ABSTRACT
Many intracellular pathogens stay invisible to the host detection machinery to promote their survival. However, it remains unknown how pathogen surfaces are disguised from host ubiquitin tagging, a first step in anti-microbial autophagy. We determined that outer membrane proteins (OMPs) of the intracellular bacterial pathogen Rickettsia parkeri are protected from ubiquitylation by protein-lysine methyltransferases (PKMTs) and the bacterial O-antigen. Analysis of the lysine-methylome revealed that PKMTs modify a subset of OMPs including surface protein OmpB. Mechanistically, methylation of lysines in OmpB camouflaged the same residues from ubiquitylation. Lysine methylation also prevented autophagy recognition and elimination by the autophagy factor ATG5 in macrophages and was critical for disease in mice. These findings suggest that lysine methylation shields proteins from ubiquitylation to evade autophagy targeting.
MAIN
Intracellular bacterial pathogens generally avoid the host immune surveillance machinery. This includes avoidance of surface targeting by the host ubiquitylation machinery and subsequent formation of a polyubiquitin coat, a first step in cell-autonomous immunity (1–5). The ubiquitin coat recruits autophagy receptors that engage with the autophagy machinery to target cytosol-exposed microbes for destruction (1, 4–8). Bacterial outer membrane proteins (OMPs) are targets for the host ubiquitylation machinery (9, 10), and the tick-borne obligate intracellular pathogen Rickettsia parkeri (R. p.) requires the abundant surface protein OmpB to protect OMPs from ubiquitylation (11). However, the detailed mechanisms that R. p. and other pathogens use to block lysine ubiquitylation of surface proteins, including OMPs, are unknown. We hypothesized that cell surface structures or modifications could provide protection at the molecular level. One such modification is lysine methylation, which is widespread in prokaryotes, archaea, and eukaryotes. This modification involves the transfer of one, two, or three methyl groups to the amino group of a lysine side chain, the same amino group that can also be modified by ubiquitin (12). Whether lysine methylation of bacterial surfaces prevents host detection and promotes intracellular survival has not been explored.
To identify bacteria-derived surface modifications that protect against ubiquitin coating, we screened pools of R. p. transposon mutants (13) (Table S1) for increased polyubiquitylation (pUb) relative to wild-type (WT) in Vero cells (an epithelial cell line commonly used to propagate and study intracellular pathogens) by immunofluorescence microscopy (Fig. 1A). We then analyzed individual mutants from pUb-positive pools and identified 4 mutants that were ubiquitylated, similar to ompB mutant bacteria (11) (Fig. 1B, D, and E). However, in contrast to the ompB mutant, these 4 strains expressed OmpB (Fig. S1). Two of the strains had insertions in the protein-lysine methyltransferase genes pkmt1 and pkmt2, which are located at two distinct chromosomal regions. The remaining two strains had insertions in the wecA and rmlD genes, which are required for the biosynthesis of O-antigen (Fig. S2), a common surface structure in Gram-negative bacteria. As a control, we analyzed a strain with a mutation in the mrdA gene, which is required for peptidoglycan biosynthesis and cell shape in other bacteria (14). This mutant strain had altered shape but was not polyubiquitylated (Fig. 1B, D and E), suggesting that not all bacterial cell envelope structures are required to avoid ubiquitylation. We also further quantified the pUb levels and observed that the pkmt1::tn bacteria had the highest levels (Fig. 1E). These data indicate that OmpB, PKMTs and the O-antigen protect R. p. from ubiquitylation.
The O-antigen was previously shown to be required for rickettsial pathogenesis (15), and OmpB was previously found to be required for R. p. to cause lethal disease in Ifnar-/-Ifngr-/- mice lacking the type I interferon receptor (IFNAR) and IFN-γ receptor (IFNGR) (16). We therefore examined whether PKMT1 or PKMT2 are important for causing disease in vivo by infecting Ifnar-/-Ifngr-/- mice. We observed that mice succumbed to WT but not to pkmt1::tn or pkmt2::tn bacteria (Fig. 1F). Mice infected with the pkmt1::tn mutant showed no signs of disease, whereas mice infected with pkmt2::tn showed a transient loss in body weight (Fig. S3). This indicates that PKMT1 and PKMT2 are virulence factors that promote R. p. pathogenesis.
