New Results

Astrocyte-derived TNF and glutamate critically modulate microglia reactivity by methamphetamine

Teresa Canedo, Camila Cabral Portugal, Renato Socodato, Joana Bravo, Tiago Oliveira Almeida, João D. Magalhães, Sónia Guerra-Gomes, João Filipe Oliveira, Nuno Sousa, Ana Magalhães, João Bettencourt Relvas, Teresa Summavielle
doi: https://doi.org/10.1101/2021.02.22.432170

Abstract

Methamphetamine (Meth) is a powerful illicit psychostimulant, widely used for recreational purposes. Besides disrupting the monoaminergic system and promoting oxidative brain damage, Meth also causes neuroinflammation that contributes to synaptic dysfunction and behavioral deficits. Aberrant activation of microglia, the largest myeloid cell population in the brain, is a common feature in neurological disorders linked to cognitive impairment and neuroinflammation. In this study, we investigated the mechanisms underlying the aberrant activation of microglia elicited by Meth in the adult mouse brain. We found that binge Meth exposure caused microgliosis and disrupted risk assessment behavior (a feature that usually occurs in human Meth abusers), both of which required astrocyte-to-microglia crosstalk. Mechanistically, Meth triggered a detrimental increase of glutamate exocytosis from astrocytes (in a manner dependent on TNF production and calcium mobilization), promoting microglial expansion and reactivity. Ablating TNF production or suppressing astrocytic calcium mobilization prevented microglia reactivity and abolished the behavioral phenotype elicited by Meth exposure. Overall, our data indicate that glial crosstalk is critical to relay behavioral alterations caused by acute Meth exposure.

One Sentence Summary Glial crosstalk under methamphetamine exposure

Introduction

Methamphetamine (Meth) is a potent and highly-addictive psychostimulant that causes long-lasting harmful effects in the central nervous system (CNS)1, 2. Meth toxicity is classically characterized by severe disruption of the dopaminergic system, causing oxidative stress and behavioral deficits3, 4. More recently, release of proinflammatory mediators and glutamate were also reported5, 6.

There is a growing understanding that the interplay between neuronal and glial cells is important for the build-up and maintenance of addiction7–9. Gliotransmission is implicated in drug-seeking modulation, with particular focus on glutamatergic signaling10, 11, that can trigger calcium influx, leading to reactive oxygen species (ROS) formation and subsequent oxidative damage12. However, the overall contribution of such mechanisms to the addictive process remains unclear13, 14.

Microglia and astrocytes play crucial roles in brain injury and repair15, 16, but their sustained reactivity – often increasing the production of proinflammatory mediators like TNF, glutamate, and ROS17, 18 – may result in damage to the brain parenchyma19, 20. Under exposure to psychoactive substances, microglia may also become highly reactive, augmenting the release of proinflammatory mediators13, and in early abstinence this reactivity might increase the likelihood of relapse9, 13. Therefore, a better understanding of the microglia reactivity and associated brain immune-pathways in response to psychostimulants is paramount to implement relevant interventions for treating addictive behaviors. In accordance, we have recently demonstrated that binge alcohol administration to adult mice causes aberrant synaptic pruning and loss of prefrontal cortex excitatory synapses, increasing anxiety-like behavior, which is prevented by pharmacological blockade of Src activation or by reducing TNF production in microglia21.

Here, we investigated how Meth interferes with microglia reactivity. Our results showed that the behavioral alterations caused by binge Meth exposure are mediated by astrocyte-microglia crosstalk in which release of glutamate from astrocytes in a TNF/IP3 receptor (IP3R)/SNARE-dependent manner leads to microglial activation, neuroinflammation, and ultimately to changes in behavior.

Materials and Methods

Animals

All experiments were in accordance with the Directive 2010/63/EU and approved by the competent authorities Direcção Geral de Alimentação e Veterinária (DGAV) and i3S Animal Ethical Committee (ref.2018-13-TS and DGAV 17469/2012). Researchers involved in animal experimentation were FELASA certified. All efforts were made to minimize animal suffering and the number of animals used.

Mice were housed under specific pathogen-free conditions, controlled environment (20°C, 45–55% humidity) with an inverted 12h/12h light/dark cycle, and allowed free access to food and water. Because of the potential behavioral variability related to the estrous cycle in females22, only male mice were used. C57BL/6 male mice were obtained from the i3S animal facility. TNF knockout mice in the C57BL/6 background (referred herein as TNF KO) were kindly supplied by Professor Rui Appelberg (University of Porto). TNF KO mice21 were maintained at i3S and genotyped by PCR using ATCCGCGACGTGGAACTGGCAGAA (forward) and CTGCCCGGACTCCGCAAAGTCTAA (reverse) primer pair. IP3R2 KO mice23, 24 were held at ICVS animal facility and genotyped PCR using the primer pairs: WT (F, 5’-ACCCTGATGAGGGAAGGTCT-3’; R, 5’-ATCGATTCATAGGGCACACC-3’) and mutant allele (neo-specific primer: F, 5’-AATGGGCTGACCGCTTCCTCGT-3’; R, 5’-TCTGAGAGTGCCTGGCTTTT-3’).

Mice treatment

Mice were treated using a Meth binge protocol25, 26 and randomly assigned to treated group (4×5mg/kg Meth, 2h apart, intraperitoneally) or control (4× isovolumetric saline), and sacrificed 24h after the first administration (Suppl. Fig. 1A). Since Meth causes hyperthermia27, we controlled body temperature through infrared readings every 20min using subcutaneous tags (Biomark, ID, USA). Meth significantly increased body temperature (Suppl. Fig. 1B) but did not exceed critical values. Methamphetamine hydrochloride was imported from Sigma-Aldrich (MO, USA) under special INFARMED license (ref. 290-13).

Supplementary Figure 1.
Supplementary Figure 1.

A: Schematic representation of binge Meth administration. B: WT, IP3R2 KO, and TNF KO mice were administered saline (CT) or Meth. The whisker plots represent the median (line within the box), maximum (top whisker) and minimum (bottom whisker) values of mice’s body temperature during the Meth administration protocol. Temperatures were evaluated at 13 time points, each point represents the mean temperature (n=3 animals per group) for one timepoint. C: Venn’s diagrams representing cluster analysis comparing the 207 Meth-altered genes cluster found in our RNA.-seq analysis, with clusters previously reported for healthy38, 39, aging40, disease-associated (DAM)41, injured40, drug exposed microglia42, 43, or with clusters previously associated to specific microglia functions38. Comparisons were conducted by contingency analysis, using the Fisher’s exact test and the Baptista-Pike method to calculate the odds-ratio. Significance was set at p<0.05. A comprehensive list of the shared genes in each case is available in Suppl. Table 7.

Figure 1.
Figure 1. Meth triggers microglial expansion in the brain.

A: Volcano plot depicting differentially expressed genes of isolated microglia from brains of mice administered with Meth vs Saline (n=3 mice). Non-differentially expressed genes are shown with gray dots, red dots represent significantly upregulated genes and blue dots represent downregulated genes. B: Top 10 enriched pathways revealed by Wikiphatways, KEEG and Reactome databases using Gen Set Enrichment Analysis (GSEA). C: Network analysis of enriched gene sets involved in cell cycle. Network represents the top of 50 upregulated genes related to cell cycle, upon Meth treatment. D: Representative confocal imaging of striatal or hippocampal sections from mice administered with binge Meth or saline (CT) and immunostained for Iba-1. Graphs display the number of Iba1+ cells with mean and SEM (3/4 sections per animal from n=3 mice). *p<0.05 (unpaired t test). Scale bars, 50μm. E: Flow cytometry analyses of microglia cells (CD11b+ CD45Low) isolated from the brains of mice administered with binge Meth or saline (CT) (n=5 animals for each group). The graph displays the percentage of microglia cells with mean and SEM. *p<0.05 (unpaired t test). F: Expression of MHCII by flow cytometry in microglia (CD11b+ CD45Low) isolated from the brains of mice administered with binge Meth or saline (CT) (n=5 animals for each group). The graph displays the frequency of microglial cells expressing the MHCII marker with mean and SEM. *p<0.05 (unpaired t test).

Fluorescence-Activated Cell Sorting (FACS) and RNA extraction

Twenty-four hours after methamphetamine administration, animals were perfused under deep anesthesia with ice-cold PBS. The brains were removed and collected in ice-cold medium A (HBBS 1X (Thermo Scientific MA, USA) supplemented with 15mM HEPES and 0.6% glucose both from Sigma-Aldrich (MO, USA). Microglial cells were isolated from adult mice brain exactly as previously described28. Microglia (Cd11b+, CD45low and CD206-) were sorted on the FACS ARIA (BD Immunocytometry Systems, CA, USA) and the RNA was isolated using a RNeasy Plus Micro Kit (Qiagen, Düsseldorf, DE) according to the manufacturer’s instructions. RNA integrity was analyzed using the Bioanalyzer 2100 RNA Pico chips (Agilent Technologies, CA, USA), according to manufacturer instructions.

