Abstract
Infection or vaccination leads to the development of germinal centers (GCs) where B cells evolve high affinity antigen receptors, eventually producing antibody-forming plasma cells or memory B cells. We followed the migratory pathways of B cells emerging from germinal centers (BEM) and found that many migrated into the lymph node subcapsular sinus (SCS) guided by sphingosine-1-phosphate (S1P). From there, B cells may exit the lymph node to enter distant tissues. Some BEM cells interacted with and took up antigen from SCS macrophages, followed by CCL21-guided return towards the GC. Disruption of local CCL21 gradients inhibited the recycling of BEM cells and resulted in less efficient adaption to antigenic variation. Our findings suggest that the recycling of BEM cells, that transport antigen and that contain the genetic code for B cell receptor variants, may support affinity maturation to antigenic drift.
The hallmark of adaptive immunity is memory, which is mediated by the expansion and long-term survival of antigen-specific lymphocytes, affinity maturation of B lymphocytes, and the long-term production of neutralizing antibody. Affinity maturation of B cells occurs via molecular evolution in germinal centers (GCs) (Zhang et al., 2016). This involves cycles of B cell proliferation and the mutation of B cell receptor genes, followed by natural selection of B cells expressing the highest affinity B cell receptors. The output of the GC reaction is high affinity antibody-producing plasma cells and memory B cells, both providing long-term immunity (Weisel et al., 2016; Yoshida et al., 2010; Zhang et al., 2018).
Plasma cells can be very long-lived (Landsverk et al., 2017), as are memory B cells (Gitlin et al., 2016; Pape et al., 2018). Interestingly, the affinity-dependent selection of memory B cells in the GC is less stringent than that seen for plasma cells, resulting in a highly variable pool of antigen-specific cells (Suan et al., 2017). As long-term immunity can be provided by long-lived plasma cells, the advantage of a low quality B cell output from the GC is not immediately obvious (Zinkernagel, 2018). However, their high variability may provide a pool of cells with the potential to protect against pathogen variants. Memory B cells can sense specific antigen, rapidly enter secondary responses, immediately present antigen to memory T cells (Ise et al., 2014; Jelcic et al., 2018), and generate new plasma cells within days (Mesin et al., 2020; Moran et al., 2018; Toellner et al., 1996).
Lymph nodes are important sites for the initiation of the adaptive immune response. They represent a platform where immunological information is sequestered and exchanged. Resident cells, including B cells, occupy distinct anatomical niches, and their movement between different areas of the lymph node is required for the progression of a GC reaction (Yi et al., 2012). One important structure in this regard is the subcapsular sinus (SCS), the primary area into which tissue derived lymph fluid drains, bringing antigens and pathogens. The SCS houses a subset of CD169+ macrophages that are specialized for antigen acquisition and pathogen defense (Moseman et al., 2012) and shuttle antigen to naïve and memory B cells (Arnon et al., 2011; Carrasco and Batista, 2007; Junt et al., 2007; Moran et al., 2018).
Results
Appearance of memory like B cells entering the subcapsular sinus guided by S1PR
In order to track the migration of antigen-specific B cells and plasma cells as they emerged from primary GCs in draining lymph nodes (drLN) following immunization, we adoptively transferred 4-hydroxynitrohpenyl (NP)-specific B cells from B1-8i mice (Sonoda et al., 1997), which express eGFP under the control of the Prdm1 promoter (Kallies et al., 2004) (labelling plasmablasts and plasma cells with eGFP) and Cdt1-mKO2 hybrid protein (Sakaue-Sawano et al., 2008) (labelling cells in G0/G1 phase of cell cycle with mKO2), and immunized with NP coupled to the carrier protein chicken gamma globulin (CGG). As we previously described (Zhang et al., 2018), plasmablasts emerged from the interface between the GC dark zone and T cell areas (Fig. 1A). Large numbers of antigen-specific B cells were located in the outer follicle surrounding GCs, typically close to the LN SCS (Fig. 1A). Cdt1-mKO2 labelling of these B cells suggests that they were recently activated B cells that emerged from adjacent GCs (BEM). This is reminiscent of historical observations describing the accumulation of marginal zone-like memory B cells under the SCS (Liu et al., 1988; Stein et al., 1980), and recent descriptions of switched memory B cells in follicles around GCs and under the SCS (Aiba et al., 2010; Moran et al., 2018).