Because PKMT1 or PKMT2 had previously been shown to methylate OmpB in vitro (17–20), we next examined whether methylation and the O-antigen protect OmpB, or another abundant outer membrane protein OmpA (21), from ubiquitylation. First, Vero cells overexpressing 6xHis-tagged ubiquitin were infected with WT and the ompB, pkmt1::tn, pkmt2::tn, wecA::tn, and rmlD::tn strains. 6xHis-tagged ubiquitin was recruited to the surface of all of the mutants, but not WT bacteria, as observed by immunofluorescence microscopy (Fig. S4). Then, 6xHis-ubiquitylated proteins were affinity purified from infected cells, and OmpA and OmpB were detected by Western blotting. OmpA was shifted towards higher molecular weights in cells infected with mutant, but not WT bacteria, indicating OmpA is ubiquitylated (Fig. 2A). Similarly, in comparison with WT, OmpB was also shifted towards higher as well as lower molecular weights in cells infected with the pkmt1::tn and pkmt2::t mutants, and to a lesser extent with the wecA::tn and rmlD::tn mutants, suggesting that OmpB is ubiquitylated (Fig. 2A). To confirm that methylation protects OmpB and OmpA from ubiquitylation on the bacterial surface, we performed pUb-enrichments of surface fractions from purified bacteria followed by Western blotting. This revealed that both OmpB and OmpA shifted towards higher molecular weights in the methyltransferase mutants but not in WT bacteria (Fig. 2B). These data demonstrate that methylation is critical to protect OMPs from ubiquitylation on the bacterial surface.
Based on our observation that methylation protects both OmpA and OmpB from ubiquitylation, we set out to determine how frequently, and to what extent, lysines of R. p. OMPs are methylated. Peptides with methylated lysines from whole WT bacteria were quantified using label-free liquid chromatography-mass spectrometry (LC-MS). We then analyzed lysine methylation frequency in abundant OMPs as well as other abundant R. p. proteins (Table S2). This analysis revealed that R. p. OmpB, OmpA, and surface cell antigen 2 (Sca2) proteins had the highest abundance of methylated peptides. Lysine methylation was also detected in the outermembrane assembly protein BamA and in a predicted outer membrane protein porin (WP_014410329.1; from here on referred to as OMP-porin) (Fig. 3A and Table S3). We next mapped both methylated and unmethylated lysines on the above-mentioned OMPs and found that more than 50% of lysines detected from OmpB and OmpA were methylated, and a significant fraction of lysines were also methylated in Sca2 (31%), OMP-porin (30%), and BamA (27%) (Fig. 3B and Fig. S5). Thus, in R. p., lysine methylation of OMPs is common.
To identify OMPs that are methylated by PKMT1 and PKMT2 during infection, we compared lysine methylation frequencies in WT with those of pkmt1::tn or pkmt2::tn mutant bacteria using LC-MS. We found that monomethylation of OmpB, OmpA, the predicted OMP-porin, and another surface cell antigen protein Sca1 was reduced in pkmt1::tn compared to WT bacteria (Fig. 3C and Fig. S6). Dimethylation of rickettsial surface proteins was not reduced in the mutants (Fig. S6). Although trimethylation was rare and therefore difficult to analyze at the individual protein level (Fig. S7), OmpB had reduced trimethylation levels in both methyltransferase mutants (Fig. 3C). Notably, the frequency of unmethylated lysines in OmpB was specifically increased in pkmt1::tn bacteria (Fig. 3C and Fig. S6). Lysine methylation of five other surface proteins (Sca1, Sca2, BamA, LomR, and Pal-lipoprotein), and 21 of 23 abundant proteins with different predicted subcellular distributions, was not affected by mutations in the pkmt1 or pkmt2 genes (Fig. S6). These data indicate that the PKMTs are required for methylation of a subset of OMPs including OmpB.
To determine which OmpB residues are modified by PKMT1 and PKMT2 during R. p. infection, we analyzed the methylation frequency of individual lysines in the mutants compared to WT using LC-MS. We observed reduced monomethylation frequencies of OmpB K418, K623, K634, K902, K1061, K1294, and K1323 in pkmt1::tn bacteria compared with WT, and reduced trimethylation frequencies on K1061 and K388 in the pkmt2::tn strain (Fig. 3D). This indicates that several lysines in R. p. OmpB are methylated by PKMT1 and PKMT2 during infection. Although these data are consistent with previous biochemical results indicating that PKMT1 monomethylates and PKMT2 trimethylates OmpB’s lysines (17, 19), we find that total OmpB-methylation is unaffected in the pkmt2::tn mutant. This suggests that PKMT1 is the primary methyltransferase for R. p. OmpB and that it can compensate, at least partly, for a deficiency in PKMT2.
To test the hypothesis that methylation of specific lysines in OmpB shields the same residues from ubiquitylation, we performed pUb-enrichments of bacterial surface fractions followed by LC-MS to quantify lysines with diglycine (diGly) remnants, a signature for ubiquitin after trypsin digestion. A prediction of this hypothesis is that individual lysines that are heavily methylated in OmpB of Rickettsia species (17) including WT R. p. (Fig. 3D) are targets for ubiquitylation in pkmt1::tn bacteria. We confirmed this hypothesis as OmpB K634 and K623 in pkmt1::tn exhibited 7 to 10000-fold increased ubiquitylation compared with WT bacteria (Fig. 3E, F and Fig. S8; Table S4). Furthermore, we observed a 13-fold increase in ubiquitylation of the OMP-porin in pkmt1::tn bacteria (Table S4), indicating that methylation also protects additional OMPs. However, in pkmt2::tn, differential OMP-ubiquitylation was below detection limits (Fig. 3E, F and Fig. S8; Table S4). Together, these data indicate that methylation of lysines in OMPs by PKMT1 camouflages the same residues from ubiquitylation.
