretreated with 2.5μM entinostat(Ent) followed by addition of 1μM tolinapant and 1ng/ml TNFα(tolin/TNF) for a further 48h. G) Diameter in arbitrary units (AU) of AKP (n=175 for each treatment group) and AK (n=50 for each treatment group) organoids pretreated with 2.5μM entinostat(Ent) followed by addition of 1μM tolinapant and 1ng/ml TNFα(tolin/TNF) for a further 48h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Supplementary Figure 6: A) Cell viability assays in HT29 WT and HT29 Caspase 8 CRISPR cells pretreated for 30 minutes with 10μM z-VAD and 2μM necrosulfonamide then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. B) qPCR analysis of RIPK3 normalised to 18S in HT29, SW620, DLD-1, HCT116 and LoVo cells. C) Cell viability assay in SW620 WT and SW620 Caspase 8 CRISPR cells pretreated for 30 minutes with 10μM z-VAD and 2μM necrosulfonamide then addition of 1μM tolinapant and 1ng/ml TNFα for 48h. D) Western blot analysis of PARP, p-MLKL(Ser358), Total MLKL, p-RIPK1(Ser166), Total RIPK1, cIAP1, Caspase 8 and β-actin in SW620 WT and SW620 Caspase-8 KO cells treated with 1μM tolinapant and 1ng/ml TNFα for 24h. E) Propidium Iodide analysis in SW620 Caspase 8 WT and SW620 Caspase 8 KO cells pretreated for 30 minutes with 10μM z-VAD and 2μM necrosulfonamide then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. F) Cell viability assays in HT29 WT and HT29 FADD KO cells pretreated for 30 minutes with 10μM z-VAD then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Supplementary Figure 7: A) Western blot analysis of p-MLKL(Ser358), Total MLKL, p-RIPK3(Ser227), Total RIPK3, p-RIPK1(Ser166), Total RIPK1, cIAP1 and β-actin in HT29 cells pretreated for 30 minutes with 10μM z-VAD then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. B) Pictures from AK (n=100 for each treatment group) and AKP (n=200 for each treatment group) organoids pretreated with 10μM z-VAD for 30 minutes followed by tolinapant/1ng/ml TNFα (tolin/TNF) for 72h. Diameter in arbitrary units (AU) from AKP and AK organoids pretreated with 10μM z-VAD for 30 minutes followed by tolinapant/1ng/ml TNFα (tolin/TNF) for 72h. C) Western blot analysis of p-MLKL(Ser358), Total MLKL, Total RIPK3, p-RIPK1(Ser166), Total RIPK1, cIAP1 and β-actin in SW620 cells pretreated with 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. D) AnnexinV/PI staining of SW620 cells pretreated with 10μM z-VAD, 5μM emricasan or 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 24h.E) Cell viability assays in HT29 and SW620 cells pretreated with 10μM z-VAD, 5μM emricasan or 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 24h. F) Cell viability assays in AK and AKP organoids pretreated with 10μM emricasan for 30 minutes then addition of 1μM tolinapant and 1ng/ml TNFα for 48h. Results were compared using a two-tailed Students t-test, p<0.05 *, p<0.01 ** and p<0.001 ***.

Acknowledgements

This work was supported by a studentship (KS) sponsored by The Northern Ireland Department for the Economy (NI DfE), and by funding from a CRUK Program grant (DBL/SMcD) C11884/A24367, a CRUK Experimental Cancer Medicine Centre (ECMC) award (CL/VC/DL) C36697/A25176, and a CRUK Career Development Fellowship (EK/WMcD) C61288/A26045. Additional support (DBL, CMcC) was obtained from NI DfE (SFI-DEL 14/1A/2582). TA and ML were supported by an HDR-UK grant (JHR1157-100/1230). DBL was also in receipt of direct funding from Astex Pharmaceuticals.

References

  1. ↵
    Van Schaeybroeck S, Allen WL, Turkington RC, Johnston PG. Implementing prognostic and predictive biomarkers in CRC clinical trials. Nature Reviews Clinical Oncology (Review Article) 2011; 8: 222.
    OpenUrl
  2. ↵
    Quasar Collaborative G, Gray R, Barnwell J, McConkey C, Hills RK, Williams NS et al. Adjuvant chemotherapy versus observation in patients with colorectal cancer: a randomised study. Lancet 2007; 370:2020–2029.
