New Results

delilah, prospero and D-Pax2 constitute a gene regulatory network essential for the development of functional proprioceptors

Adel Avetisyan, Yael Glatt, Maya Cohen, Yael Timerman, Nitay Aspis, Atalya Nachman, Naomi Halachmi, Ella Preger-Ben Noon, Adi Salzberg
doi: https://doi.org/10.1101/2021.04.07.438778

ABSTRACT

Coordinated animal locomotion depends on the development of functional proprioceptors. While early cell-fate determination processes are well characterized, little is known about the terminal differentiation of cells within the proprioceptive lineage and the genetic networks that control them. In this work we describe a gene regulatory network consisting of three transcription factors-Prospero (Pros), D-Pax2 and Delilah (Dei)-that dictates two alternative differentiation programs within the proprioceptive lineage in Drosophila. We show that D-Pax2 and Pros control the differentiation of cap versus scolopale cells in the chordotonal organ lineage by, respectively, activating and repressing the transcription of dei. Normally, D-Pax2 activates the expression of dei in the cap cell but is unable to do so in the scolopale cell where Pros is co-expressed. We further show that D-Pax2 and Pros exert their effects on dei transcription via a 262 bp chordotonal-specific enhancer in which two D-Pax2- and three Pros-binding sites were identified experimentally. When this enhancer was removed from the fly genome, the cap- and ligament-specific expression of dei was lost, resulting in loss of chordotonal organ functionality and defective larval locomotion. Thus, coordinated larval locomotion depends on the activity of a dei enhancer that integrates both activating and repressive inputs for the generation of a functional proprioceptive organ.

INTRODUCTION

A central question in developmental biology is how different cells that originate in the same lineage and develop within the same organ, acquire unique identities, properties and specialized morphologies. One of the common mechanisms involved in cell fate diversification within a cell lineage is asymmetric cell division in which cytoplasmic determinants of the mother cell differentially segregate into one of the two daughter cells. This asymmetry is then translated into differential gene expression and the activation of cell type-specific gene regulatory networks (GRN) that dictate the differentiation programs of cells with unique properties. The transition from a primary cell fate to the characteristic phenotype of a fully differentiated cell involves complex GRNs in which numerous genes regulate each other’s expression. Despite this complexity, genetic analyses in well-characterized developmental systems can often reveal elementary interactions in small GRNs which dictate a specific cell fate, or a specific feature of the differentiating cell.

Many of the core components and the central processes underlying asymmetric cell divisions and primary cell fate decisions have been uncovered in studies performed on the central and peripheral nervous system (PNS) of Drosophila (e.g Knoblich, 2008; Schweisguth, 2015). The PNS of Drosophila contains two classes of multicellular sensory organs, external sensory organs and chordotonal organs (ChOs), whose lineages share a similar pattern of asymmetric cell divisions (Lai and Orgogozo, 2004). In both types of organs, the neuron and support cells, which collectively comprise the sensory organ, arise from a single sensory organ precursor cell (SOP) through a sequence of precisely choreographed asymmetric cell divisions (Reeves and Posakony, 2005). Unlike the primary cell-fate specification, which has been extensively investigated, the process of terminal differentiation of the post-mitotic progeny is poorly understood. We are using the larval lateral pentascolopidial ChO (LCh5) as a model system to study cell fate diversification within a sensory lineage.

The LCh5 organ is composed of five mechano-sensory units (scolopidia) that are attached to the cuticle via specialized epidermal attachment cells. Each of the five scolopidia originates in a single precursor cell that divides asymmetrically to generate five of the six cell types that construct the mature organ: the neuron, scolopale, ligament, cap and cap-attachment cell (Brewster and Bodmer, 1995)(Figure 1A-C). Three of the five cap-attachment cells are rapidly removed by apoptosis, leaving two cap-attachment cells that anchor the five cap cells to the epidermis (Avetisyan and Salzberg, 2019). Later in development, following the migration of the LCh5 organ from the dorsal to the lateral region of the segment, a single ligament-attachment cell is recruited from the epidermis to anchor the five ligament cells to the cuticle (Inbal et al., 2004). The mature LCh5 organ responds to mechanical stimuli generated by muscle contractions that lead to relative displacement of the attachment cells and the consequent shortening of the organ (Hassan et al., 2019).