Because polyubiquitylation promotes recruitment of the autophagy receptors p62/SQSTM1 and NDP52 (7, 8), we hypothesized that lysine methylation and the O-antigen shield OMPs from ubiquitylation to block recruitment of these proteins. Consistent with this hypothesis, we observed that the majority of pkmt1::tn, pkmt2::tn, O-antigen (wecA::tn, rmlD::tn), as well as ompB mutant bacteria, co-localized with p62 and NDP52 by immunofluorescence microscopy (Fig. S9). These data demonstrate that PKMTs and the O-antigen protect R. p. from autophagy recognition.
Many pathogenic bacteria including R. p. grow in immune cells such as macrophages (11), despite the fact that microbial detection in such cells triggers anti-bacterial pathways. We therefore investigated whether PKMT1 or PKMT2 were required for evading autophagy targeting and bacterial growth in cultured bone-marrow-derived macrophages (BMDMs), as was observed for OmpB (11). BMDMs were generated from control mice and mice lacking the gene encoding for autophagy related 5 (ATG5), a protein required for optimal membrane envelopment around pathogens targeted by autophagy, and for their subsequent destruction (6). We observed that pkmt1::tn mutant bacteria were unable to grow in control BMDMs (Atg5flox/flox), and that growth was rescued in Atg5-deficient BMDMs (Atg5-/-). Further, >91% of pkmt1::tn bacteria were labeled with both pUb and p62 in Atg5-deficient BMDMs (Fig. 4A, B, C and D), suggesting that detected bacteria are not restricted when the autophagy cascade is prevented. In contrast, the pkmt2::tn mutant was not grossly defective in growth compared with WT bacteria and 50% of the bacteria were labeled p62, irrespective of host genotype (Fig. 4A, B, C and D), consistent with less pronounced ubiquitylation phenotypes compared to pkmt1::tn bacteria. Altogether, these data indicate that methylation is required for R. p. growth in macrophages by avoiding autophagy targeting.
Our work reveals a molecular mechanism involving lysine methylation that camouflages bacterial surface proteins from host detection. In particular, we found that lysine methylation is essential for blocking ubiquitylation, a first step in cell-autonomous immunity (1–4). This highlights an intricate evolutionary arms race between pathogens and hosts and reveals a strategy that pathogens can adapt to counteract host responses. The lysine methyltransferases PKMT1 and PKMT2 are conserved between rickettsial species (Fig. S10 and Fig. S11) and contain a core Rossmann fold found in the broader superfamily of class I methyltransferases that exist in diverse organisms (12, 18). Thus, we propose that lysine methylation, and potentially other lysine modifications, could be used by pathogens, symbionts, and perhaps even in eukaryotic organelles, to prevent unwanted surface ubiquitylation and downstream consequences including elimination by autophagy. Further study of microbial surface modifications will continue to enhance our understanding of the pathogen-host interface and could ultimately lead to new therapeutic interventions to treat human diseases including those caused by infectious agents.
Funding
P.E. was supported by a postdoctoral fellowship from the Sweden-America Foundation. M.D.W. was supported by NIH/NIAID grants R01 AI109044 and R21 AI109270. A mass spectrometer used in this study was purchased with support from the NIH (grant 1S10 OD020062-01).
Author contributions
P.E. conceived the study with the assistance of M.D.W. P.E. performed laboratory work and analysis, except for mass spectrometry, which was conducted together with A.T.I, and animal experiments, which were conducted by T.P.B. P.E. drafted the initial manuscript, and A.T.I, T.P.B, and M.W.D provided editorial feedback.
Data and materials availability
All data used in the analysis are provided in the main text or supplementary materials. Materials are available upon request.
SUPPLEMENTARY MATERIAL FIGURE
Materials and Methods
Cell lines and primary mouse macrophages
Vero cells were purchased from the UC Berkeley Cell Culture Facility and the identity was repeatedly confirmed by mass-spectrometry analysis. Cells were grown at 37 °C and 5% CO2 in DMEM plus 2% heat-inactivated (30 min, 56 °C, in a water-bath) fetal bovine serum (Gemcell). Vero cells were confirmed to be mycoplasma negative by DAPI staining and fluorescence microscopy screening at the UC Berkeley Cell Culture Facility.