Library preparation and Sequencing

Ion Torrent sequencing libraries were prepared according to the AmpliSeq Library prep kit protocol. Briefly, 1ng of highly intact total RNA was reverse transcribed, the resulting cDNA was amplified for 16 cycles by adding PCR Master Mix, and the AmpliSeq mouse transcriptome gene expression primer pool. Amplicons were digested with the proprietary FuPa enzyme, then barcoded adapters were ligated onto the target amplicons. The library amplicons were bound to magnetic beads, and residual reaction components were washed off. Libraries were amplified, re-purified and individually quantified using Agilent TapeStation High Sensitivity tape. Individual libraries were diluted to a 50pM concentration and pooled equally. Emulsion PCR, templating and 550 chip loading was performed with an Ion Chef Instrument (Thermo Scientific MA, USA). Sequencing was performed on an Ion S5XL™ sequencer (Thermo Scientific MA, USA).

Bioinformatics

Data from the S5 XL run processed using the Ion Torrent platform specific pipeline software Torrent Suite v5.12 to generate sequence reads, trim adapter sequences, filter and remove poor signal reads, and split the reads according to the barcode. FASTQ and/or BAM files were generated using the Torrent Suit plugin FileExporter v5.12. Automated data analysis was done with Torrent Suite™ Software using the Ion AmpliSeq™ RNA plug-in v.5.12 and target region AmpliSeq_Mouse_Transcriptome_V1_Designed.

Raw data was loaded into Transcripotme Analysis Console (4.0 Thremo Fisher Scientific, MA, EUA) and first filtered based on ANOVA eBayes using Limma package, applied to fold changes ≤ −1.5 or ≥1.5 between experimental and control conditions. Significant changes had a p value <0.05 and a false discovery rate <0.2. Genes that significantly downregulated and upregulated by Meth in microglia, following the described criteria, are represented in Supp. Table 1.

RNA-seq functional enrichment analysis using Gene Set Enrichment Analysis (GSEA) was performed by WEB-based Gene SeT AnaLysis Toolkit (WebGestalt)29. All detectable genes (Supp. Table 2) with their corresponding fold-change values were submitted to WebGestalt at http:// http://www.webgestalt.org. GSEA was performed using the open-access available platforms, Wikipathways, KEEG and REACTOME with default settings. Enrichment scores for gene sets were calculated using an FDR cutoff of 0.05 and hypergeometric overlap analysis (Supp. Table 3). Genes retrieved from GSEA datasets were used for constructing a protein-protein interaction network. Such network was generated using Omics Visualizer30 and String applications31 in Cytoscape.

Primary cultures

Primary mixed glial cultures were performed as previously described32, 33. Briefly, neonatal Wistar rats or C57BL/6 mice were sacrificed, and their cerebral cortices dissected and digested with 0.07% trypsin-EDTA in the presence of DNAse for 15min. Cells were dissociated and seeded in poly-D-lysine-coated T-flasks at 1.5×106 cells/cm2 in DMEM GlutaMAX™-I. Culture media was changed every three days up to 21 days. All cultures were kept at 37°C with 95% air/ 5%CO2 in a humidified incubator.

To obtained purified microglia cultures, culture flasks were orbitally shaken (200 rpm, 2h) to detach microglia. Then, culture media containing microglia were collected, centrifuged (453g, 5min), resuspended, and plated in glass coverslips at 2.5×105 cells/cm2 in DMEM-F12 GlutaMAXTM-I supplemented with 10% FBS, 0.1% Penicillin-Streptomycin and 1ng/ml GM-CSF. Purified microglia were cultured for 4-7 days. Immunolabeling with CD11b showed a purity of 95-99%.

For purified astrocyte cultures, mixed glial cell cultures were shaken to remove non-astrocytic cells. Astrocytes (adherent cells) were detached and split into non-coated T-flasks in DMEM GlutaMAX™-I. Split cultures were re-split at least four times to obtain purified cultures. After that, astrocytes were plated at 2.5×104 cells/cm2 in non-coated plates and maintained for 3 to 4 days.

Astrocyte-conditioned medium and microglia treatment

Astrocytes were seeded at a density of 2.5×104 cells/cm2. After two days, cells were left untreated (control) or incubated with 100µM Meth for 24h. Untreated astrocyte-conditioned medium (ACM CT) and conditioned medium from Meth-treated astrocytes (ACM Meth) were collected, centrifuged for debris removal, and frozen at −80°C until used. To evaluate astrocytic conditioned media’s effects, purified microglial cell cultures were exposed to ACM CT or ACM Meth for 24h.

Flow cytometry

Microglia and macrophages were analyzed, as we previously described33, 34. Briefly, mice were anesthetized and perfused with ice-cold PBS. For single-cell suspensions, the whole brain was quickly removed and mechanically homogenized. The cell suspension was passed through a 100μm cell strainer and centrifuged over a discontinuous 70%/30% Percoll gradient. Cells on the interface were collected, pelleted, and resuspended in FACS buffer (2% BSA; 0.1% Sodium Azide in PBS). Cells were counted using the Countess TM automated counter (Thermo Scientific, MA, USA). For microglia and macrophages characterization, the following antibodies were used: CD45-PE (103106), CD11b-Alexa647 (101218), Ly6C-PerCP/Cy5.5 (128012), CCR2-PE/Cy7 (150611), and MHCII-BV421 (107631), all obtained from BioLegend (CA, USA). Samples were evaluated on FACS Canto II (BD Immunocytometry Systems, CA, USA).

Immunohistochemistry

Mice were anesthetized and perfused with ice-cold PBS, followed by 4% PFA. Brains were post-fixed overnight, cryoprotected using sucrose gradients (15 and 30%), embedded in OCT, frozen and cryosectioned (coronally at 40μm, between Bregma positions 1.0mm-2.0mm) in the CM3050S cryostat (Leica Biosystems, Nussloch, DE). Brain sections were collected on adherent slides and stored at −20°C.

For immunolabeling, brain slides were defrosted and permeabilized with 0.25% Triton X-100 for 15min. Then, brain slices were blocked with 3% BSA, 0.1% Triton X-100 and 5% FBS for 1h. Primary antibodies were incubated overnight (4°C) under the manufacturer’s recommendations. After washing, slices were incubated with corresponding secondary antibodies conjugated to Alexa Fluor for 2h (RT). After PBS washes, sections were mounted using Fluoroshield from Sigma-Aldrich and visualized under a TCS SP5 II confocal microscope (Leica Biosystems). All used antibodies were described in Suppl. Table 4.

Immunocytochemistry

Immunocytochemistry was performed as we previously described33, 34. Briefly, after fixation with 4% PFA, cultures were permeabilized with 0.1% Triton X-100 or 10 min and blocked with 3% BSA for 1h. Cells were incubated with primary antibody under the manufacture’s recommendations, washed and incubated with secondary antibodies conjugated with Alexa Fluor 488 or 568 for 1h (RT). Finally, cells were incubated with DAPI, mounted, and visualized using a DMI6000B inverted microscope (Leica Microsystems) with an HCX Plan Apo 63x/1.3 NA glycerol immersion objective. Images were acquired with 4×4 binning using a digital CMOS camera (ORCA-Flash4.0 V2, Hamamatsu Photonics). All antibodies are described in Suppl. Table 5.

Phagocytic assay

Fluorescent latex beads (Sigma-Aldrich) were diluted in a culture medium (0,001%) and incubated for 1h. After that, cells were washed and fixed with 4% PFA. Immunocytochemistry for CD11b was performed, and the phagocytic efficiency of microglia was estimated as described elsewhere with minor modifications35.

Reactive oxygen species determination by fluorescence microscopy

Primary microglia cultures were incubated with CellROX® green reagent from Thermo-Fisher Scientific, according to manufacturer’s recommendations, following PBS washing and fixation with 4% PFA.

Fluorescent signals quantification and colocalization analysis

For the intensity quantification, images were exported using the Leica LAS AF program in TIFF format (16-bit). Background subtraction of images, image segmentation, and determination of the intensity of the fluorescence signal was processed in FIJI software as before33. For colocalization analyses, images were acquired using an HCX Plan Apo 63x/1.4-0.6NA oil immersion objective in 16-bit sequential mode using bidirectional TCS mode at 100Hz with the pinhole kept at one airy in the Leica TCS SP5 II confocal microscope. The Coloc2 plug-in in FIJI was used to establish TNF/GFAP channels’ quantitative colocalization as before32.

Total RNA extraction, cDNA synthesis, and qRT-PCR

From brain tissue, RNA was extracted using the TRIzolTM (Ambion by Life Technologies, MA, USA). RNA from cell cultures was isolated using the RNeasy Mini Kit from Qiagen (Düsseldorf, DE). RNAs quality and concentration were determined using a NanoDrop ND-1000 Spectrophotometer. cDNA synthesis was performed using 1µg of total RNA using RT2 Easy First Strand kit from Qiagen. qRT-PCR was performed using iQ™ SYBR®Green Supermix on an iQ™5 multicolor real-time PCR detection system (Bio-Rad, CA, USA). All primers were obtained from Sigma-Aldrich and described in Suppl. Table 6. Raw data were analyzed using the ΔΔCT method with Yhwaz serving as the internal control gene and results expressed in relative gene abundance.