In order to identify GC-derived BEM in drLNs and their migration to non-reactive distant lymphoid tissues (distLNs), we used the well-established Cγ1-Cre reporter strain, which induces constitutive expression of GFP in B cells after T cell-dependent activation, which includes GC-lineage B cells (Casola et al., 2006). We crossed these with mice expressing B cell receptors specific for the hapten 4-hydroxynitrophenyl (NP) (Cascalho et al., 1996; Marshall et al., 2011) and a Cre-inducible eGFP reporter (QM Cγ1Cre mTmG mice) (Casola et al., 2006; Muzumdar et al., 2007). We immunized wild type (WT) host mice that had received a small number of antigen-specific B cells from QM Cγ1Cre mTmG. We observed that GC B cells (eGFP+NP+CD38lowFas+) were detectable from 4 d after immunization with maximum numbers seen at 6 - 10 d (Fig. 1 B-D). Within a day of GCs reaching maximum size, there was the emergence of a population of B cells that were eGFP+, NP-binding, CD38high, Fasint, CD138-, Bcl6low (Fig. 1B) in the drLN (Fig. 1C, D). These cells also started to express markers associated with memory B cells such as CD73, CD80 and PD-L2 (Weisel et al., 2016). At the same time, antigen-activated B cells were observed in distant lymphoid tissues (Fig1 B – D). These eGFP+ circulating memory B cells (BCM) were confirmed to be antigen-specific, expressed CD62L at similar levels to naïve B cells, and high levels of CD73, CD80, and PDL2 (Fig. 1D). This suggests that the presence of BEM close to the SCS at the peak of the GC response is related to emigration of antigen-activated B cells from the drLN through the SCS, generating systemic cellular B cell immunity.
Further immunohistological examination of drLNs around the peak of BEM migration (Fig. 1 E-H) showed that the eGFP+ BEM in B cell follicles surrounding the GC were still in cell cycle (Fig. 1G). Staining with Lyve-1 and ER-TR7, to identify the SCS floor and ceiling respectively, showed that indeed some BEM had moved into the SCS (Fig. 1H). These data suggest that BEM move from the GC into the SCS, from where they may join the efferent lymph flow (Girard et al., 2012), leaving the drLN to disseminate via blood into distant lymphoid tissues.
Intravital imaging of drLN of Cγ1Cre mTmG mice confirmed that a large number of eGFP+ BEM had actively migrated between the GC and the SCS (Fig. 2A, suppl. movie 1,2). BEM entered the SCS lumen (Fig. 2B), where some moved along the SCS (Fig. 2C) presumably migrating towards efferent lymphatics. Surprisingly, some BEM, after a short pause around macrophages in the SCS, re-entered the LN follicles through the SCS floor and migrated back towards the GC (Fig. 2B, D).
To examine the factors that regulate the migration of BEM from GCs, we performed RNASeq analysis of FACS sorted eGFP+ BEM in LNs comparing them to naïve B cells, GC B cells, and BCM from distLNs. Principle component analysis of all genes expressed by these four subsets of cells confirmed a close relationship of eGFP+ BEM with GC B cells, whereas eGFP+ BCM in distLN are much closer to naïve B cells (Fig. 2E). This was also evident in the number of individual genes differentially expressed, with a greater number of genes differentially expressed regarding the transition from naïve to GC B cells, and a larger overlap in genes coexpressed in GC B cells and BEM (Fig. 2F). Analysis of migratory receptors during the transition from GC B cells into BEM by qRT-PCR revealed a loss of expression chemokine receptors known to be associated with B cells location in the GC (Cxcr5, Cxcr4, S1pr2) (Green and Cyster, 2012), and increased expression of the receptors S1pr1, S1pr3, S1pr4, Ebi2, Cxcr3, Ccr6, and Ccr7 (Fig. 3G, H). CCR6, EBI2, and CXCR3 are known to be expressed on memory B cells (Stoler-Barak et al., 2019; Suan et al., 2017). Blockade or deletion of these receptors, however, did not lead to a noticeable change in the appearance of BCM in distLNs. S1P receptors, particularly S1PR1 and S1PR2, are known to direct the location of B cells in the follicle center and their emigration into lymph vessels (Green and Cyster, 2012). In vivo S1PR blockade using FTY720 led to a dramatic reduction of BCM in blood and distLNs (Fig 3I), while there was no noticeable effect on the numbers of other lymphocytes in distant lymphoid tissues. This suggests that S1PR guides memory B cell migration into the SCS and to lymphatic vessels.