BMDMs generated from the femurs of mutant Atg5flox/flox and matched Atg5-/- C57BL/6 mice were a kind gift from the laboratory of Jeffery S. Cox (UC Berkeley), and they were prepared as previously described (11) although in the absence of antibiotics. Genotypes were confirmed by PCR and Sanger sequencing at the UC Berkeley DNA Sequencing Facility, as previously described (11).
Rickettsia parkeri strain generation and validation
R. parkeri strain Portsmouth (NCBI accession no. NC_017044.1; originally a gift from C. Paddock, Center for Disease Control and Prevention) were propagated and purified as described below, and bacterial stocks of WT, ompBSTOP::tn (the genome sequences of these bacterial strains are available at the Sequence Read Archive as accession no. SRP154218 (WT, SRX4401164; ompBSTOP::tn, SRX4401167), pkmt1::tn, pkmt2::tn, wecA::tn and rlmD::tn bacteria were prepared every ~6-10 months, and side-by-side experimental comparisons were made between stocks prepared at similar times.
R. parkeri pkmt1::tn, pkmt2::tn, wecA::tn, and 114 other mutant strains screened for pUb were previously isolated in a screen for small plaque mutants (13, 22). The ompBSTOP::tn was previously isolated in a suppressor screen and lacked expression of OmpB (11). The rmlD::tn, and 132 other mutant strains screened for pUb were isolated in an independent screen in which mutants were isolated without regard for plaque size (Table S1). The genomic locations of transposon insertion sites for all mutants were determined by semi-random nested PCR. To verify the insertions and clonality, we used PCR reactions that amplified the transposon insertion site using primers for flanking chromosomal regions: 5’GCTCACTAGATAGCACTCG’3 and 5’GCTCGATTTATCTCACTTTATG’3 for rlmD::tn, 5’CGTTTAATAGTCCAGTTAATTTGT’3 and 5’CCGTCTATACCGTCCATAAAAT’3 for wecA::tn, 5’GCATCGAAATAACCCTGAG’3 and 5’GCAAACTTCTCAAAGAAATTAACG’3 for pkmt1::tn, 5’GCTAAGAAATCTTCTAATTTGATATTTTAC’3 and 5’CGAAAATTTACCTGAGCCTT’3 for pkmt2::tn, 5’CGACACATAATAGCACAAACTAC’3 and 5’GCGGAGGCGGTAGTAAAG’3 for mrdA::tn (Fig. S12).
Screening for pUb-positive strains
To prepare the mutant library for screening, passage 1 (P1) transposon insertion mutants were amplified one time in Vero cells using 24-well cell culture plates. At 5-12 d.p.i, when 50-70% of the infected cells appeared to be rounded up (as a sign of infection) by visual inspection using a light microscope, cell culture media were completely removed, and cells were subsequently lysed in 500 μL cold sterile water for 2-3 minutes (min). Next, 500 μL of 2x cold sterile brain-heart-infusion (BHI) broth (BD Difco, cat. no. 237500) was added to the lysed cells, resuspended, and P2 bacteria were transferred to cryogenic storage vials and frozen at −80 °C.
To screen for pUb-positive strains, 10-40 μL of each of five to seven P2 mutant bacterial strains were diluted in 1 mL of room temperature (RT) cell culture media supplemented with 2% FBS. Subsequently, the pooled bacterial suspension was centrifuged at 250g for 4 min at RT onto confluent Vero cells grown on coverslips in 24-well plates. Cells were then incubated at 33 °C and fixed at 50-55 h.p.i. with pre-warmed 4% PFA for 10 min at RT. If cells were over-infected (i.e., individual infection foci had grown together) as determined by immunofluorescence microscopy, infections of that specific pool were repeated using reduced volumes of P2 bacteria. Next, fixed cells were permeabilized with 0.2% Triton-X for 5 min and then stained with the anti-Rickettsia I7205 antibody (1:500 dilution; gift from Ted Hackstadt) and anti-polyubiquitin FK1 antibody (Enzo Life Sciences, BML-PW8805-0500; 1:250 dilution), followed by Alexa 488 anti-rabbit antibody (Invitrogen, A11008; 1:500 dilution) or goat anti-mouse Alexa-568 (Invitrogen, A11004). Whole coverslips were manually inspected on a Nikon Ti Eclipse microscope with x60 (1.4 numerical aperture) Plan Apo objective. The initial screen revealed that five out of 39 mutant pools contained pUb-positive areas.