    OpenUrlCrossRefPubMedWeb of Science
  3. ↵
    Efficacy of adjuvant fluorouracil and folinic acid in colon cancer. International Multicentre Pooled Analysis of Colon Cancer Trials (IMPACT) investigators. Lancet 1995; 345: 939–944.
    OpenUrlCrossRefPubMedWeb of Science
  4. ↵
    Andre T, Boni C, Navarro M, Tabernero J, Hickish T, Topham C et al. Improved overall survival with oxaliplatin, fluorouracil, and leucovorin as adjuvant treatment in stage II or III colon cancer in the MOSAIC trial. J Clin Oncol 2009; 27: 3109–3116.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Deveraux QL, Reed JC. IAP family proteins--suppressors of apoptosis. Genes Dev 1999; 13: 239–252.
    OpenUrlFREE Full Text
  6. ↵
    Suzuki Y, Nakabayashi Y, Takahashi R. Ubiquitin-protein ligase activity of X-linked inhibitor of apoptosis protein promotes proteasomal degradation of caspase-3 and enhances its anti-apoptotic effect in Fas-induced cell death. Proc Natl Acad Sci U S A 2001; 98: 8662–8667.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Bertrand MJ, Milutinovic S, Dickson KM, Ho WC, Boudreault A, Durkin J et al. cIAP1 and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIP1 ubiquitination. Mol Cell 2008; 30: 689–700.
    OpenUrlCrossRefPubMedWeb of Science
  8. ↵
    Micheau O, Lens S, Gaide O, Alevizopoulos K, Tschopp J. NF-kappaB signals induce the expression of c-FLIP. Mol Cell Biol 2001; 21: 5299–5305.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Oeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol 2009; 1: a000034.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Micheau O, Tschopp J. Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 2003; 114: 181–190.
    OpenUrlCrossRefPubMedWeb of Science
  11. ↵
    Johnson CN, Ahn JS, Buck IM, Chiarparin E, Day JEH, Hopkins A et al. A Fragment-Derived Clinical Candidate for Antagonism of X-Linked and Cellular Inhibitor of Apoptosis Proteins: 1-(6-[(4-Fluorophenyl)methyl]-5-(hydroxymethyl)-3,3-dimethyl-1 H,2 H,3 H-pyrrolo[3,2-b]pyridin-1-yl)-2-[(2 R,5 R)-5-methyl-2-([(3R)-3-methylmorpholin-4-yl]methyl)piperazin-1-yl]ethan-1-one (ASTX660). J Med Chem 2018; 61: 7314–7329.
    OpenUrl
  12. ↵
    Mita MM, LoRusso PM, Papadopoulos KP, Gordon MS, Mita AC, Ferraldeschi R et al. A Phase 1 Study of ASTX660, an Antagonist of Inhibitors of Apoptosis Proteins, in Adults With Advanced Cancers or Lymphoma. Clin Cancer Res 2020.
  13. ↵
    Marisa L, de Reynies A, Duval A, Selves J, Gaub MP, Vescovo L et al. Gene expression classification of colon cancer into molecular subtypes: characterization, validation, and prognostic value. PLoS Med 2013; 10: e1001453.
    OpenUrlCrossRefPubMed
  14. ↵
    Parameswaran N, Patial S. Tumor necrosis factor-alpha signaling in macrophages. Crit Rev Eukaryot Gene Expr 2010; 20: 87–103.
    OpenUrlCrossRefPubMed
  15. ↵
    Varfolomeev E, Blankenship JW, Wayson SM, Fedorova AV, Kayagaki N, Garg P et al. IAP antagonists induce autoubiquitination of c-IAPs, NF-kappaB activation, and TNFalpha-dependent apoptosis. Cell 2007; 131: 669–681.
    OpenUrlCrossRefPubMedWeb of Science
  16. ↵
    Feltham R, Bettjeman B, Budhidarmo R, Mace PD, Shirley S, Condon SM et al. Smac mimetics activate the E3 ligase activity of cIAP1 protein by promoting RING domain dimerization. J Biol Chem 2011; 286: 17015–17028.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Tenev T, Bianchi K, Darding M, Broemer M, Langlais C, Wallberg F et al. The Ripoptosome, a signaling platform that assembles in response to genotoxic stress and loss of IAPs. Mol Cell 2011; 43: 432–448.