CCR7 dependent recycling of BEM
The intravital imaging we performed (Fig. 2A-D) showed that many BEM after entering the SCS returned to the follicles. Dendritic cells (DC), arriving in the SCS from afferent lymph migrate into the lymph node guided by local CCL21 gradients that are sensed by CCR7 on DC (Ulvmar et al., 2014). As B cells upregulate CCR7 during the transition from GC B cell to BEM (Fig. 2H, 3A), we hypothesized that a local CCL21 gradient might have a similar role for BEM return into the drLN, as it has for DCs. In order to test this, QM CCR7+ mT+ and QM CCR7ko eYFP+ B cells were co-transferred into WT mice and their migration assessed after immunization. CCR7 is required for the initial activation of naïve B cells, enabling B cell migration into T cell zones (Okada et al., 2005; Reif et al., 2002). Therefore, CCR7-deficient B cells were underrepresented in activated B cell populations (antigen-specific GC B cells, plasma cells, and BEM) in the drLN (Fig. 3B). Despite this, there was an increase in Ccr7-/- BCM in blood, distLNs, spleen, and bone marrow (Fig. 4B, C). This is compatible with a role for CCL21 in orchestrating BEM re-entry into the follicle from the SCS. Without cues sensed by CCR7, BEM are unable to move back from the SCS into the LN parenchyma and therefore appeared in larger numbers in blood and distant lymphoid tissues.
The non-signaling atypical chemokine receptor 4 (ACKR4) is expressed in the SCS ceiling endothelium and shares the ligands CCL19 and CCL21 with CCR7. ACKR4 generates the CCL21 chemokine gradient that guides DCs into lymph nodes (Ulvmar et al., 2014). To test whether CCR7-mediated retention of BEMin the drLN is dependent on an ACKR4-generated chemokine gradient, we co-transferred QM mT+Ackr4+/+and QM eYFP+ Ackr4-/- B cells into Ackr4+/+ or Ackr4-/- hosts and immunized with NP-CGG. While ACKR4-deficiency on B cells had no significant effect on the size of the GC compartment nor affected BEM numbers in the drLN, ACKR4-deficiency of the LN environment led to decreased numbers of antigen-specific BEM being retained in the drLN and higher numbers appearing in the blood (Fig. 3D). This suggests that chemotactic cues generated in the SCS environment organize BEM reentry into the drLN. In the absence of these, BEM leave the SCS in larger numbers to appear as BCM in the efferent lymph and distLNs.
To further test this, we followed the accumulation of BEM in the SCS of drLN by fluorescence microscopy in immunized Cγ1Cre mTmG mice that were Ackr4+/+or Ackr4-/-. This revealed a significantly increased retention of BEM in the SCS of ACKR4-/- drLN 8 d when BEM recycle in the drLN (Fig. 3E, F). There was also an increased number of BCM arriving in ACKR4-/- distLNs, and this difference persisted until d 14 (Fig. 5F). Intravital two-photon microscopy confirmed the increased numbers of BEM in the SCS of drLNs of ACKR4-deficient mice (Fig 5G, H, suppl. Fig. S1, suppl. movie 3). Importantly, BEM re-entry from the SCS into the lymph node was rarely observed when ACKR4 was absent (suppl. movie 4).