Figure 1.
Figure 1. The LCh5 organ and the dei gene

(A) Four abdominal segments of a stage 16 embryo carrying the sv/Pax2D1-GFP reporter (green) which labels the cap and scolopale cells, stained with anti-Pros (red) which labels the nuclei of scolopale cells, and anti-Futsch (blue), which labels the neurons. One LCh5 organ is circled and the cap cells (C), scolopale cells (S) and neurons (N) are indicated. The cap-attachment, ligament-attachment and ligament cells are not stained. Scale bar = 20μm. (B-C) the ChO lineage (B) and schematic illustration of a single scolopidium (C). The neuron is depicted in blue, the scolopale cell in orange, the ligament cell in cerulean, the cap cell in green, the cap-attachment cell in red and the ligament-attachment cell in purple. (D) Schematic representation of the dei locus showing the two exons (black boxes) and the cis regulatory modules (CRM) that drive gene expression within the ChO lineage: the deiattachment CRM which drives expression in the attachment cells (red box) and the deiChO CRM which drives expression in the cap and ligament cells (green box). The deiChO CRM was originally mapped to a 1353 bp fragment (deiChO-1353) and was then delimited to a smaller 389 bp fragment located immediately upstream to the second exon (deiChO-389). As part of this work, the ChO-specific CRM was further delimited to a 262 bp fragment (deiChO-262). (E-H) The embryonic expression patterns driven by the deiattachment (E), deiChO-1353 (F), deiChO-389 (G) and deiChO-262 (H) enhancers are shown. C, cap cell; L, ligament cell; CA, cap-attachment cell, LA, ligament-attachment cell.

Very little is known about the unique cell type-specific differentiation programs that characterize each of the ChO cells, whose morphologies and mechanical properties differ dramatically from each other. To address this issue, we focus on the transcription factor Taxi wings/Delilah (Dei), an important regulator of cell adhesion (Egoz-Matia et al., 2011), which is expressed in the four accessory cell types (cap, ligament, cap-attachment and ligament-attachment) but is excluded from the neuron and the scolopale cell. Even though dei is expressed in all four accessory cells, its expression in these cells is differentially regulated. The transcription of dei in the ChO is controlled by two cis-regulatory modules (CRMs): The deiattachment enhancer, located ~2.5Kb upstream of the dei transcription start site, drives expression in the cap-attachment and ligament-attachment cells (as well as tendon cells), whereas the deiChO-1353 enhancer, an intronic 1353bp DNA fragment, drives dei expression specifically in the cap and ligament cells (Nachman et al., 2015) (Figure 1D-F). The deiattachment enhancer was shown to be activated by the transcription factor Stripe, which is considered a key regulator of tendon cell development (Becker et al., 1997) and a known determinant of attachment cell identity (Klein et al., 2010). Here we provide a high-resolution dissection of the deiChO-1353 enhancer and show that it integrates both activating and repressive cues to drive dei expression in cap and ligament cells while suppressing it in scolopale cells. We find that D-Pax2/Shaven (Sv), which is expressed in both branches of the cell lineage, is a positive regulator of dei and that Prospero (Pros) inhibits dei expression specifically in the scolopale cell. This small GRN is required for the realization of differentiation programs characterizing cap versus scolopale cell fates and is therefore essential for ChO functionality and coordinated larval locomotion.

RESULTS

Identifying D-Pax2/Sv as a putative direct activator of dei expression

To reveal the gene network that regulates dei expression in the ChO cells we used the ChO-specific deiChO-1353 enhancer as an entry point. We first mapped the critical regulatory region within the deiChO-1353 enhancer to a 389 bp fragment (deiChO-389) that accurately recapitulated the expression pattern of the full deiChO-1353 enhancer (Nachman et al., 2015) (Figure 1D, F-G). Subsequently, we narrowed down the critical regulatory region to an evolutionarily conserved 262 bp fragment deiChO-262, which drives ChO-specific expression in a pattern indistinguishable from the expression pattern driven by the larger fragments deiChO-1353 and deiChO-389 (Figure 1D, F, H).