    OpenUrlCrossRefPubMedWeb of Science
  18. ↵
    Bossen C, Ingold K, Tardivel A, Bodmer JL, Gaide O, Hertig S et al. Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J Biol Chem 2006; 281: 13964–13971.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Wong WW, Vince JE, Lalaoui N, Lawlor KE, Chau D, Bankovacki A et al. cIAPs and XIAP regulate myelopoiesis through cytokine production in an RIPK1- and RIPK3-dependent manner. Blood 2014; 123: 2562–2572.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Jackstadt R, van Hooff SR, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA et al. Epithelial NOTCH Signaling Rewires the Tumor Microenvironment of Colorectal Cancer to Drive PoorPrognosis Subtypes and Metastasis. Cancer Cell 2019; 36: 319–336 e317.
    OpenUrlCrossRef
  21. Schwitalla S, Fingerle AA, Cammareri P, Nebelsiek T, Goktuna SI, Ziegler PK et al. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell 2013; 152: 25–38.
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Cammareri P, Vincent DF, Hodder MC, Ridgway RA, Murgia C, Nobis M et al. TGFbeta pathway limits dedifferentiation following WNT and MAPK pathway activation to suppress intestinal tumourigenesis. Cell Death Differ 2017; 24: 1681–1693.
    OpenUrlCrossRef
  23. ↵
    Crawford N, Stasik I, Holohan C, Majkut J, McGrath M, Johnston PG et al. SAHA overcomes FLIP-mediated inhibition of SMAC mimetic-induced apoptosis in mesothelioma. Cell Death Dis 2013; 4: e733.
    OpenUrlCrossRefPubMed
  24. ↵
    McCann C, Crawford N, Majkut J, Holohan C, Armstrong CWD, Maxwell PJ et al. Cytoplasmic FLIP(S) and nuclear FLIP(L) mediate resistance of castrate-resistant prostate cancer to apoptosis induced by IAP antagonists. Cell Death Dis 2018; 9: 1081.
    OpenUrl
  25. ↵
    Ward GA, Lewis EJ, Ahn JS, Johnson CN, Lyons JF, Martins V et al. ASTX660, a Novel Non-peptidomimetic Antagonist of cIAP1/2 and XIAP, Potently Induces TNFalpha-Dependent Apoptosis in Cancer Cell Lines and Inhibits Tumor Growth. Mol Cancer Ther 2018; 17: 1381–1391.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Majkut J, Sgobba M, Holohan C, Crawford N, Logan AE, Kerr E et al. Differential affinity of FLIP and procaspase 8 for FADD’s DED binding surfaces regulates DISC assembly. Nat Commun 2014; 5: 3350.
    OpenUrlPubMed
  27. ↵
    Humphreys LM, Fox JP, Higgins CA, Majkut J, Sessler T, McLaughlin K et al. A revised model of TRAIL-R2 DISC assembly explains how FLIP(L) can inhibit or promote apoptosis. EMBO Rep 2020; 21: e49254.
    OpenUrl
  28. ↵
    Muhlethaler-Mottet A, Flahaut M, Bourloud KB, Nardou K, Coulon A, Liberman J et al. Individual caspase-10 isoforms play distinct and opposing roles in the initiation of death receptor-mediated tumour cell apoptosis. Cell Death Dis 2011; 2: e125.
    OpenUrlPubMed
  29. ↵
    Horn S, Hughes MA, Schilling R, Sticht C, Tenev T, Ploesser M et al. Caspase-10 Negatively Regulates Caspase-8-Mediated Cell Death, Switching the Response to CD95L in Favor of NF-kappaB Activation and Cell Survival. Cell Rep 2017; 19: 785–797.
    OpenUrl
  30. ↵
    Lees A, McIntyre AJ, Crawford NT, Falcone F, McCann C, Holohan C et al. The pseudo-caspase FLIP(L) regulates cell fate following p53 activation. Proc Natl Acad Sci U S A 2020; 117: 17808–17819.
    OpenUrlAbstract/FREE Full Text
  31. Bangert A, Cristofanon S, Eckhardt I, Abhari BA, Kolodziej S, Hacker S et al. Histone deacetylase inhibitors sensitize glioblastoma cells to TRAIL-induced apoptosis by c-myc-mediated downregulation of cFLIP. Oncogene 2012; 31: 4677–4688.
    OpenUrlCrossRefPubMed
  32. ↵
    Kerr E, Holohan C, McLaughlin KM, Majkut J, Dolan S, Redmond K et al. Identification of an acetylation-dependant Ku70/FLIP complex that regulates FLIP expression and HDAC inhibitor-induced apoptosis. Cell Death Differ 2012; 19: 1317–1327.