FRET assays

Primary microglia or astrocyte were plated on plastic-bottom culture dishes μ-Dish35mm (iBidi, Martinsried, DE) and transfected with FRET biosensor for glutamate (pDisplay FLIPE-600n, plasmid 13545), ROS (pFRET-HSP33 cys, plasmid 16076) or calcium (pcDNA-D1ER, plasmid 36325), all from Addgene (MA, USA) using jetPRIME® from Polyplus (NY, USA). Imaging was performed using a Leica DMI6000B inverted microscope, and images were processed in FIJI software exactly as before36.

Elevated plus-maze (EPM)

Anxiety-like behavior was assessed using the elevated plus maze (EPM) test precisely as we previously described21, 37. The test was conducted in the dark phase of the light/dark cycle. The mice’s movement and location were analysed by an automated tracking system equipped with an infrared-sensitive camera (Smart Video Tracking Software v 2.5, Panlab, Harvard Apparatus). The maze, made of opaque grey polyvinyl, consisted of four arms arranged in a cross-shape; two closed arms have surrounding walls (18cm high), opposing two open arms (all arms 37×6cm). The apparatus was elevated at the height of 50cm. Each mouse was placed on the central platform facing an open arm and allowed to explore the maze for 5min.

Statistical analysis

A 95% confidence interval was used, and P < 0.05 was considered statistically significant. Results were expressed as mean ± SEM (standard error of the mean). Gene clusters were compared by contingency analysis using the Fisher’s exact test and the Baptista-Pike method to calculate the odds-ratio. Experimental units in individual replicates were evaluated for Gaussian distribution using the D’ & Pearson omnibus normality test. When comparing only two experimental groups, the unpaired Student t test with equal variance assumption was used for data with normal distribution, and the Mann-Whitney test was used otherwise. When comparing three or more groups, a one-way analysis of variance (ANOVA), followed by the Bonferroni or Tukey post hoc test was used for data with normal distribution, and the Kruskal-Wallis test followed by Dunn’s multiple comparisons was used otherwise. We used a two-way ANOVA followed by the Sidak test to compare different groups with two independent variables. All quantifications were performed blinded. Statistical analysis was performed using the GraphPad Prism® software version 8.4.3.

Results

Microglia exposed to Meth display a core cell cycle-related transcriptomic signature

To clarify the action of Meth in microglia, we used a binge pattern of Meth administration to adult mice (Suppl. Fig. 1A) and conducted RNA-Seq analysis in flow cytometry-sorted microglia (CD11b+CD45LowCD206-) from whole brain tissue. Out of 23,930 microglial transcripts identified in the transcriptome dataset, 207 were significantly altered after binge Meth administration (Fig. 1A and Suppl. Tables 1 and 2). To pinpoint the most relevant biological pathways altered in the microglial transcriptome after Meth exposure, we performed gene set enriched analysis (GSEA). GSEA using Wikipathways, KEEG, and REACTOME databases revealed a prominent upregulation of cell cycle-related pathways (including DNA Replication, mRNA processing, Eukaryotic Transcription Initiation, Homologous recombination, RNA polymerase, Mismatch repair, DNA Repair, DNA Double-Strand Break, G2/M DNA damage checkpoint, Mitotic Cell Cycle, Cell Cycle) (Fig. 1B and detailed data in Suppl. Table 3), possibly associated with Meth-induced microglial expansion. Of note, the TNF-alpha NF-kB and the NOD-like receptor signaling pathways, both associated with proinflammatory signaling, were also upregulated (Fig. 1B).

The combined cell cycle-related transcriptomic cluster (the top 50 upregulated transcripts are displayed as network in Fig. 1C) contained as highest altered transcripts the DNA primase small subunit (Prim1), the DNA polymerase epsilon catalytic subunit A (Pole), the DNA polymerase epsilon subunit 3 (Pole3), the translocated promoter region, nuclear basket protein (Tpr), and the DNA helicases MCM5 and MCM6 (Fig. 1C). Thus, initiation of DNA replication, DNA mismatch repair, homologous recombination, and telomere C-strand synthesis (licensed by the epsilon DNA polymerase complex and the MCM complex via 3’-5’ exodeoxyribonuclease and 3’-5’ DNA helicase activities) are plausibly the most strongly microglial pathways affected by Meth exposure.

Next, we compared our cluster of 207 differentially expressed transcripts upon Meth exposure with clusters previously reported for microglial signature program38, 39, aging40, disease-associated (DAM)41, injury-related (IRM)40, drug exposure42, 43, or the microglial engulfment module38 (Suppl. Fig. 1C and Suppl. Table 7). Interestingly, we only found a positive association of our Meth-induced cluster with the aging clusters. These data indicate that Meth exposure does not affect the classical signature programs of healthy or diseased microglia but are in line with reports showing that Meth might foster cellular and tissue ageing44.

Meth activates microglia in vivo

The increase in expression of cell cycle-related transcripts correlated with a significant increase in the number of Iba-1+ cells on tissue sections obtained from the striatum and the hippocampus (Fig. 1D) of mice exposed to Meth when compared to saline-treated (control) animals. This increase in microglia numbers was further confirmed using flow cytometry (Fig. 1E). We found also an increase in MHC-II expression in microglia (Fig. 1F). We also analyzed the brain macrophage population (CD11b+CD45High) and found no differences between Meth-treated and control mice in total, Ly6C+ or Ly6C+/CCR2+ macrophages (Suppl. Fig. 2A). Together, these results indicate that binge Meth administration causes microgliosis.

Supplementary Figure 2.
Supplementary Figure 2.

A: Flow cytometry analyses macrophages (CD11b+ CD45high) isolated from the brains of mice injected with Meth or saline (CT) (n=5 animals for each group). Graphs display with mean and SEM of the percentage of macrophages, the percentage of macrophages expressing activation markers such as Ly6C+ and Ly6C+CCR2+. B: Primary cortical microglia cells incubated with the CellRox green reagent and treated with 1µM LPS (n=3 different cultures). Graph (means and SEM) displays the CellRox intensity normalized to the control values (unpaired t test). Scale bar, 10μm. C: Fluorescence imaging of primary cortical microglia immunolabeled for iNOS treated with 1µM LPS (n=3 independent cultures). Graph (means and SEM) displays iNOS intensity normalized to the Control values (unpaired t test). Scale bar, 10μm. D: Viability of astrocytes were examined by Hoechst staining under 100μM Meth. Graph represent (means and SEM) the percentage of cell viability upon Meth exposure compared to control (CT) condition. E: Viability of microglial cells were examined by Hoechst staining under 100μM Meth. Graph represent (means and SEM) the percentage of cell viability upon Meth exposure compared to control (CT) condition. F: Viability of microglia were examined by Hoechst staining under ACM Meth exposure. Graph represent (means and SEM) the percentage cell viability upon ACM Meth exposure compared to control condition (ACM CT).

Meth activates microglia in an astrocyte dependent-manner

Microglia activation is thought to modify several of their morphological, molecular and functional properties. Therefore, using primary microglia cultures, we investigated whether exposure to Meth altered some of those properties. We found that Meth diminished the microglia capacity to phagocyte inert fluorescent beads (Fig. 2A) and did not increase the formation of ROS (Fig. 2B) or the expression of iNOS (Fig. 2C). We also observed no differences in the mRNA transcript abundance of the proinflammatory cytokines IL-1β, IL-6 and TNF compare to saline-treated microglia (Fig. 2D). To further confirm that our microglia cultures were responsive to a classic proinflammatory stimulus, but not to Meth, we treated them with LPS, which as expected increased ROS formation and iNOS expression (Suppl. Fig. 2B and C). We also analyzed classic microglial anti-inflammatory markers and found no significant alterations in arginase 1 expression (Fig. 2E), nor in the amounts of mRNA transcripts IL-10 and TGFβ (Fig. 2F). We concluded that Meth does not activate microglia in a cell-autonomous manner and that the transcriptomic changes associated with microgliosis observed in vivo might result from crosstalk between microglia and other cell types.

Figure 2.
Figure 2. Microglia activation triggered by Meth requires Astrocytes.

A: Fluorescence imaging of CD11b (red) in primary cortical microglia incubated with microbeads (green) and treated with 100μM Meth for 24h (n=3 independent cultures). Graph (means and SEM) displays phagocytic efficiency. *p<0.05 (unpaired t test). Scale bar, 10μm. B: Fluorescence imaging of primary cortical microglia incubated with the CellRox® green reagent and treated with 100μM Meth for 24h (n=3 independent cultures). Graph (means and SEM) displays the CellRox® intensity normalized to the Control values (unpaired t test). Scale bar, 10μm. C: Fluorescence imaging of primary cortical microglia immunolabeled for iNOS (green) treated with 100μM Meth for 24h (n=3 independent cultures). Graph (means and SEM) displays iNOS intensity normalized to the Control values (unpaired t test). Scale bar, 10μm. D: qRT-PCR for IL-1β, IL-6 or TNF from primary cortical microglia treated with 100μM Meth for 3h or 24h (n=3 independent cultures). Graphs (means and SEM) display the indicated transcripts’ mRNA expression levels (unpaired t test). E: Fluorescence imaging of arginase in primary cortical microglia treated with 100μM Meth for 24h (n=3 independent cultures). Graph (means and SEM) displays arginase intensity normalized to the CT values (unpaired t test). Scale bar, 10μm. F: qRT-PCR for IL-10 or TGFβ from primary cortical microglia treated with 100μM Meth for 3h or 24h (n=3 independent cultures). Graphs (means and SEM) display the indicated transcripts’ mRNA expression levels (unpaired t test). G: Fluorescence imaging of primary cortical microglia (n=3 independent cultures) incubated with the CellRox® green reagent and then exposed to conditioned media from primary cortical astrocytes (ACM) treated with 100μM Meth or not (CT). Graph (means and SEM) displays the CellRox intensity normalized to the ACM CT values. *p<0.05 (unpaired t test). Scale bar, 10μm. H: qRT-PCR for iNOS (C), IL-1β (D), IL-6 (E), or TNF (F) from primary cortical microglia exposed to ACM CT or ACM Meth for 24h (n=3-5 independent cultures). Graphs (means and SEM) display the mRNA fold change for the indicated transcripts.