We combined two types of screens in an attempt to identify genes that regulate the expression of dei in the ChO lineage. The first screen was an RNAi-based phenotypic screen conducted in second instar larvae (Hassan et al., 2018). It capitalized on a reporter fly strain in which the cap and ligament cells expressed green fluorescent protein (GFP) under the regulation of the deiChO-1353 enhancer, while the attachment cells expressed red fluorescent protein (RFP) under the regulation of the deiattachment enhancer (Halachmi et al., 2016). One of the 31 genes identified in the screen as being required for normal morphogenesis of the larval LCh5 organ was shaven (sv), which encodes for the Drosophila Pax2 homologue D-Pax2. The knockdown of sv within the ChO lineage led to loss of expression of the deiChO-1353 reporter from the cap cells, suggesting that D-Pax2 is a positive regulator of dei transcription in this cell type (Hassan et al., 2018).

The second screen was a yeast one hybrid (Y1H) screen aimed at identifying proteins that bind directly to the deiChO-389 enhancer. The screen was performed on a D. melanogaster whole embryo library using the deiChO-389 sequence as a bait. Two proteins were identified to bind the bait with very high confidence in the interaction: D-Pax2 and LamC. Three additional candidates were identified as binders with moderate confidence in the interaction: Fax, Lola and Toy (Figure S1). Together, the results of the two independent screens identified D-Pax2 as a putative direct transcriptional activator of dei and an important player in ChO development.

D-Pax2/Sv activates dei expression in the cap cell

To validate the sv RNAi-induced phenotype, we characterized the LCh5 organs of sv mutant embryos (sv6, sv7). In accordance with the knockdown phenotypes, the expression of dei in the cap cell was abolished in sv-deficient embryos (Figure 2A-B). The expression of additional genes associated with proper differentiation of the cap cell, such as αTub85E, was reduced as well (Figure 2C-D). The loss of sv did not eliminate the expression of either scolopale-specific proteins (Crumbs, Pros) or neuronal markers (Futsch, Elav, Nrg), suggesting that it did not affect primary cell fate decisions, however its loss prevented normal morphogenesis of the sensory unit (Figure 2E-H).

Figure 2.
Figure 2. Sv/D-Pax2 activates dei expression in the cap cell

(A-B) Representative abdominal segments of stage 16 embryos stained for Dei (cyan) and the neuronal marker Futcsh (red). The anti-Dei staining is shown separately in the lower panel. (A) A sv6 heterozygous embryo demonstrating the expression of Dei in the cap cell nuclei (circled). (B) The expression of Dei is lost in homozygous sv6 embryos. (C-D) Heterozygous (C) and homozygous (D) sv7 embryos stained for αTub85E (red) and Futsch (cyan). The arrows mark the cap cells; the arrowheads mark the ligament cells. The anti-αTub85E staining is shown separately in the lower panel. (E-F) Heterozygous (E) and homozygous (F) sv6 embryos stained for Elav (cyan) and Pros (red). The arrows mark the nuclei of scolopale cells. The anti-Pros staining is shown separately in the lower panel. (G-H) Heterozygous (G) and homozygous (G) sv6 embryos stained for Nrg (cyan) and Crumbs (red). The arrows mark the nuclei of scolopale (Sco) cells. The anti-Crumbs staining is shown separately in the lower panel. (I-L) Representative abdominal segments of stage 16 embryos that express GFP (I, K) or GFP and sv (J, L) under the regulation of en-Gal4. The embryos carry the deiChO-262-lacZ marker (anti βGal staining is shown in red) and are stained with anti-Dei (blue in I-J) or anti-αTub85E (blue in K-L). The staining patterns of deiChO-262-lacZ, Dei and αTub85E are shown separately on the right.

To further test the ability of D-Pax2/Sv to activate dei expression in vivo, we ectopically expressed sv under the regulation of en-Gal4 and examined the resulting changes in gene expression patterns. The ectopic expression of sv led to ectopic expression of both the endogenous dei gene and the deiChO-262 transcriptional reporter, as well as the cap cell marker αTub85E (Figure 2I-L). The morphology of the sv-overexpressing LCh5 organs was abnormal. These observations corroborate the notion that D-Pax2/Sv is an activator of dei that plays a critical role in ChO morphogenesis.