    OpenUrlCrossRefPubMed
  33. ↵
    Shiffman M, Freilich B, Vuppalanchi R, Watt K, Chan JL, Spada A et al. Randomised clinical trial: emricasan versus placebo significantly decreases ALT and caspase 3/7 activation in subjects with non-alcoholic fatty liver disease. Aliment Pharmacol Ther 2019; 49: 64–73.
    OpenUrl
  34. ↵
    Sumida Y, Yoneda M, Ogawa Y, Yoneda M, Okanoue T, Nakajima A. Current and new pharmacotherapy options for non-alcoholic steatohepatitis. Expert Opin Pharmacother 2020: 1–15.
  35. ↵
    Watson AJ. Apoptosis and colorectal cancer. Gut 2004; 53: 1701–1709.
    OpenUrlFREE Full Text
  36. ↵
    Krajewska M, Kim H, Kim C, Kang H, Welsh K, Matsuzawa S et al. Analysis of apoptosis protein expression in early-stage colorectal cancer suggests opportunities for new prognostic biomarkers. Clin Cancer Res 2005; 11: 5451–5461.
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Flanagan L, Kehoe J, Fay J, Bacon O, Lindner AU, Kay EW et al. High levels of X-linked Inhibitor-of-Apoptosis Protein (XIAP) are indicative of radio chemotherapy resistance in rectal cancer. Radiat Oncol 2015; 10: 131.
    OpenUrlCrossRefPubMed
  38. ↵
    Xiao R, Allen CT, Tran L, Patel P, Park SJ, Chen Z et al. Antagonist of cIAP1/2 and XIAP enhances anti-tumor immunity when combined with radiation and PD-1 blockade in a syngeneic model of head and neck cancer. Oncoimmunology 2018; 7: e1471440.
    OpenUrl
  39. ↵
    Xiao R, An Y, Ye W, Derakhshan A, Cheng H, Yang X et al. Dual Antagonist of cIAP/XIAP ASTX660 Sensitizes HPV(-) and HPV(+) Head and Neck Cancers to TNFalpha, TRAIL, and Radiation Therapy. Clin Cancer Res 2019; 25: 6463–6474.
    OpenUrlAbstract/FREE Full Text
  40. ↵
    Feoktistova M, Geserick P, Kellert B, Dimitrova DP, Langlais C, Hupe M et al. cIAPs block Ripoptosome formation, a RIP1/caspase-8 containing intracellular cell death complex differentially regulated by cFLIP isoforms. Mol Cell 2011; 43: 449–463.
    OpenUrlCrossRefPubMedWeb of Science
  41. ↵
    Lin Y, Devin A, Rodriguez Y, Liu ZG. Cleavage of the death domain kinase RIP by caspase-8 prompts TNF-induced apoptosis. Genes Dev 1999; 13: 2514–2526.
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Qin J, Wen B, Liang Y, Yu W, Li H. Histone Modifications and their Role in Colorectal Cancer (Review). Pathol Oncol Res 2020; 26: 2023–2033.
    OpenUrl
  43. ↵
    Featherstone C, Jackson SP. Ku, a DNA repair protein with multiple cellular functions? Mutat Res 1999; 434: 3–15.
    OpenUrlCrossRefPubMedWeb of Science
  44. ↵
    Kim MJ, Hong KS, Kim HB, Lee SH, Bae JH, Kim DW et al. Ku70 acetylation and modulation of c-Myc/ATF4/CHOP signaling axis by SIRT1 inhibition lead to sensitization of HepG2 cells to TRAIL through induction of DR5 and down-regulation of c-FLIP. Int J Biochem Cell Biol 2013; 45: 711–723.
    OpenUrl
  45. ↵
    Wachmann K, Pop C, van Raam BJ, Drag M, Mace PD, Snipas SJ et al. Activation and specificity of human caspase-10. Biochemistry 2010; 49: 8307–8315.
    OpenUrlCrossRefPubMed
  46. ↵
    Chen M, Orozco A, Spencer DM, Wang J. Activation of initiator caspases through a stable dimeric intermediate. J Biol Chem 2002; 277: 50761–50767.
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Cai Z, Jitkaew S, Zhao J, Chiang HC, Choksi S, Liu J et al. Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nat Cell Biol 2014; 16: 55–65.
    OpenUrlCrossRefPubMedWeb of Science
  48. He S, Wang L, Miao L, Wang T, Du F, Zhao L et al. Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 2009; 137: 1100–1111.