BEM recycling supports adaption to antigenic drift
We next considered the functional significance of BEM LN re-entry from the SCS into the B cell follicle. Of note, we observed that BEM appeared to undergo prolonged interaction with CD169-positive SCS macrophages (Fig. 4A, suppl. Fig. S2, suppl. movie 5) before reentering the LN parenchyma. Intravital imaging of cytoplasmic calcium levels showed an increase in calcium specific to B cells contacting SCS macrophages (Fig. 4B, suppl. Fig. S3), suggesting an antigen-specific interaction between BEMand antigen-carrying SCS macrophages. SCS macrophages are known to transfer antigens to naïve B cells (Carrasco and Batista, 2007; Junt et al., 2007). A recent study showed similar interactions of antigen-specific memory B cells during secondary responses (Moran et al., 2018). For some BEM, we observed that they acquired CD169-labelled material from SCS macrophages (Fig. 4C, suppl. movie 7), suggesting that BEM acquire and transport antigen from SCS macrophages into the GC. To test this, mice were immunized with rabbit-IgG and eight days later injected with AlexaFluor647-labelled mouse anti-rabbit immune complex (IC). Within 10 min, IC was seen associated with SCS macrophages. IC was also present inside intranodal lymphatics and entering the lymph node parenchyma. BEM within the SCS were in intimate contact with IC-carrying cells, whereas inside the LN parenchyma, those BEM that were close to the SCS carried speckles of IC (Fig. 4D). Flow cytometry confirmed that 20 – 30 % of BEM carried increased amounts of IC within minutes of IC injection (Fig. 4E). Together, these data suggest that BEM may be activated by specific antigen in the SCS, and can transport this back into the LN parenchyma.
GCs typically contain large amounts of antigen deposited on follicular dendritic cells (FDC). Therefore, additional antigen deposition by BEM seems unnecessary, unless the antigen is changing during the course of an infection. BEM, are a GC output with highly variable affinity and specificity for antigen, and would therefore include cells that may interact with antigenic variants. To test the hypothesis that BEM recycling has a role in adaption to antigenic drift, we used variants of the hapten NP and measured the adaption of affinity maturation to these variants. The B cell response of C57BL/6 mice is dominated by a canonical IgH VDJ BCR combination that has natural affinity to 4-hydroxy-iodo-phenyl (NIP), and reduced affinity to the variants NP, dinitrophenyl (DNP) and trinitrophenyl (TNP) (Fig. 4F). C57BL/6 mice were immunized with NIP-KLH. After the onset of BEM recycling, we rechallenged in the same foot with NP, DNP, followed by TNP-KLH. Three days after the last injection we observed a shift in antibody affinity towards TNP (suppl. Fig. S4). In order to test whether this was dependent on BEM recycling, the experiment was repeated in Ackr4ko mice, where BEM cannot undergo recycling. This showed that without BEM recycling, the drift towards the new antigenic variant was significantly reduced (Fig. 4G).
The SCS is the site of antigen entry into the lymph node. We have shown that BEM collect antigen from this important anatomical site, as described for naïve B cells. For naïve B cells, however, this is mediated mainly by non-antigen-specific receptors (Carrasco and Batista, 2007). Many pathogens, particularly viruses, mutate frequently leading to antigenic drift that, during the course of a primary infection, can lead to a large accumulation of VDJ gene mutations (Schoofs et al., 2019). The recycling of highly variable BEM through the SCS described here allows for BCR-dependent selection of B cell variants reacting with mutated antigen. This may accelerate affinity maturation to antigenic drift, not only because BEM transport antigenic variants back into the GC, but more likely because they provide genomic code for immunoglobulin variants that can kickstart affinity maturation to the variant antigen. We do not know whether BCM upon leaving the reactive lymph node act in a similar way when they encounter antigen in other sites. While some low affinity B cells can enter GCs during recall responses (Wong et al., 2020), most mature memory B cells are primed to differentiate into plasma cells (Mesin et al., 2020; Moran et al., 2018; Toellner et al., 1996; Viant et al., 2020). Whether this change in memory B cell function matures with time in absence of stimulation by antigen, or is induced by specific environments remains to be seen.