In a secondary screen, individual strains from the pUb-positive pools were used to infect Vero cells, as stated above. Infected cells were also fixed and stained as above except that a post-fixation step using 100% methanol for 5 min was included and that an OmpB antibody (11) and Hoechst (Sigma, B2261, 1:2500 dilution) was used instead of the anti-Rickettsia I7205 antibody. Samples were inspected as above and strains were scored as following: 1) pUb-negative (49 strains), 2) a few infection foci were pUb-positive (2 strains: Sp mutant 24, insertion at bp position 753916; Sp mutant 94, insertion at bp position 774831), 3) bacteria in the center of foci were pUb-positive but not on the edges (2 strains: Sp mutant 43, insertion at bp position 651602-651604; Sp mutant 45, insertion at bp position 751156), 4) almost all bacteria in all foci were pUb-positive (4 strains: pkmt1::tn, insertion at bp position 1161553 (gene MC1_RS06185); pkmt2::tn, insertion at bp position 34100 (gene MC1_RS00180); wecA::tn, insertion at bp position 1223170 (MC1_RS06510); and rmlD::tn, insertion at bp position 455753 (MC1_RS02345).
Rickettsia purification
R. parkeri strains were propagated as described previously (11). “Purified bacteria” were from five T175 flasks of Vero cells growing in DMEM supplemented with 2% FBS that after 5-8 days of infection (normally ~75% infected as observed by light microscopy) were harvested in the media using a cell scraper. Then, bacteria were centrifuged 12000g for 15 min at 4 °C in prechilled tubes. Pellets were resuspended in cold K-36 buffer (0.05 M KH2PO4, 0.05 M K2HPO4, pH 7, 100 mM KCl and 15 mM NaCl) and a pre-chilled dounce-homogenizer (tight fit) were used for 60 strokes to release bacteria from host cells. The homogenate was then centrifuged at 200g for 5 min at 4 °C to remove cellular debris. The supernatant was overlaid onto cold 30% v/v MD-76R (Mallinckrodt Inc., 1317-07) diluted in K-36, and centrifuged at 58300g for 20 min at 4 °C in an SW-28 swinging-bucket rotor. The pellet was resuspended in cold 1x BHI broth (0.5 mL BHI per infected T175 flask), and after letting DNA precipitates sediment to the bottom of the tubes, bacterial suspensions were collected, aliquoted and frozen at −80 °C.
“Gradient-purified bacteria” were from ten T175 flasks of Vero cells, purified as above with the addition of a 40/44/54% v/v MD-76R (diluted in K-36 buffer) gradient step centrifuged at 58300g for 25 min at 4 °C using the SW-28 swinging bucket rotor. The bacteria were then collected from the 44-54% interface, diluted in K-36 buffer, and pelleted by centrifugation at 12000g for 15 min at 4 °C. The pellet was resuspended in cold 1x BHI broth and subsequently aliquoted and frozen at −80 °C.
OmpW and EF-Tu antibody production
The sequence encoding amino acids 22-224 of outer membrane protein W (OmpW; WP_014411122.1) (a protein that lacks the signal peptide), or full-length Elongation factor Tu (EF-Tu; WP_004997779.1), were amplified by PCR from R. parkeri genomic DNA, and subsequently cloned into plasmid pETM1, which encodes N-terminal 6xHis and maltose-binding proteins (MBP) tags. From the resulting plasmids, fusion proteins were expressed in E. coli strain BL21 codon plus RIL-Camr (DE3) (QB3 Macrolab, UC Berkeley) by induction with 1 mM isopropyl-β-D-thio-galactoside (IPTG) for 2-2.5 hours at 37 °C. Bacterial pellets were resuspended in lysis buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 1mM EDTA, and 1 mM dithiothreitol (DTT)) and stored at −80 °C. For protein purification, bacteria were thawed, lysozyme was added to 1 mg/mL (Sigma, L4919), and lysis was carried out by sonication. Lysates containing 6xHis-MBP-OmpW and 6xHis-MBP-OmpW were incubated on amylose resin (New England Biolabs, E8021L) (Qiagen, 1018244) and bound proteins were eluted in lysis buffer lacking EDTA and DTT but containing 10 mM maltose. Fractions were analyzed by SDS-PAGE and those with the highest concentrations of fusion proteins were pooled to generate rabbit antibodies against OmpW and EFTU. 1.2 mg of purified 6xHis-MBP-OmpW and 6xHis-MBP-EFTU proteins were sent to Pocono Rabbit Farm and Laboratory (Canadensis, PA), and immunization was carried out according to their 91-d protocol.