Because astrocyte-derived signaling is essential in microglia activation45, we tested the hypothesis that astrocytes could mediate Meth-induced microglia activation. To do that, we exposed primary cortical microglia to conditioned media (CM) obtained from primary cortical astrocytes treated with Meth (ACM Meth) or CM from control astrocyte cultures (ACM CT). Neither Meth nor ACM Meth affected astrocytic or microglial viability (Suppl. Fig. 2D-F). Using the CellRox green reagent, we found an increase in ROS production in primary cortical microglia exposed to ACM Meth compared with cultures exposed to ACM CT (Fig. 2G). Using the FRET HSP biosensor46, we observed a consistent and fast increase (within 5 min) of ROS generation in living primary microglia exposed to ACM Meth (Suppl. Fig. 3A). Besides, primary cortical microglia treated with ACM Meth displayed higher mRNA levels of the proinflammatory markers iNOS, IL-1β, and IL-6, but not TNF (Fig. 2H). Primary cortical microglia exposed to ACM Meth also displayed enhanced iNOS expression compared with cultures incubated with ACM CT (Suppl. Fig. 3B). We concluded that upon Meth exposure, astrocytes could induce microglial activation.

Supplementary Figure 3.
Supplementary Figure 3.

A: Primary cortical microglia expressing the ROS FRET biosensor (HSP) were incubated with ACM CT (left panel) and then exposed to ACM Meth (right panel). Time-lapses of CFP/FRET ratio changes for the HSP biosensor (normalized at 0 min) are shown according to the scale (n=4 cells pooled across two independent experiments). Scale bars, 10μm. B: Fluorescence imaging of primary cortical microglia immunolabeled for iNOS (green) and F-actin (grey; labeled with Alexa Fluor 647 Phalloidin obtained from Thermo Scientific (MA, USA)) and treated with ACM CT or ACM Meth for 24h (n=3 independent experiments). Graph (means and SEM) displays iNOS intensity normalized to the ACM CT. *p<0.05 (unpaired t test). Scale bar, 10μm. C: Primary cortical astrocytes expressing the glutamate release FRET biosensor (FLIPE) were exposed to TNF (50nM). Time-lapses of CFP/FRET ratio changes for the FLIPE biosensor (normalized at 0 min) are shown according to the scale (n=6 cells pooled across two independent experiments). Scale bars, 10μm. D: qRT-PCR for TNF, IL-1β and IL-6 from the striatum or hippocampus of mice administered with saline or binge Meth and sacrificed 24h after (n=4-5 mice per group). Graphs (means and SEM) display the fold change of indicated transcripts. *p<0.05 and **p<0.01 (unpaired t test). E: Primary cortical astrocytes expressing the endoplasmic reticulum calcium release FRET biosensor (D1ER) were exposed to Meth (100µM) (upper panels; blue circles) or TNF (50nM) (bottom panels; red circles). Time-lapses of CFP/FRET ratio changes for the D1ER biosensor (normalized at 0 min) are shown according to the scale (n=3-4 cells pooled across 2-3 independent experiments). Scale bars, 10μm. F: Primary cortical astrocytes expressing the glutamate release FRET biosensor (FLIPE) were exposed to TNF (50nM) (upper panels; black circles) or XestosponginC (500nM) + TNF (50nM) (bottom panels; lilac circles). Time-lapses of CFP/FRET ratio changes for the FLIPE biosensor (normalized at 0 min) are shown according to the scale (n=4 cells pooled across two independent experiments). Scale bars, 20μm.

Supplementary Figure 4.
Supplementary Figure 4.

A: WT animals were evaluated in the EPM 24 hours after being administered with saline (CT) or binge Meth (n=11-13 animals per group). CT and Meth-treated mice displayed significant differences in the frequency of stretch-attend postures (SAP). The graph displays the mean and SEM. **p<0.01 (unpaired t test). B: WT animals were evaluated in the EPM 24 hours after being administered with saline (CT) or binge Meth (n=11-13 animals per group). CT and Meth-treated mice displayed significant differences in the frequency of protected head dipping. The graph displays the mean and SEM. *p<0.05 (unpaired t test). C: WT animals were evaluated in the EPM 24 hours after being administered with saline (CT) or binge Meth (n=11-13 animals per group). CT and Meth-treated mice displayed no differences regarding the latency to enter in open arms. The graph displays the mean and SEM.

Meth causes glutamate release via TNF and IP3-dependent Ca2+ mobilization in astrocytes Astrocytes are critical players in regulating neuroinflammation47. Of note, our RNA-Seq data revealed a Meth-induced enrichment of gene transcripts associated with the TNF-alpha NF-kB Signaling Pathway (Fig. 1B). Besides, TNF has emerged as an essential mediator of brain homeostasis48. We observed increased TNF expression in specific brain regions following Meth exposure (Suppl. Fig 3D), which was also previously reported49. The secretion of high amounts of TNF activates TNF receptor 1 and leads to a massive release of glutamate from astrocytes50. Accordingly, we observed by double-labeling immunofluorescence an increase in TNF content in astrocytes (GFAP+ cells) in the hippocampus of mice exposed to Meth (Fig. 3A), and using the glutamate-release FRET biosensor FLIPE600nSURFACE 51, we found that TNF promoted a fast and sustained release of glutamate from living cortical astrocytes (Suppl. Fig. 3C). In addition, Meth also caused robust glutamate release in cortical astrocytes from WT mice (Fig. 3B). However, Meth was inefficient in triggering glutamate release in cortical astrocytes from TNF-deficient mice (Fig. 3B), confirming that autocrine TNF signaling plays a crucial role in Meth-induced glutamate release from astrocytes.

Figure 3.
Figure 3. Meth activates microglia via astrocytic TNF production.

A: Confocal imaging of hippocampal sections from mice treated with Meth or saline (CT) and immunostained for GFAP (green) and TNF (red). Graphs display the GFAP/TNF colocalization puncta (upper graph) or GFAP intensity (bottom graph) normalized to the CT values (3/4 sections per animal from n=3 mice). *p<0.05 (unpaired t test). Scale bars, 50μm B: Primary cortical astrocytes from WT or TNF KO mice expressing the glutamate release FRET biosensor (FLIPE) were exposed to Meth 100µM. Time-lapses of CFP/FRET ratio changes for the FLIPE biosensor (normalized at 0 min) shows the maximum effect of Meth in both genotypes and are coded according to the scale (n=3-8 cells pooled across 2-3 independent experiments). Scale bars, 10μm C: Primary cortical astrocytes expressing the glutamate release FRET biosensor (FLIPE) were exposed to Meth, BAPTA-AM (10µM) + Meth 100µM (upper panels), XestosponginC (XeC; 500nM) + Meth 100µM (middle panels) or Tetanus toxin (Tet; 500nM) + Meth (bottom panels). Time-lapses of CFP/FRET ratio changes for the FLIPE biosensor (normalized at 0 min) show the maximum effect of Meth and are coded according to the scale (n=5-7 cells pooled across 3 independent experiments). *p<0.05 (two-way ANOVA vs CT 0 min); # p<0.05 (two-way ANOVA vs CT Meth). Scale bars, 10μm. D: Fluorescence imaging of primary cortical microglia immunolabeled for iNOS and treated with glutamate 100µM (n=3 independent cultures). Graph (means and SEM) displays iNOS intensity normalized to the CT. *p<0.05 (Mann-Whitney test). Scale bar, 10μm. E: Primary cortical microglia expressing the ROS FRET biosensor (HSP) were exposed to glutamate 100µM. Time-lapses of CFP/FRET ratio changes for the HSP biosensor (normalized at 0 min) shows the maximum effect of Meth and are coded according to the scale (n=5 cells pooled across two independent experiments). *p<0.05. Scale bars, 10μm. F: Primary cortical microglia from WT or TNF KO mice expressing the ROS FRET biosensor HSP were incubated with ACM CT and then exposed to ACM Meth 100µM. Time-lapses of CFP/FRET ratio changes for the HSP biosensor (normalized at 0 min) show the maximum effect of Meth and are coded according to the scale (n=4 cells pooled across two independent experiments). *p<0.05, §non-significant. Scale bars, 10μm.