Funding
YZ, CJMB, JCYP, and KMT were funded by the BBSRC (BB/S003800/1, BB/M025292/1). LGC and GB were supported by EU Marie Curie Initial Training Network DECIDE. VLJT was supported by the Francis Crick Institute which receives its core funding from Cancer Research UK (FC001194), the UK Medical Research Council (FC001194), and the Wellcome Trust (FC001194). LSL was funded by a Wellcome Trust Clinical Research Training Fellowship (104384/Z/14/Z). MRC is supported by a Medical Research Council New Investigator Research Grant (MR/N024907/1), a Chan-Zuckerberg Initiative Human Cell Atlas Technology Development Grant, a Versus Arthritis Cure Challenge Research Grant (21777), and an NIHR Research Professorship (RP-2017-08-ST2-002). There are no competing interests.
Authors contributions
Conceptualization: YZ, AR, AEH, MRC, KT, Methodology: YZ, LGI, CU, MRC, Formal analysis: CJB, Investigation: YZ, LGI, CU, LSL, TWD, JRF, JMW, CJB, JYP, LZ, Writing: YZ, LGC, CU, MRC, KMT, Writing - review and editing: GB, VLT, AEH, MRC, KMT, Visualisation: CU, LSL, TWD, JRF, Supervision: YZ, VLT, AEH, MRC, KMT, Funding acquisition: YZ, LSL, GB, VLT, AEH, MRC, KMT All data is available in the manuscript or the supplementary materials.
Supplementary materials and figures
Materials and Methods
Mice and immunization
C57BL/6J mice (wild type, WT) were purchased from Harlan laboratories. ACKR4tm1.1Rjbn (ACKR4-/-) mice (1) were a gift from R. Nibbs (University of Glasgow). Cγ1Cre mTmG mice were generated by crossing Ighg1tm1(cre)Cgn (2) with Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo mice (3) (Jackson lab). For all adoptive transfer experiments, variants of QM mice were used, which were homozygous NP-specific Ig heavy chain variable region from Igh-Jtm1(VDJ-17.2.25)Wabl and Igktm1Dhu (4). Some QM mice contained a constitutively expressed enhanced yellow fluorescent protein (eYFP) derived from Gt(ROSA)26Sortm1.1(EYFP)Cos (5) (QM eYFP mice), if crossed with Rosa26mTmG, called QM mT. QM CCR7 mice are QM crossed with CCR7tm1Rfor mice (6). Animal studies were performed with approval of local ethical committees and under appropriate governmental authority.
NP (4-hydroxy-3-nitrophenyl acetyl) was conjugated to CGG (Chicken γ-globulin) at a ratio of NP18-CGG. Mice were immunized into plantar surface of their rear feet with 20μg NP18-CGG alum precipitated plus 105 chemically inactivated Bordetella pertussis (B.p.) (LEE laboratories, BC, USA) (7). Popliteal lymph node (pLN) were analyzed as reactive (or draining) lymph nodes, and axillary and brachial lymph nodes as remote (or distant) lymph nodes.
FTY720 (Caymanchem, USA) was given at 1mg/kg body weight via i.p. at d6 and d7 after NP-CGG on feet of mice which received 2×105 NP+ B220+ cells. For immune complex injections, 4 μg of Alexafluor 647 labelled immune complex (IC) was made with 1:1 ratio of Alexafluor647 conjugated mouse anti-rabbit IgG plus rabbit IgG, mixed 30 minutes before injection into the foot, 8 d post priming with 20 μg rabbit IgG alum precipitated with 105 B.p.
For antigenic drift experiments ACKR4-/- mice and litter mate wild type control mice were primed with 10 μg of NIP-KLH in alum precipitated with 105 B.p. in the rear feet. 8 d later, mice were boosted with 1 μg of soluble NP-KLH, DNP-KLH, and TNP-KLH on the same feet every 2 days (NP conjugates from Biosearch Technologies, USA).
Immunohistology
Lymph node sections were prepared and stained as described previously (8, 9). CD138 (281-2) and IgD APC (11-26c, BD BioSciences), biotinylated peanut agglutinin (PNA) (Vector Labs), Ki-67 and LYVE-1 (Abcam), ER-TR7 (eBioscience) were used. Secondary antibodies were Cy3-conjugated donkey anti-rat or donkey anti-rabbit (Jackson ImmunoResearch Laboratories, West Grove, PA) and Alexafluor 405 conjugated streptavidin (Invitrogen UK). Slides were mounted in ProLong Gold antifade reagent (Invitrogen, UK) and left to dry in a dark chamber for 24 h. Images were taken on a Leica DM6000 fluorescence-microscope, or Zeiss Axio ScanZ1. Image data were processed using Fiji (10) or ZEN (Carl Zeiss Germany).