Western blotting
To determine the levels of bacterial and host proteins in purified bacterial samples, 30%-purified bacterial samples were boiled in 1x SDS loading buffer (150 mM Tris pH 6.8, 6% SDS, 0.3% bromophenol blue, 30% glycerol, 15% β-mercaptoethanol) for 10 min, then 1×106 PFUs were resolved on an 8-12% SDS-PAGE gel and transferred to an Immobilon-FL polyvinylidene difluoride membrane (Millipore, IPEL00010). Membranes were probed for 30 min at room temperature or 4°C overnight with antibodies as follows: affinity-purified rabbit anti-OmpB antibody (11) diluted 1:200-30000 in TBS-T (20 mM Tris, 150 mM NaCl, pH 8.0, 0.05% Tween 20 (Sigma, P9416)) plus 5% dry milk (Apex, 20-241); mouse monoclonal anti-OmpA 13-3 antibody diluted 1:10000-50000 in TBS-T plus 5% dry milk; rabbit anti-OmpW serum diluted 1:8000 in TBS-T plus 5% dry milk; mouse monoclonal FK1 anti-polyubiquitin antibody diluted 1:2500 in TBS-T plus 2% BSA; rabbit anti-OmpW serum diluted 1:15000 in TBS-T plus 5% dry milk; or rabbit anti-O-antigen serum 1:5000 in TBS-T plus 5% dry milk. Secondary antibodies were: mouse antirabbit horseradish peroxidase (HRP) (Santa Cruz Biotechnology, sc-2357), or goat anti-mouse HRP (Santa Cruz Biotechnology, sc-2005), diluted 1:1000-2500 in TBS-T plus 5% dry milk. Secondary antibodies were detected with ECL Western Blotting Detection Reagents (GE, Healthcare, RPN2106) for 1 min at room temperature, and developed using Biomax Light Film (Carestream, 178-8207).
Immunofluorescence microscopy
R. parkeri infections were carried out in 24-well plates with sterile circle 12-mm coverslips (Thermo Fisher Scientific, 12-545-80). To initiate infection, 30%-purified bacteria were diluted in cell culture media at room temperature to a MOI of 0.01 for Vero cells, and a MOI of 0.1 for BMDMs. Bacteria were centrifuged onto cells at 300g for 5 min at room temperature and subsequently incubated at 33 °C. Next, infected cells were fixed for 10 min at room temperature in pre-warmed (37 °C) 4% paraformaldehyde (Ted Pella Inc., 18505) diluted in PBS, pH 7.4, then washed 3 times with PBS. Primary antibodies were the following: for staining with the guinea pig polyclonal anti-p62 antibody (Fitzgerald, 20R-PP001; 1:500 dilution), mouse polyclonal anti-NDP52 antibody (Novus Biologicals, H00010241-B01P; 1:100 dilution), a rabbit anti-Rickettsia I7205 antibody (1:500 dilution; gift from Ted Hackstadt), or anti-polyubiquitin FK1 antibody (1:250 dilution), cells were permeabilized with 0.5% Triton-X100 for 5 min prior to staining. For staining with mouse monoclonal anti-OmpA 13-3 antibody (1:5000 dilution), anti-OmpB antibody (11) (1:1,000 dilution), or rabbit anti-O-antigen serum (15) (1:500 dilution), infected cells were postfixed in methanol for 5 min at RT (no Triton-X). Cells were then washed 3 x with PBS and incubated with the primary antibody diluted as already indicated in PBS with 2% BSA for 30 min at RT. To detect the primary antibodies, secondary goat anti-rabbit Alexa-568 (Invitrogen, A11036), goat anti-mouse Alexa-568 (Invitrogen, A11004), or goat anti-guinea pig Alexa-568 (Invitrogen, A11075), Alexa 488 anti-rabbit antibody (Invitrogen, A11008; 1:500 dilution), Alexa 488 anti-mouse antibody (Invitrogen, A11001) antibodies were incubated at room temperature for 30 min (all 1:500 in PBS with 2% BSA). Images were captured as 15-25 z-stacks (0.1-μm step size) on a Nikon Ti Eclipse microscope with a Yokogawa CSU-XI spinning disc confocal with 100X (1.4 NA) Plan Apo objectives, and a Clara Interline CCD Camera (Andor Technology) using MetaMorph software (Molecular Devices). Images were processed using ImageJ using z-stack average maximum intensity projections and assembled in Adobe Photoshop. For quantification of the percentage of bacteria with pUb and p62, only bacteria that co-localized with rim-like patterns of the respective marker were scored as positive for staining. To quantify pUb, p62, NDP52, OmpB, and OmpA signal per bacteria, z-stacks were projected as stated above, and the edges of individual bacteria were marked by the freehand region of interest (ROI) function in ImageJ. Subsequently, the average pixel intensity within that ROI was measured. pUb/p62/NDP52 signal intensities were calculated by subtracting the average pUb/p62/NDP52 signal of WT bacteria from the pUb/p62/NDP52-value of each bacterium. OmpB signal intensity was calculated by subtracting the average OmpB-signal of ompBSTOP::tn bacteria from the OmpB-value of each bacterium. OmpA signal intensity was calculated by subtracting the average background-signal (areas with no bacteria) from the OmpA-value of each bacterium.