Astrocytes can release glutamate from intracellular pools through various mechanisms, including Ca2+-dependent and -independent pathways52. To test whether glutamate release from astrocytes under Meth exposure is Ca2+-dependent, we chelated cytosolic Ca2+ with BAPTA-AM and observed an inhibition of Meth-induced glutamate release (Fig. 3C), suggesting that elevation of cytosolic Ca2+ is necessary for Meth-triggered astrocytic glutamate release.

The rise in cytosolic Ca2+ required for glutamate release from astrocytes may originate from the endoplasmic reticulum (ER) through the Ca2+-release channel inositol triphosphate receptor (IP3R)53. Using the D1ER FRET biosensor54, which detects the efflux of Ca2+ from the ER into the cytosol, we monitored the mobilization of Ca2+ in living astrocytes exposed to Meth or TNF (Suppl. Fig. 3E). Treatment of primary cortical astrocytes with Meth (Suppl. Fig. 3E, blue circles) or TNF (Suppl. Fig. 3E, red circles) triggered a fast and sustained decrease in the FRET/CFP ratio of the D1ER biosensor, indicating that both Meth and TNF promoted the mobilization of Ca2+ from the ER to the cytosol. To investigate the role of IP3R in Meth-induced Ca2+-mobilization, we used Xestospongin C (XeC)55, an IP3R antagonist. We observed that XeC abolished glutamate release in living primary astrocyte cultures exposed to Meth (Fig. 3C) or TNF (Suppl. Fig. 3F), and concluded that IP3R-dependent Ca2+ mobilization is involved in Meth-induced glutamate release.

To test whether in Meth-treated astrocytes, glutamate was released through an exocytic mechanism56, we used the tetanus toxin to prevent Ca2+-dependent assembling of the dnSNARE complex and the fusion of exocytic vesicles with the membrane57. In these conditions, we observed a large attenuation in the Meth-induced CFP/FRET ratio change of the FLIPE biosensor (Fig. 3C), indicating that, in astrocytes, Meth stimulates the exocytosis of glutamate-containing vesicles in a Ca2+-dependent manner.

Because TNF controls astrocytic glutamate release, we hypothesized that TNF/glutamate signaling might be directly involved in microglia activation by astrocytes that were exposed to Meth. Accordingly, we found that treating primary microglia with glutamate increased iNOS expression (Fig. 3D). Glutamate treatment also promoted fast and sustained ROS generation in living primary cortical microglia as revealed by using the FRET HSP ROS biosensor (Fig. 3E). While the CM obtained from WT astrocytes exposed to Meth promoted ROS generation in primary microglia (Fig. 3F), the CM obtained from TNF-deficient astrocytes exposed to Meth failed to increase microglial ROS production (Fig. 3F), confirming that TNF/glutamate signaling is necessary to induce microglial activation by astrocytes.

TNF and IP3R2-dependent Ca2+ mobilization are required for microglia activation in vivo Because Meth activates microglia via TNF-to-IP3R signaling in astrocytes, we evaluated whether Meth-induced microgliosis required this signaling in vivo. Knowing that the IP3R isoform 2 is the primary IP3 receptor in astrocytes and the major source of Ca2+-translocation from the ER into the cytosol in these cells58, we challenged IP3R2 KO, and TNF KO mice with binge Meth administration (as described in Suppl. Fig. 1A). We observed that the Meth-induced microgliosis in the striatum and in the hippocampus was prevented in both KO mice compared to WT (Fig. 4A). Consistently with these findings, flow cytometry showed that the Meth-induced increase in the microglia population was also prevented in TNF KO and IP3R2 KO mice (Fig. 4B).

Figure 4.
Figure 4. TNF or IP3R2 deficiency prevents Meth-induced microgliosis and behavioral changes

A: Confocal imaging of striatal or hippocampal sections from WT, IP3R2 KO, or TNF KO mice administered with binge Meth (3/4 sections per animal from n=3 mice) or saline (CT; n=3) and immunostained for Iba-1. Graphs (means and SEM) display the number of Iba-1+ cells *p<0.001 WT-CT vs. WT-Meth; §non-significant (IP3R2 KO-CT vs. IP3R2 KO-Meth and #non-significant TNF KO-CT vs. TNF KO-Meth). Two-way ANOVA with the Sidak post hoc analysis. Scale bars, 50μm. B: Flow cytometry analysis of microglia cells (CD11b+ CD45Low) isolated from WT, IP3R2 KO, or TNF KO mice injected with Meth or saline (CT) (n=5-9 animals per group). The graph displays the percentage of microglia cells with mean and SEM. *p<0.05 WT-CT vs. WT-Meth; §non-significant IP3R2 KO-CT vs. IP3R2 KO-Meth and #non-significant TNF KO-CT vs. TNF KO-Meth. Two-way ANOVA with Fisher’s LSD post hoc analysis. C: WT, IP3R2 KO, and TNF KO animals were evaluated in the EPM 24 hours after being a binge pattern of Meth or saline (CT) administration (n=6-13 animals). CT and Meth-treated mice displayed significant differences in the time spent in the open arms (OA) in the distance traveled in the OA, and in total distance traveled. Graphs display means and SEM. *p<0.05, WT-CT vs. WT-Meth; §non-significant IP3R2 KO-CT vs. IP3R2 KO-Meth and #non-significant TNF KO-CT vs. TNF KO-Meth. Two-way ANOVA with the Sidak post hoc analysis.

Excessive glutamate and microglia overactivation can negatively affect behavior59. Because Meth-induced TNF production led to glutamate release from astrocytes in an IP3R-dependent manner and activated microglia, we hypothesized that blocking TNF or IP3R signaling could prevent the behavioral alteration elicited by Meth. When tested in EPM, WT mice exposed to Meth displayed increased time and distance traveled in the open arms (Fig. 4C) and decreased frequency of stretch-attended postures (Suppl. Fig. 4), while the total traveled distance was lower than for the saline group (Fig. 4C). This behavioral pattern, which is consistent with decreased risk assessment and typical of psychostimulant intake, and was significantly attenuated in TNF or IP3R2 KO mice (Fig. 4C). These in vivo data confirm the relevance of the the TNF/Ca2+ mobilization-signaling for Meth-induced microgliosis and behavioral effects.

Discussion

Although it was previously observed that Meth induces a microglia proinflammatory response in vivo25, 60, the mechanisms involved in this process are still poorly understood. We found that Meth-induced microglia reactivity requires a crosstalk with astrocytes, mediated by glutamate release in a TNF- and IP3R/Ca2+-dependent manner and that blocking TNF-signaling prevented both microgliosis and the loss of risk assessment behavior elicited by Meth.

Consistently with previous findings61, 62, our study shows that binge Meth caused microglial expansion and increased the expression of proinflammatory markers that are hallmarks of many neurodegenerative diseases63. The range of enriched pathways related to cell cycle modulation that associate with microglial expansion, confirms the relevance of this Meth-induced effect. To characterize the molecular mechanisms involved in Meth-induced microglia activation, we analysed Meth effects directly on purified microglia cultures. In contrast with a previous work reporting that Meth induces a proinflammatory response in an immortalized microglial cell line64, our results demonstrated that Meth does not directly induce a proinflammatory phenotype in primary microglia. Nonetheless, and corroborating our findings, Frank and colleagues observed that Meth fails to induce the expression of proinflammatory cytokines in microglial cultures despite up-regulating IL-1, IL-6, and TNF in vivo65. Likewise, our primary microglia cultures were highly responsive to LPS, excluding the possibility that the lack of a direct Meth effect could be due to microglia anergy65. Similarly, cocaine was reported to be ineffective in directly inducing the expression of microglial TNF mRNA levels66 in vitro.

Because Meth activated microglia in vivo, we tested the hypothesis that this activation could result from an interplay with other cell types. Reactive astrocytes67 are observed in several models of Meth exposure68–70, including human cerebral organoids71, and persistently associated with increased neurotoxicity and neuroinflammation, strengthening the likelihood of an astrocyte-mediated microglial response. Astrocytes seem to control immune activation via secretion of multiple molecular factors72, 73. Among them, TNF emerged as an essential mediator of brain homeostasis48. Increased. We demonstrated that Meth increased TNF content in hippocampal astrocytes in vivo and in vitro, suggesting that TNF may play an important role in microglia activation by Meth-sensitized astrocytes. Indeed, it has been reported that an autocrine/paracrine TNF-dependent TNF receptor 1 activation promotes glutamate release from astrocytes50, while TNF inhibitors strongly reduce glutamate release in cultured astrocytes74. In line with this, we also observed that while Meth triggered rapid and sustained glutamate release from astrocytes obtained from wild-type mice, it failed to do so in astrocytes obtained from TNF-deficient mice. In addition, TNF downregulates the glutamate transporter EAAT-2 on astrocytes, compromising glutamate clearance from the extracellular space, which contributes to an hyperglutamate state and promotes excitotoxic glutamate signaling75, 76. Excitotoxicity associates positively with the progression of several neurodegenerative diseases77. Meth, by acting on the trace amine-associated receptor 1 (TAAR1), induces excitotoxicity through downregulation of EAAT-2 transcription and activity in astrocytes78. In this context, our results strongly suggest that glutamate is a critical modulator in Meth-induced microglial activation. Corroborating this hypothesis, we observed that Meth failed to induce microgliosis and loss of risk-assessment behavior in TNF-deficient mice. Interestingly, TNF-deficient mice were previously reported to self-administer more Meth79, which according to our data, may also result from reduced astrocyte-microglia reactivity, and not only from increased dopamine availability, as previously suggested26.