Flow Cytometry and adoptive transfer
Cells from spleens and lymph nodes were prepared as described (8). Red blood cells were lysed by ACK lysing buffer (Gibco). Cell suspensions were blocked by CD16/32 (93, eBioscience) diluted in FACS buffer (PBS supplemented with 0.5% BSA plus 2mM EDTA), followed with staining cocktail. PD-L2 biotin (TY25) and B220-BV421 or BV510 (RA3-6B2) and Str. BV421 or BV711 were from BioLegend, NP was conjugated in house with PE for detected antigen specific B cells (8). CD38 APC (90), GL7 eFluor 450 (GL7), CD86 PE-Cy5 (GL1), CD80 PE-Cy5(16-10A1), and CD73 PE-Cy7 (eBioTY) were from eBioscience. CXCR4 biotin (2B11), Fas PE-Cy7 (Jo2) and CD138 APC or BV421 (281-2) were from BD Bioscience. Samples were analyzed using BD LSRFortessa Analyzer (BD Biosciences, USA) with the software BD FACSDiva (BD Biosciences). Data were analyzed offline with FlowJo (FlowJo LLC, USA). For adoptive transfer experiment, 2×105 NP+ B220+ cells from spleens of fluorescent protein labelled QM background mice were transferred into C57BL6/J hosts 1 d before immunization with NP-CGG in alum on rear feet. In co-transfer experiments, a mix of 1×105 of NP+B220+ B cells of each genotype respectively were injected i.v.
Intravital microscopy
Intravital microscopy of popliteal lymph nodes of Cγ1Cre mTmG mice were performed 8 days after immunization with NP-CGG in alum ppt on plantar surface of rear feet. Subcapsular sinus macrophages were labelled with CD169-A647 antibody (BioLegend) injected subcutaneously to foot before imaging. Popliteal LN imaged under anesthesia with a Chameleon Ti:Sapphire multiphoton laser and Leica SP8 microscope. Images were acquired using a 25x objective, with one Z stack every 30 to 40 seconds, and processed using either Bitplane Imaris or Fiji ImageJ (11).
Cell sorting for qRT-PCR, RNA-seq library preparation and data analysis
Draining LN and distant LN in mice 8 d after foot immunization with NP-CGG in alum and B.p were stained as described above. Naive B cells, GC B cells, plasma cells, BEM cells from drLN and BCM from distLN were sorted using a high speed cell sorter (MoFlo, Beckman-Coulter).
For real time PCR, RNA was purified by using the RNeasy Mini kit (QIAGEN), cDNA preparation was as described as before (8). Real-time PCR from cDNA (qRT-PCR) was done in multiplex with β2-microglobulin and gene expression related to β2-microglobulin gene expression levels. Primers and probes are listed in Zhang et al 2018 (12), and as follows: S1pr2 Fwd: GGCCTAGCCAGTGCTCAGC, Rev: CCTTGGTGTAATTGTAGT, probe: FAM-CAGAGTACCTCAATCCTGA-TAMRA. CCR7 Fwd: GGTGGCTCTCCTTGTCATTTTC, Rev: GTGGTATTCTCGCCGATGTAGTC, probe: FAM-TGCTTCTGCCAAGATGAGGTCACCG-BHQ1. Cxcr3 (Mm00438259_m1), Ccr6 (Mm01700300_g1), Ebi2 (Mm02620906_s1) were TaqMan gene expression assays (Thermo Fisher Scientific, UK). S1pr1 and Ackr4 were run with SYBRGreen realtime PCR (Thermo Fisher Scientific). S1pr1, Fwd: AAATGCCCCAACGGAGACT, Rev: CTGATTTGCTGCGGCTAAATTC. Ackr4: Fwd: TGG ATC CAA GAT AAA GGC GGG GTG T143YES, Rev: TGA CTG GTT CAG CTC CAG AGC CAT G For RNA-seq, cells were directly sorted into 500ul of Trizol. The total RNA was purified using the RNeasy Plus Micro kit (QIAGEN) according to the manufacturer’s instructions. Un-stranded, non-rRNA, non-polyA+ selected libraries were prepared using the SMARTer Ultra Low Input RNA kit for Sequencing v3 (Clontech Laboratories). The libraries were sequenced on the Illumina HiSeq 2000 platform (Illumina, Crick advanced sequencing) as 75 bp paired-end runs.