Sample preparation for mass spectrometry to determine the lysine methylome
5×107 gradient-purified WT (Passage 6), pkmt1::tn (P4) and pkmt2::tn (P4) bacteria were centrifuged at 11,000g for 3 min. Each pellet was resuspended in 50 μL Tris (10 mM)-EDTA (10 mM), pH 7.6, and incubated for 45 min in a 45 °C water bath. Bacterial surface fractions were recovered from the supernatant after centrifugation at 11,000g for 3 min. Pellet was resuspended as above and incubated for additional 45 min at 45 °C before resuspension in 50 μL Tris (10 mM)-EDTA (10 mM). Both pellet and surface fractions were boiled at 95 °C for 10 min. Samples were cooled to RT prior to addition of 20 μL 50 mM NH4HCO3, pH 7.5, and 50 μL of a 0.2% solution of RapiGest (diluted in NH4HCO3, Waters, 186001861). Next, samples were heated at 80 °C for 15 min and cooled to RT before addition of 1 μg of trypsin (Promega, V511A). Samples were digested at 37 °C overnight. To hydrolyze the RapiGest, 20 μL of 5% trifluoroacetic acid (TFA) was added to samples which were incubated at 37 °C for 90 min prior centrifugation at 15000g for 25 min at 4 °C. Supernatant samples were desalted using C18 OMIX tips (Agilent Technologies, A57003100) according to the manufacturer’s instructions and sample volume was decreased to 20 μL using a SpeedVac vacuum concentrator. Samples were stored at 4 °C prior to analysis.
TUBE assay and sample preparation for mass spectrometry
To enrich for polyubiquitylated proteins, 3×108 PFUs of “purified” WT (P6) and pkmt1::tn (P4) and pkmt2::tn (P3) bacteria were centrifuged at 14,000g for 3 min at room temperature. Next, to release the surface protein fraction, the bacterial pellets were resuspended in lysis buffer (50 mM Tris-HCI, pH 7.5, 150 mM NaCl, 1 mM EDTA and 10% glycerol), supplemented with 0.0031% v/v lysonase (Millipore, 71230), the deubiquitylase inhibitor PR619 at a final concentration of 20 μM (Life Sensor, SI9619) and 0.8% w/v octyl β-D-glucopyranoside (Sigma, O8001), and incubated on ice for 10 min with occasional pipetting of samples to break pellet into smaller pieces. Subsequently, the lysate was cleared by centrifugation at 14,000g at 4 °C for 5 min and incubated with equilibrated agarose TUBE-1 (Life Sensor, UM401) for 3 h, at 4 °C. After binding of polyubiquitylated proteins to TUBE-1, agarose beads were washed 1 time with TBS supplemented with 0.05% Tween and 5 mM EDTA, and subsequently 3 times with TBS only (no Tween or EDTA) and centrifuged at 5,000g for 5 min. To prepare samples for MS analysis, enriched proteins were digested at 37 °C overnight on agarose beads in RapiGest SF solution (Waters, 186001861) supplemented with 0.75 μg trypsin (Promega, V511A). The reaction was stopped using 1% TFA (Sigma, T6508). Octyl β-D-glucopyranoside was extracted using water-saturated ethyl acetate. Prior to submission of samples for mass spectrometry analysis, samples were desalted using C18 OMIX tips (Agilent Technologies, A57003100), according to the manufacturer’s instructions.
Liquid chromatography-mass spectrometry
Samples of proteolytically digested proteins were analyzed using a Synapt G2-Si ion mobility mass spectrometer that was equipped with a nanoelectrospray ionization source (Waters). The mass spectrometer was connected in line with an Acquity M-class ultraperformance liquid chromatography system that was equipped with trapping (Symmetry C18, inner diameter: 180 μm, length: 20 mm, particle size: 5 μm) and analytical (HSS T3, inner diameter: 75 μm, length: 250 mm, particle size: 1.8 μm) columns (Waters). Data-independent, ion mobility-enabled, high-definition mass spectra and tandem mass spectra were acquired in the positive ion mode (23–25). Data acquisition was controlled using MassLynx software (version 4.1), and tryptic peptide identification and relative quantification using a label-free approach (26, 27) were performed using Progenesis QI for Proteomics software (version 4.0, Waters). Raw data were searched against Rickettsia parkeri and Chlorocebus sabaeus protein databases (National Center for Biotechnology Information, NCBI) to identify tryptic peptides, allowing for up to three missed proteolytic cleavages, with diglycine-modified lysine (i.e., ubiquitylation remnant) and methylated lysine as variable post-translational modifications. Data-dependent analysis was performed using an UltiMate3000 RSLCnano liquid chromatography system that was connected in line with an LTQ-Orbitrap-XL mass spectrometer equipped with a nanoelectrospray ionization source, and Xcalibur (version 2.0.7) and Proteome Discoverer (version 1.3, Thermo Fisher Scientific, Waltham, MA) software, as described elsewhere (28).