Astrocytes release glutamate through different pathways, including Ca2+-dependent and -independent mechanisms52. The ER serves as a major source for astrocytic mobilization of intracellular Ca2+ via IP3R12, 80. We evaluated the involvement of IP3 in Meth-induced glutamate release from astrocytes and confirmed that it occurs in an IP3-dependent way. Accordingly, when we administered Meth to IP3R2-deficient mice, microgliosis and behavioral changes were prevented, suggesting that astrocytic IP3R/Ca2+ signaling is required for microglia activation triggered by Meth.

Astrocytes were also recently demonstrated as critical modulators of the reward system, responding to amphetamine-elicited dopaminergic signaling and regulating excitatory neurotransmission through ATP/adenosine activation of neuronal A1 adenosine receptors81. Our results provide further mechanistic insight reinforcing the astrocytes’ role in reward and addiction by regulating microglial reactivity.

Collectively, our findings show that astrocytes cause the activation of microglia in acute Meth-exposure via glutamate release in a TNF/IP3R2-Ca2+-dependent manner (Fig. 5), leading to behavioural alterations. Comprehending how microglial reactivity and neuroinflammation will adapt throughout prolonged exposure to Meth, particularly during withdrawal, will further increase the translational significance of our findings and contribute to identifying novel molecular targets with therapeutic value in psychostimulant abuse.

Figure 5.
Figure 5. Meth-induced microglia activation occurs via astrocytes.

A: Exposure to Meth induces astrocytic sensitization (1). Meth-sensitized astrocytes secrete soluble factors (2) that will act on microglia cells, inducing their activation. B: In astrocytes, Meth triggers the production (1) and secretion (2) of TNF. TNF acts on astrocytic TNF receptors in an autocrine/paracrine manner, leading to the activation of PLC (3). TNF-induced PLC activation produces the second messenger IP3(4) that interacts with IP3 receptors on the ER (5). Activation of IP3R2 promotes Ca2+-mobilization from the ER into the cytosol (6), consequently increasing glutamate release (7). Increased glutamate and TNF content in the extracellular milieu promotes the activation of microglia (8). TNF: Tumor necrosis factor; PLC: Phospholipase C; IP3: Inositol (1,3,4) phosphate; ER: Endoplasmic reticulum; Ca2+: Calcium ions.

Funding and Disclosure

This work was financed by FEDER - Fundo Europeu de Desenvolvimento Regional funds through the COMPETE 2020 - Operational Programme for Competitiveness and Internationalisation (POCI), Portugal 2020, and by Portuguese funds through FCT - Fundação para a Ciência e a Tecnologia/Ministério da Ciência (FCT), Tecnologia e Ensino Superior in the framework of the project POCI-01-0145-FEDER-030647 (PTDC/SAU-TOX/30647/2017) in TS lab. FEDER Portugal (Norte-01-0145-FEDER-000008000008—Porto Neurosciences and Neurologic Disease Research Initiative at I3S, supported by Norte Portugal Regional Operational Programme (NORTE 2020), under the PORTUGAL 2020 Partnership Agreement, through the European Regional Development Fund (ERDF); FCOMP-01-0124-FEDER-021333). CCP and RS hold employment contracts financed by national funds through FCT – in the context of the program-contract described in paragraphs 4, 5, and 6 of art. 23 of Law no. 57/2016, of August 29, as amended by Law no. 57/2017 of July 2019. TC and AM were supported by FCT (SFRH/BD/117148/2016 and IF/00753/2014). Work in JBR lab was supported by the FCT project PTDC/ MED-NEU/31318/2017. JFO was also supported by FCT projects PTDC/MED-NEU/31417/2017 and POCI-01-0145-FEDER-016818; Bial Foundation Grants 207/14 and 037/18, by National funds, through FCT - project UIDB/50026/2020 and UIDP/50026/2020; and by the projects NORTE-01-0145-FEDER-000013 and NORTE-01-0145-FEDER-000023, supported by Norte Portugal Regional Operational Programme (NORTE 2020), under the PORTUGAL 2020 Partnership Agreement, through the European Regional Development Fund (ERDF).

We acknowledge the support of the following i3S Scientific Platforms: Animal Facility, Cell Culture and Genotyping (CCGen), Translational Cytometry Unit (TraCy), and Advanced Light Microscopy (ALM), a member of the national infrastructure PPBI-Portuguese Platform of BioImaging (POCI-01–0145-FEDER-022122). The RNAseq technique was performed at the Genomics i3S Scientific Platform with the assistance of Mafalda Rocha as a result of the GenomePT project (POCI-01-0145-FEDER-022184), supported by COMPETE 2020 - Operational Programme for Competitiveness and Internationalization (POCI), Lisboa Portugal Regional Operational Programme (Lisboa2020), Algarve Portugal Regional Operational Programme (CRESC Algarve2020), under the PORTUGAL 2020 Partnership Agreement, through the European Regional Development Fund (ERDF), and by FCT. We also acknowledge Rui Applelberg for generously supplying TNF KO mice, and Maria Summavielle for her contribution in assembling the figures illustrating this publication.

Conflict of interest

The authors declare no conflict of interest.

View this table:
Supplementary Table 4.

Antibodies used for immunohistochemistry

View this table:
Supplementary Table 5.

Antibodies used for immunocytochemistry

View this table:
Supplementary Table 6.