The sequencing data was analyzed using Partek® Flow® software, version 8.0.19 Copyright ©; 2019 Partek Inc., St. Louis, MO, USA. Paired sequencing data was imported and then aligned to mouse genome GRCm38 (mm10). t-SNE analysis was performed on normalized RNA counts to generate a 2D plot by dimensional reduction. Gene specific analysis (GSA) tool was used to identify differentially expressed genes against naïve B cells subset as a control. GSA used the lognormal and negative binomial response distribution under the multi-model approach and a lowest maximum coverage of 1.0 was used as the low-value filter. Venn diagrams were produced from differential expression of genes with a log fold change >1 and P-value <0.05 using BioVenn (Hulsen et al., 2008). The heatmap was produced from GSA data as described earlier from a predetermined list of genes of interest using the Hierarchical Clustering tool; genes were clustered based on their average Euclidean distance from one another.
Calcium imaging by intravital microscopy
C57BL6/J mice received B cells from B18hi mice (carrying the Vh186.2 heavy chain with high affinity to NP) that contained genetically encoded Ca2+ indicator TN-XXL (13) under the control of the CD19 promoter (14). These were immunized with 10 µg NP-CGG emulsified in complete Freund’s adjuvant (CFA) into the right foot. The popliteal LN was analyzed at day 7. One day prior to imaging, a mixture of 10 µg anti-CD21/35 Fab (clone 7G6) -Atto590 (produced at the DRFZ) for staining follicular dendritic cells and 10 µg CD169-efluor660 (eBioscience) to label SCS macrophages were injected into the footpad.
Intravital two-photon microscopy was performed as described before (15), using a TrimScope II from Lavision Biotec, at an excitation of 850 nm (TiSa) and 1100 nm (OPO). The detection of the fluorescence signals was accomplished with photomultiplier tubes in the ranges of (466 ± 20) nm, (525 ± 25) nm and (655 ± 20) nm.
TN-XXL is a genetically encoded calcium indicator that consists of a chicken troponin C domain connecting the fluorescent proteins eCFP and Citrine (Suppl. Fig. S7A). These act as a Förster resonance energy transfer (FRET) pair with ECFP as the donor and Citrine as the acceptor fluorophore. Troponin C contains four binding lobes for Ca2+ ions. If Ca2+ is present or cytosolic concentrations are elevated this leads to a conformation change of the linker peptide that causes donor and acceptor to come into sufficient proximity for FRET emission. When quenched ECFP is excited with one photon at 475 nm, or two photons at 850 nm, citrine will emit fluorescence at 530nm. If no calcium is present, emission in the blue range of the donor group will be more prominent.
Measurements from six immunized mice were analyzed with image analysis software Imaris (Bitplane AG). Raw data was pre-processed using a linear unmixing algorithm (16) to minimize interference of red fluorescence from antibody staining into the green channel of the citrine fluorescence. Relative FRET ratio was calculated from dividing green fluorescence gain by the sum of blue and green fluorescence, and corrected for instrument-specific values and spectral overlap. A colocalization channel was used to measure contact intensity between B cells (citrine-positive, masked on eCFP to exclude OPO influence) and CD169-efluor660 signal. Using the histogram of the colocalization intensity mean of the B cell surfaces, we identified distinguishable populations of B cells (Suppl. Fig. S7F) with either no contact (-) or tight contact (+). All B cells with colocalization intensity of 0 AU were assigned to the (-) group. To choose a threshold value of colocalization intensity for B cells to be assigned to the (+) group, we biexponentially fitted the decay of the histogram and determined the point in which cell numbers intersect the plateau of y=9,509 to be 717 AU. Non-contacting B cells and B cells with colocalization intensities >717 AU were filtered and corresponding FRET intensities of all cells at all time points exported for plotting.