Localization of tagged ubiquitin and ubiquitin pull-downs
To assess localization of 6xHis-ubiquitin during infection, confluent Vero cells grown in 24-well plates with coverslips were transfected with 2 μg of pCS2-6xHis-ubiquitin plasmid DNA using Lipofectamine 2000 (Invitrogen, 11668-019) for 6 h in Opti-MEM (Gibco, 31985-070). Subsequently, media was exchanged to media without transfection reagent and cells were incubated overnight at 37 °C and 5% CO2. The following day (~16 h after transfection), transfected cells were infected with purified WT or mutant bacteria at a MOI of 1. At 28 h.p.i., infected cells were fixed with 4% paraformaldehyde (Ted Pella Inc., 18505) diluted in PBS, pH 7.4 for 10 min, then washed 3 times with PBS. Primary anti-6xHis monoclonal mouse antibody (Clontech, 631212, diluted 1:1,000) was used to detect 6xHis-ubiquitin in samples permeabilized with 0.5% Triton-X100, and a goat anti-mouse Alexa-568 (Invitrogen, A11004) to detect the primary 6xHis antibody. Hoechst (Thermo Scientific, 62249, diluted 1:2500) was used to detect bacterial DNA. Samples were imaged as already described.
For ubiquitin pull-downs, confluent Vero cells grown in 6-well plates were transfected and infected as described above. At 28 h.p.i., cells were washed once with 1x PBS, pH 7.4, and subsequently lysed in urea lysis buffer (8 M urea, 50 mM Tris-HCI, pH 8.0, 300 mM NaCI, 50 mM Na2HPO4, 0.5% Igepal CA-630 (Sigma, I8896)) for 20 min at RT. Subsequently, samples were sonicated, and lysate was cleared by centrifugation at 15000g for 15 min at room temperature. Prior to incubation with Ni-NTA resin, an aliquot was saved for the input sample. 6xHis-ubiquitin conjugates were purified by incubation and rotation with Ni-NTA resin for 3 h, at RT, in the presence of 10 mM imidazole. Beads were washed 3 times with urea lysis buffer and 1 time with urea lysis buffer lacking Igepal CA-630. Ubiquitin conjugates were eluted at 65 °C for 15 min in 2x Laemmli buffer containing 200 mM imidazole and 5% 2-mercaptoetanol (Sigma, M6250), vortexed for 90 seconds, and centrifuged at 5000g for 5 min at RT. Eluted and input proteins were detected by SDS-PAGE followed by Western blotting, as described above.
Animal experiments
Animal research using mice was conducted under a protocol approved by the UC Berkeley Institutional Animal Care and Use Committee (IACUC) in compliance with the Animal Welfare Act. The UC Berkeley IACUC is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International and adheres to the principles of the Guide for the Care and Use of Laboratory Animals. Infections were performed in a biosafety level 2 facility. Mice were age-matched between 8 and 18 weeks old. Mice were selected for experiments based on their availability, regardless of sex. All mice were healthy at the time of infection and were housed in microisolator cages and provided chow and water. Littermates of the same sex were randomly assigned to experimental groups. For infections, R. parkeri was prepared by diluting 30%-prep bacteria into cold sterile 1x PBS to 5×106 PFU per 200 μL. Bacterial suspensions were kept on ice during injections. Mice were exposed to a heat lamp while in their cages for approximately 5 min and then each mouse was moved to a mouse restrainer (Braintree, TB-150 STD). The tail was sterilized with 70% ethanol, and 200 μL of bacterial suspensions were injected using 30.5-gauge needles into the lateral tail vein. Body temperatures were monitored using a rodent rectal thermometer (BrainTree Scientific, RET-3). Mice were monitored daily for clinical signs of disease, such as hunched posture, lethargy, or scruffed fur. If a mouse displayed severe signs of infection, as defined by a reduction in body temperature below 90 °F or an inability to move around the cage normally, the animal was immediately and humanely euthanized using CO2 followed by cervical dislocation, according to lACUC-approved procedures (16).
Statistical analysis, experimental variability and reproducibility
Statistical parameters and significance are reported in the legends. Data were considered to be statistically significant when p < 0.05, as determined by a one-way ANOVA with Dunnett’s post-hoc test, a Kruskal-Wallis test with Dunn’s post-hoc test, a Brown-Forsyth and Welch ANOVA with Dunnett’s post-hoc test, or a two-way ANOVA (all two-sided). Statistical analysis was performed using PRISM 6 software (GraphPad Software). If not otherwise described, n indicates the number of independent biological experiments executed at different times.
ACKNOWLEDGEMENTS
We thank Dr. Hwan Kim (Stony Brook University) for kindly providing the O-antigen antibody and for fruitful discussions. We are also grateful for the Atg5flox/flox and Atg5-/- BMDMs provided by Dr. G. Golovkine, a member of the laboratory of Prof. Jeffery S. Cox (UC Berkeley), and Prof. Michael Rape at UC Berkeley for fruitful discussions.