Primer sequences used in qRT-PCR

Footnotes

References

  1. 1.↵
    Thanos PK, Kim R, Delis F, Ananth M, Chachati G, Rocco MJ et al. Chronic Methamphetamine Effects on Brain Structure and Function in Rats. PLoS One 2016; 11(6): e0155457.
    OpenUrl
  2. 2.↵
    Chang X, Sun Y, Zhang Y, Muhai J, Lu L, Shi J. A Review of Risk Factors for Methamphetamine-Related Psychiatric Symptoms. Front Psychiatry 2018; 9: 603.
  3. 3.↵
    Moszczynska A, Callan SP. Molecular, Behavioral, and Physiological Consequences of Methamphetamine Neurotoxicity: Implications for Treatment. J Pharmacol Exp Ther 2017; 362(3): 474–488.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    Northrop NA, Halpin LE, Yamamoto BK. Peripheral ammonia and blood brain barrier structure and function after methamphetamine. Neuropharmacology 2016; 107: 18–26.
    OpenUrl
  5. 5.↵
    Shaerzadeh F, Streit WJ, Heysieattalab S, Khoshbouei H. Methamphetamine neurotoxicity, microglia, and neuroinflammation. J Neuroinflammation 2018; 15(1): 341.
    OpenUrl
  6. 6.↵
    Yamamoto BK, Raudensky J. The role of oxidative stress, metabolic compromise, and inflammation in neuronal injury produced by amphetamine-related drugs of abuse. J Neuroimmune Pharmacol 2008; 3(4): 203–217.
    OpenUrlCrossRefPubMed
  7. 7.↵
    Cadet JL, Bisagno V. Glial-neuronal ensembles: partners in drug addiction-associated synaptic plasticity. Front Pharmacol 2014; 5: 204.
  8. 8.
    Miguel-Hidalgo JJ. The role of glial cells in drug abuse. Curr Drug Abuse Rev 2009; 2(1): 72–82.
    OpenUrlPubMed
  9. 9.↵
    Beardsley PM, Hauser KF. Glial modulators as potential treatments of psychostimulant abuse. Adv Pharmacol 2014; 69: 1–69.
    OpenUrlCrossRefPubMed
  10. 10.↵
    Araque A, Carmignoto G, Haydon PG, Oliet SH, Robitaille R, Volterra A. Gliotransmitters travel in time and space. Neuron 2014; 81(4): 728–739.
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    Tzschentke TM, Schmidt WJ. Glutamatergic mechanisms in addiction. Mol Psychiatry 2003; 8(4): 373–382.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    Bazargani N, Attwell D. Astrocyte calcium signaling: the third wave. Nat Neurosci 2016; 19(2): 182–189.
    OpenUrlCrossRefPubMed
  13. 13.↵
    Clark KH, Wiley CA, Bradberry CW. Psychostimulant abuse and neuroinflammation: emerging evidence of their interconnection. Neurotox Res 2013; 23(2): 174–188.
    OpenUrlCrossRefPubMed
  14. 14.↵
    Krasnova IN, Justinova Z, Cadet JL. Methamphetamine addiction: involvement of CREB and neuroinflammatory signaling pathways. Psychopharmacology (Berl) 2016; 233(10): 1945–1962.
    OpenUrlCrossRef
  15. 15.↵
    Salter MW, Beggs S. Sublime microglia: expanding roles for the guardians of the CNS. Cell 2014; 158(1): 15–24.
    OpenUrlCrossRefPubMed
  16. 16.↵
    Harms AS, Lee JK, Nguyen TA, Chang J, Ruhn KM, Trevino I et al. Regulation of microglia effector functions by tumor necrosis factor signaling. Glia 2012; 60(2): 189–202.
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    Prinz M, Priller J. Microglia and brain macrophages in the molecular age: from origin to neuropsychiatric disease. Nat Rev Neurosci 2014; 15(5): 300–312.
    OpenUrlCrossRefPubMed
  18. 18.↵
    Biber K, Moller T, Boddeke E, Prinz M. Central nervous system myeloid cells as drug targets: current status and translational challenges. Nat Rev Drug Discov 2016; 15(2): 110–124.
    OpenUrlCrossRefPubMed
  19. 19.↵
    Stephenson J, Nutma E, van der Valk P, Amor S. Inflammation in CNS neurodegenerative diseases. Immunology 2018; 154(2): 204–219.
    OpenUrl
  20. 20.↵
    Subhramanyam CS, Wang C, Hu Q, Dheen ST. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin Cell Dev Biol 2019; 94: 112–120.
    OpenUrl
  21. 21.↵
    Socodato R, Henriques JF, Portugal CC, Almeida TO, Tedim-Moreira J, Alves RL et al. Daily alcohol intake triggers aberrant synaptic pruning leading to synapse loss and anxiety-like behavior. Sci Signal 2020; 13(650): eaba5754.
  22. 22.↵
    ter Horst JP, de Kloet ER, Schachinger H, Oitzl MS. Relevance of stress and female sex hormones for emotion and cognition. Cell Mol Neurobiol 2012; 32(5): 725–735.
    OpenUrlCrossRefPubMed
  23. 23.↵
    Li X, Zima AV, Sheikh F, Blatter LA, Chen J. Endothelin-1-induced arrhythmogenic Ca2+ signaling is abolished in atrial myocytes of inositol-1,4,5-trisphosphate(IP3)-receptor type 2-deficient mice. Circ Res 2005; 96(12): 1274-1281.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    Guerra-Gomes S, Sousa N, Pinto L, Oliveira JF. Functional Roles of Astrocyte Calcium Elevations: From Synapses to Behavior. Frontiers in Cellular Neuroscience 2018; 11(427).
  25. 25.↵
    Thomas DM, Walker PD, Benjamins JA, Geddes TJ, Kuhn DM. Methamphetamine neurotoxicity in dopamine nerve endings of the striatum is associated with microglial activation. J Pharmacol Exp Ther 2004; 311(1): 1–7.
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    Nakajima A, Yamada K, Nagai T, Uchiyama T, Miyamoto Y, Mamiya T et al. Role of tumor necrosis factor-alpha in methamphetamine-induced drug dependence and neurotoxicity. J Neurosci 2004; 24(9): 2212–2225.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    Krasnova IN, Cadet JL. Methamphetamine toxicity and messengers of death. Brain Res Rev 2009; 60(2): 379–407.
    OpenUrlCrossRefPubMedWeb of Science
  28. 28.↵
    Galatro TF, Vainchtein ID, Brouwer N, Boddeke E, Eggen BJL. Isolation of Microglia and Immune Infiltrates from Mouse and Primate Central Nervous System. Methods Mol Biol 2017; 1559: 333–342.
    OpenUrlCrossRefPubMed
  29. 29.↵
    Liao Y, Wang J, Jaehnig EJ, Shi Z, Zhang B. WebGestalt 2019: gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Research 2019; 47(W1): W199-W205.
    OpenUrlCrossRefPubMed
  30. 30.↵
    Legeay M, Doncheva NT, Morris JH, Jensen LJ. Visualize omics data on networks with Omics Visualizer, a Cytoscape App. F1000Res 2020; 9: 157.
  31. 31.↵
    Doncheva NT, Morris JH, Gorodkin J, Jensen LJ. Cytoscape StringApp: Network Analysis and Visualization of Proteomics Data. J Proteome Res 2019; 18(2): 623–632.
    OpenUrlCrossRef
  32. 32.↵
    Portugal CC, Socodato R, Canedo T, Silva CM, Martins T, Coreixas VS et al. Caveolin-1-mediated internalization of the vitamin C transporter SVCT2 in microglia triggers an inflammatory phenotype. Sci Signal 2017; 10(472).
  33. 33.↵
    Socodato R, Portugal CC, Canedo T, Rodrigues A, Almeida TO, Henriques JF et al. Microglia Dysfunction Caused by the Loss of Rhoa Disrupts Neuronal Physiology and Leads to Neurodegeneration. Cell Rep 2020; 31(12): 107796.
    OpenUrlCrossRef
  34. 34.↵
    Andrade EB, Magalhaes A, Puga A, Costa M, Bravo J, Portugal CC et al. A mouse model reproducing the pathophysiology of neonatal group B streptococcal infection. Nat Commun 2018; 9(1): 3138.
    OpenUrlCrossRef
  35. 35.↵
    Koenigsknecht J, Landreth G. Microglial phagocytosis of fibrillar beta-amyloid through a beta1 integrin-dependent mechanism. J Neurosci 2004; 24(44): 9838–9846.
    OpenUrlAbstract/FREE Full Text
  36. 36.↵
    Socodato R, Melo P, Ferraz-Nogueira JP, Portugal CC, Relvas JB. A Protocol for FRET-Based Live-Cell Imaging in Microglia. STAR Protocols 2020: 100147.
  37. 37.↵
    Mateus-Pinheiro A, Alves ND, Patrício P, Machado-Santos AR, Loureiro-Campos E, Silva JM et al. AP2γ controls adult hippocampal neurogenesis and modulates cognitive, but not anxiety or depressive-like behavior. Molecular Psychiatry 2017; 22(12): 1725–1734.
    OpenUrl
  38. 38.↵
    Ayata P, Badimon A, Strasburger HJ, Duff MK, Montgomery SE, Loh Y-HE et al. Epigenetic regulation of brain region-specific microglia clearance activity. Nature Neuroscience 2018; 21(8): 1049–1060.
    OpenUrlCrossRefPubMed
  39. 39.↵
    Butovsky O, Jedrychowski MP, Moore CS, Cialic R, Lanser AJ, Gabriely G et al. Identification of a unique TGF-β–dependent molecular and functional signature in microglia. Nature Neuroscience 2014; 17(1): 131–143.
    OpenUrlCrossRefPubMed
  40. 40.↵
    Hammond TR, Dufort C, Dissing-Olesen L, Giera S, Young A, Wysoker A et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity 2019; 50(1): 253–271.e256.
    OpenUrlCrossRefPubMed
  41. 41.↵
    Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer’s Disease. Cell 2017; 169(7): 1276–1290.e1217.
    OpenUrlCrossRefPubMed
  42. 42.↵
    Najera JA, Bustamante EA, Bortell N, Morsey B, Fox HS, Ravasi T et al. Methamphetamine abuse affects gene expression in brain-derived microglia of SIV-infected macaques to enhance inflammation and promote virus targets. BMC immunology 2016; 17(1): 7–7.
    OpenUrl
  43. 43.↵
    Savell KE, Tuscher JJ, Zipperly ME, Duke CG, Phillips RA, Bauman AJ et al. A dopamine-induced gene expression signature regulates neuronal function and cocaine response. Science Advances 2020; 6(26): eaba4221.
  44. 44.↵