Statistical analysis
All analysis was performed using GraphPad Prism 6 software. To calculate significance two-tailed Mann-Whitney non-parametric test was used. In the experiments where 2 parameters from the same individual mouse are compared, Wilcoxon matched-pairs signed rank test (paired non-parametric test) was used to calculate significance. Statistics throughout were performed by comparing data obtained from all independent experiments. P values <0.05 were considered significant (*). *p<0.05, ** p< 0.01, *** p<0.001, ****p<0.0001
Supplementary figures
Supplementary movies
Supplementary movie 1: movement of BEM between GC and SCS and in and out of the SCS.
Intravital microscopy. Overview of a Cγ1Cre mTmG ACKR4+/+ drLN day 8 after foot immunization. Cγ1Cre-dependent expression of eGFP (green) shows GC and BEM. CD169 (blue) indicates location of SCS with SCS macrophages. Red: dTomato expressing stroma. Grey: second harmonic.
Supplementary movie 2: GFP+ BEM moving into the SCS and reentry into drLN
Intravital microscopy. Higher power video of SCS of a Cγ1Cre mTmG ACKR4+/+ drLN 8 d after foot immunization. Cγ1Cre-dependent expression of eGFP (green) shows GC and BEM. CD169 (blue) indicates SCS macrophages. Red: dTomato expressing stroma. Grey: second harmonic. Blue line: Track of BEM entering the SCS. White line: Track of BEM returning into the lymph node from the SCS.
Supplementary movie 3: Location of BEM in relation to SCS macrophages and SCS lumen in wt and ACKR4ko drLN.
Intravital microscopy. 3D still image of SCS of a Cγ1Cre mTmG ACKR4+/+ drLN 8 d after foot immunization. Cγ1Cre-dependent expression of eGFP (green) indicating BEM. CD169 (blue) SCS macrophages lining the SCS floor endothelium. Red: dTomato expressing stroma. Grey: second harmonic indicating the LN capsule. BEM can be seen inside the LN parenchyma and having entered the SCS.
Supplementary movie 4: BEM moving along the SCS in ACKR4-/- drLN
Intravital microscopy of SCS of a Cγ1Cre mTmG ACKR4-/- drLN 8 d after foot immunization. Cγ1Cre-dependent expression of eGFP positive B cells (green and white). CD169 (blue) SCS macrophages lining the SCS floor endothelium. Red: dTomato expressing stroma. Tracked cells (white) can be seen moving inside the SCS, but not reentering the LN parenchyma.
Supplementary movie 5: Prolonged interaction of BEM with SCS macrophage
Intravital microscopy of a Cγ1Cre mTmG drLN 8 d after foot immunization. Cγ1Cre-dependent expression of eGFP (green) indicating BEM. Red: dTomato expressing stroma. Blue: CD169 on SCS macrophages.
Supplementary movie 6: Colocalization of BEM with increased Ca2+ and SCS macrophages
Animated GIF merging images from Fig. 6B, showing surface rendering of CD169+ve macrophages (purple), FDC in GC (orange), GC B cells and BEM (green), and on second frame FRET intensity of green B cells shown in first frame, color-coded for mean FRET intensity
Supplementary movie 7: BEM removing CD169+ material from SCS macrophage
Intravital microscopy of a Cγ1Cre mTmG drLN 8 d after foot immunization. Cγ1Cre-dependent expression of eGFP (green) indicating BEM. Red: dTomato expressing stroma. CD169+ material (blue) can be seen at the trailing edge of the migrating BEM.
Acknowledgments
Abbreviations
- BEM
- memory like B cell emerging from germinal centers
- BCM
- circulating memory B cell
- S1P
- sphingosine-1-phosphate
- GC
- germinal center
- ACKR4
- atypical chemokine receptor 4
- NP-CGG
- 4-hydroxy-nitrophenyl coupled to chicken gamma globulin
- QM
- quasi-monoclonal mouse
- SCS
- subcapsular sinus
- pLN
- popliteal lymph node
- drLN
- draining lymph node
- distLN
- distant lymph node
- DC
- dendritic cell
- FDC
- Follicular dendritic cells
- IC
- immune complex