    OpenUrlCrossRefPubMedWeb of Science
  49. ↵
    Holler N, Zaru R, Micheau O, Thome M, Attinger A, Valitutti S et al. Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule. Nat Immunol 2000; 1: 489–495.
    OpenUrlCrossRefPubMedWeb of Science
  50. ↵
    Aaes TL, Kaczmarek A, Delvaeye T, De Craene B, De Koker S, Heyndrickx L et al. Vaccination with Necroptotic Cancer Cells Induces Efficient Anti-tumor Immunity. Cell Rep 2016; 15: 274–287.
    OpenUrlPubMed
  51. ↵
    Yatim N, Jusforgues-Saklani H, Orozco S, Schulz O, Barreira da Silva R, Reis e Sousa C et al. RIPK1 and NF-kappaB signaling in dying cells determines cross-priming of CD8(+) T cells. Science 2015; 350: 328–334.
    OpenUrlAbstract/FREE Full Text
  52. ↵
    Conev NV, Dimitrova EG, Bogdanova MK, Kashlov YK, Chaushev BG, Radanova MA et al. RIPK3 expression as a potential predictive and prognostic marker in metastatic colon cancer. Clin Invest Med 2019; 42: E31–E38.
    OpenUrl
  53. Moriwaki K, Bertin J, Gough PJ, Orlowski GM, Chan FK. Differential roles of RIPK1 and RIPK3 in TNF-induced necroptosis and chemotherapeutic agent-induced cell death. Cell Death Dis 2015; 6: e1636.
    OpenUrlCrossRefPubMed
  54. ↵
    Nugues AL, El Bouazzati H, Hetuin D, Berthon C, Loyens A, Bertrand E et al. RIP3 is downregulated in human myeloid leukemia cells and modulates apoptosis and caspase-mediated p65/RelA cleavage. Cell Death Dis 2014; 5: e1384.
    OpenUrlCrossRefPubMed
  55. ↵
    Najafov A, Zervantonakis IK, Mookhtiar AK, Greninger P, March RJ, Egan RK et al. BRAF and AXL oncogenes drive RIPK3 expression loss in cancer. PLoS Biol 2018; 16: e2005756.
    OpenUrlCrossRef
  56. ↵
    Harrison SA, Goodman Z, Jabbar A, Vemulapalli R, Younes ZH, Freilich B et al. A randomized, placebo-controlled trial of emricasan in patients with NASH and F1-F3 fibrosis. J Hepatol 2019.
  57. ↵
    Brumatti G, Ma C, Lalaoui N, Nguyen NY, Navarro M, Tanzer MC et al. The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and treat acute myeloid leukemia. Sci Transl Med 2016; 8: 339ra369.
    OpenUrlCrossRef
  58. ↵
    Langfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics 2008; 9: 559.
    OpenUrlCrossRefPubMed
  59. ↵
    Aran D, Hu Z, Butte AJ. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol 2017; 18: 220.
    OpenUrlCrossRefPubMed
  60. ↵
    Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet 2006; 38: 500–501.
    OpenUrlCrossRefPubMedWeb of Science
  61. ↵
    Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 2015; 1: 417–425.
    OpenUrl
  62. ↵
    Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012; 483: 603–607.
    OpenUrlCrossRefPubMedWeb of Science
  63. ↵
    Paek AL, Liu JC, Loewer A, Forrester WC, Lahav G. Cell-to-Cell Variation in p53 Dynamics Leads to Fractional Killing. Cell 2016; 165: 631–642.
    OpenUrlCrossRef
  64. ↵
    Ahmed D, Eide PW, Eilertsen IA, Danielsen SA, Eknaes M, Hektoen M et al. Epigenetic and genetic features of 24 colon cancer cell lines. Oncogenesis 2013; 2: e71.
    OpenUrlCrossRefPubMed
Back to top
Posted November 20, 2020.
Download PDF
Email
Clinical positioning of the IAP antagonist tolinapant (ASTX660) in colorectal cancer
Nyree Crawford, Katie Stott, Tamas Sessler, Christopher McCann, William McDaid, Cheryl Latimer, Jennifer Fox, Joanne M Munck, Tomoko Smyth, Alpesh Shah, Vanessa Martins, Mark Lawler, Philip Dunne, Emma Kerr, Simon S McDade, Vicky Coyle, Daniel B Longley
bioRxiv 2020.11.20.391680; doi: https://doi.org/10.1101/2020.11.20.391680
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools

Subject Area