    Astarita G, Avanesian A, Grimaldi B, Realini N, Justinova Z, Panlilio LV et al. Methamphetamine Accelerates Cellular Senescence through Stimulation of De Novo Ceramide Biosynthesis. PLOS ONE 2015; 10(2): e0116961.
    OpenUrlCrossRefPubMed
  45. 45.↵
    Liddelow SA, Marsh SE, Stevens B. Microglia and Astrocytes in Disease: Dynamic Duo or Partners in Crime? Trends Immunol 2020; 41(9): 820–835.
    OpenUrlCrossRefPubMed
  46. 46.↵
    Socodato R, Portugal CC, Canedo T, Domith I, Oliveira NA, Paes-de-Carvalho R et al. c-Src deactivation by the polyphenol 3-O-caffeoylquinic acid abrogates reactive oxygen species-mediated glutamate release from microglia and neuronal excitotoxicity. Free Radic Biol Med 2015; 79: 45–55.
    OpenUrl
  47. 47.↵
    Ransohoff RM, Brown MA. Innate immunity in the central nervous system. J Clin Invest 2012; 122(4): 1164–1171.
    OpenUrlCrossRefPubMedWeb of Science
  48. 48.↵
    Rossi D. Astrocyte physiopathology: At the crossroads of intercellular networking, inflammation and cell death. Prog Neurobiol 2015; 130: 86–120.
    OpenUrlCrossRefPubMed
  49. 49.↵
    Goncalves J, Martins T, Ferreira R, Milhazes N, Borges F, Ribeiro CF et al. Methamphetamine-induced early increase of IL-6 and TNF-alpha mRNA expression in the mouse brain. Ann N Y Acad Sci 2008; 1139: 103–111.
    OpenUrlPubMed
  50. 50.↵
    Bezzi P, Domercq M, Brambilla L, Galli R, Schols D, De Clercq E et al. CXCR4-activated astrocyte glutamate release via TNFalpha: amplification by microglia triggers neurotoxicity. Nat Neurosci 2001; 4(7): 702–710.
    OpenUrlCrossRefPubMedWeb of Science
  51. 51.↵
    Okumoto S, Looger LL, Micheva KD, Reimer RJ, Smith SJ, Frommer WB. Detection of glutamate release from neurons by genetically encoded surface-displayed FRET nanosensors. Proc Natl Acad Sci U S A 2005; 102(24): 8740–8745.
    OpenUrlAbstract/FREE Full Text
  52. 52.↵
    Harada K, Kamiya T, Tsuboi T. Gliotransmitter Release from Astrocytes: Functional, Developmental, and Pathological Implications in the Brain. Front Neurosci 2015; 9: 499.
  53. 53.↵
    Parpura V, Grubisic V, Verkhratsky A. Ca(2+) sources for the exocytotic release of glutamate from astrocytes. Biochim Biophys Acta 2011; 1813(5): 984–991.
    OpenUrlCrossRefPubMedWeb of Science
  54. 54.↵
    Palmer AE, Jin C, Reed JC, Tsien RY. Bcl-2-mediated alterations in endoplasmic reticulum Ca2+ analyzed with an improved genetically encoded fluorescent sensor. Proc Natl Acad Sci U S A 2004; 101(50): 17404–17409.
    OpenUrlAbstract/FREE Full Text
  55. 55.↵
    Gafni J, Munsch JA, Lam TH, Catlin MC, Costa LG, Molinski TF et al. Xestospongins: potent membrane permeable blockers of the inositol 1,4,5-trisphosphate receptor. Neuron 1997; 19(3): 723-733.
    OpenUrlCrossRefPubMedWeb of Science
  56. 56.↵
    Verkhratsky A, Matteoli M, Parpura V, Mothet JP, Zorec R. Astrocytes as secretory cells of the central nervous system: idiosyncrasies of vesicular secretion. EMBO J 2016; 35(3): 239–257.
    OpenUrlAbstract/FREE Full Text
  57. 57.↵
    Schiavo G, Matteoli M, Montecucco C. Neurotoxins affecting neuroexocytosis. Physiol Rev 2000; 80(2): 717–766.
    OpenUrlCrossRefPubMedWeb of Science
  58. 58.↵
    Petravicz J, Fiacco TA, McCarthy KD. Loss of IP3 receptor-dependent Ca2+ increases in hippocampal astrocytes does not affect baseline CA1 pyramidal neuron synaptic activity. J Neurosci 2008; 28(19): 4967–4973.
    OpenUrlAbstract/FREE Full Text
  59. 59.↵
    Blank T, Prinz M. Microglia as modulators of cognition and neuropsychiatric disorders. Glia 2013; 61(1): 62–70.
    OpenUrlCrossRefPubMedWeb of Science
  60. 60.↵
    Sekine Y, Ouchi Y, Sugihara G, Takei N, Yoshikawa E, Nakamura K et al. Methamphetamine causes microglial activation in the brains of human abusers. J Neurosci 2008; 28(22): 5756–5761.
    OpenUrlAbstract/FREE Full Text
  61. 61.↵
    Buchanan JB, Sparkman NL, Johnson RW. A neurotoxic regimen of methamphetamine exacerbates the febrile and neuroinflammatory response to a subsequent peripheral immune stimulus. J Neuroinflammation 2010; 7: 82.
  62. 62.↵
    Loftis JM, Choi D, Hoffman W, Huckans MS. Methamphetamine causes persistent immune dysregulation: a cross-species, translational report. Neurotox Res 2011; 20(1): 59–68.
    OpenUrlPubMed
  63. 63.↵
    Block ML, Zecca L, Hong JS. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 2007; 8(1): 57–69.
    OpenUrlCrossRefPubMedWeb of Science
  64. 64.↵
    Coelho-Santos V, Goncalves J, Fontes-Ribeiro C, Silva AP. Prevention of methamphetamine-induced microglial cell death by TNF-alpha and IL-6 through activation of the JAK-STAT pathway. J Neuroinflammation 2012; 9: 103.
  65. 65.↵
    Frank MG, Adhikary S, Sobesky JL, Weber MD, Watkins LR, Maier SF. The danger-associated molecular pattern HMGB1 mediates the neuroinflammatory effects of methamphetamine. Brain Behav Immun 2016; 51: 99–108.
    OpenUrl
  66. 66.↵
    Lewitus GM, Konefal SC, Greenhalgh AD, Pribiag H, Augereau K, Stellwagen D. Microglial TNF-alpha Suppresses Cocaine-Induced Plasticity and Behavioral Sensitization. Neuron 2016; 90(3): 483–491.
    OpenUrl
  67. 67.↵
    Escartin C, Galea E, Lakatos A, O’Callaghan JP, Petzold GC, Serrano-Pozo A et al. Reactive astrocyte nomenclature, definitions, and future directions. Nature Neuroscience 2021.
  68. 68.↵
    Narita M, Miyatake M, Narita M, Shibasaki M, Shindo K, Nakamura A et al. Direct evidence of astrocytic modulation in the development of rewarding effects induced by drugs of abuse. Neuropsychopharmacology 2006; 31(11): 2476–2488.
    OpenUrlCrossRefPubMedWeb of Science
  69. 69.
    Bortell N, Basova L, Semenova S, Fox HS, Ravasi T, Marcondes MC. Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro. J Neuroinflammation 2017; 14(1): 49.
    OpenUrl
  70. 70.↵
    Du SH, Qiao DF, Chen CX, Chen S, Liu C, Lin Z et al. Toll-Like Receptor 4 Mediates Methamphetamine-Induced Neuroinflammation through Caspase-11 Signaling Pathway in Astrocytes. Front Mol Neurosci 2017; 10: 409.
  71. 71.↵
    Dang J, Tiwari SK, Agrawal K, Hui H, Qin Y, Rana TM. Glial cell diversity and methamphetamine-induced neuroinflammation in human cerebral organoids. Mol Psychiatry 2020.
  72. 72.↵
    Dong Y, Benveniste EN. Immune function of astrocytes. Glia 2001; 36(2): 180–190.
    OpenUrlCrossRefPubMedWeb of Science
  73. 73.↵
    Farina C, Aloisi F, Meinl E. Astrocytes are active players in cerebral innate immunity. Trends Immunol 2007; 28(3): 138–145.
    OpenUrlCrossRefPubMedWeb of Science
  74. 74.↵
    Domercq M, Brambilla L, Pilati E, Marchaland J, Volterra A, Bezzi P. P2Y1 receptor-evoked glutamate exocytosis from astrocytes: control by tumor necrosis factor-alpha and prostaglandins. J Biol Chem 2006; 281(41): 30684–30696.
    OpenUrlAbstract/FREE Full Text
  75. 75.↵
    Sitcheran R, Gupta P, Fisher PB, Baldwin AS. Positive and negative regulation of EAAT2 by NF-kappaB: a role for N-myc in TNFalpha-controlled repression. EMBO J 2005; 24(3): 510–520.
    OpenUrlAbstract/FREE Full Text
  76. 76.↵
    Wang Z, Pekarskaya O, Bencheikh M, Chao W, Gelbard HA, Ghorpade A et al. Reduced expression of glutamate transporter EAAT2 and impaired glutamate transport in human primary astrocytes exposed to HIV-1 or gp120. Virology 2003; 312(1): 60–73.
    OpenUrlCrossRefPubMedWeb of Science
  77. 77.↵
    Doble A. The role of excitotoxicity in neurodegenerative disease: implications for therapy. Pharmacol Ther 1999; 81(3): 163–221.
    OpenUrlCrossRefPubMedWeb of Science
  78. 78.↵
    Cisneros IE, Ghorpade A. Methamphetamine and HIV-1-induced neurotoxicity: role of trace amine associated receptor 1 cAMP signaling in astrocytes. Neuropharmacology 2014; 85: 499–507.
    OpenUrlCrossRefPubMed
  79. 79.↵
    Yan Y, Nitta A, Koseki T, Yamada K, Nabeshima T. Dissociable role of tumor necrosis factor alpha gene deletion in methamphetamine self-administration and cue-induced relapsing behavior in mice. Psychopharmacology (Berl) 2012; 221(3): 427–436.
    OpenUrl
  80. 80.↵
    Volterra A, Liaudet N, Savtchouk I. Astrocyte Ca(2)(+) signalling: an unexpected complexity. Nat Rev Neurosci 2014; 15(5): 327–335.
    OpenUrlCrossRefPubMed
  81. 81.↵
    Corkrum M, Covelo A, Lines J, Bellocchio L, Pisansky M, Loke K et al. Dopamine-Evoked Synaptic Regulation in the Nucleus Accumbens Requires Astrocyte Activity. Neuron 2020; 105(6): 1036–1047 e1035.
    OpenUrl
Back to top
Posted February 22, 2021.
Download PDF

Supplementary Material

Data/Code
Email
Astrocyte-derived TNF and glutamate critically modulate microglia reactivity by methamphetamine
Teresa Canedo, Camila Cabral Portugal, Renato Socodato, Joana Bravo, Tiago Oliveira Almeida, João D. Magalhães, Sónia Guerra-Gomes, João Filipe Oliveira, Nuno Sousa, Ana Magalhães, João Bettencourt Relvas, Teresa Summavielle
bioRxiv 2021.02.22.432170; doi: https://doi.org/10.1101/2021.02.22.432170
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools

Subject Area