Pros represses dei in the scolopale cell

The sv gene is expressed broadly within the ChO lineage during early stages of organ development and is then gradually restricted to the cap and scolopale cells (Czerny et al., 1997; Fu et al., 1998), where its expression level remains high during late embryogenesis and larval stages. Yet, the expression of its downstream target gene dei is, normally, activated in the cap cell but is excluded from the scolopale cell. This discrepancy in the expression pattern of D-Pax2/Sv and dei may point to the presence of a scolopale-specific repressor that prevents the transcription of dei in this D-Pax2/Sv-expressing cell. The results of the abovementioned RNAi screen identified the transcription factor Pros as a good candidate for being that repressor. pros and sv RNAi had opposite effects on the expression of the deiChO-1353-GFP reporter. Whereas the knockdown of sv led to a loss of the reporter expression from the cap cell, the knockdown of pros led to expansion of its expression into the scolopale cell suggesting that, normally, Pros represses dei in this cell (Hassan et al., 2018).

To validate the pros knockdown phenotypes and to further test the idea that Pros acts as a repressor of dei in the scolopale cell, we characterized the ChOs of pros17 embryos. As seen in Figure 3A-B, the loss of pros led to ectopic expression of both the endogenous dei gene and the deiChO-262 reporter, as well as the cap cell marker αTub85E in the scolopale cells. The pros-deficient scolopale cells developed into cap-like cells rather than ligament-like or attachment cell-like cells. This was indicated by the upregulation of dei which was not accompanied by upregulation of the transcription factor Sr that is normally co-expressed with Dei in the ligament and attachment cells but is excluded from the cap cells (Figure 3C-D). The observed alterations in gene expression pattern do not reflect a full scolopale-to-cap cell fate transformation, as the Pros-deficient scolopale cells still maintain some of their scolopale-specific characteristics, such as Eyes Shut and α–Catenin expression (Figure 3E-H). As the number of neurons, ligament, cap, and cap-attachment cells remained normal in pros mutant embryos (Figure S2), we conclude that Pros does not influence primary cell-fate decisions within the LCh5 lineage.

Figure 3.
Figure 3. Pros represses dei in the scolopale cell

(A-B) Representative abdominal segments of stage 16 pros17 heterozygous (A) and homozygous (A) embryos carrying the deiChO-262-lacZ marker (shown in red) and stained for Dei (blue) and αTub85E (green). Each of the three channels is shown separately below. Note the expansion of Dei and the deiChO-262-lacZ marker into the scolopale cells in pros17 mutant embryos. The arrows point to the scolopale cells. (C-D) pros17 heterozygous (C) and homozygous (D) embryos stained for Dei (blue) and Sr (red). Note that the ectopic expression of Dei in the scolopale cells of pros mutant embryo is not accompanied by ectopic expression of Sr (the arrow labeled with asterisks in D). (E-F) pros17 heterozygous (E) and homozygous (F) embryos carrying an α-Catenin-GFP reporter and stained for Dei (blue, shown separately in the inset) and αTub85E (red). (G-H) pros17 heterozygous (G) and homozygous (H) embryos carrying the deiChO-262-lacZ reporter (shown in green) and stained with the scolopale marker anti-Eyes Shut (MAb21A6, red, shown separately in the inset). Note that the expression of both Eyes Shut/21A6 and α-Catenin is maintained in the pros-deficient scolopale cells. (I-J) deiChO-1353-Gal4 (I) and deiChO-1353>UAS-pros (J) embryos stained for Dei (cyan, shown separately in I’-J’) and αTub85E (red, shown separately in I’’-J’’). The cap and ligament cells are circled. Note the loss of Dei and αTub85E expression upon Pros expression. (K-L) deiChO-1353 (I) and deiChO-1353>UAS-pros (J) embryos carrying the deiChO-1353-lacZ reporter (shown in green) stained for Sal (blue) and Repo (red). (M-N) dei-Gal4 (M) and dei-Gal4>UAS-pros (N) embryos carrying an α-Catenin-GFP reporter (green, shown separately in M’-N’) and stained for Crumbs (red, shown separately in M’’-N’’) and αTub85E (blue). Note the duplication of scolopale-specific structures in the cap cell expressing Pros ectopically (circled).

The ability of Pros to repress dei was not restricted to the scolopale cell. Ectopic expression of pros in the LCh5 lineage, using a deiChO-1353-Gal4 driver, abolished the expression of both the endogenous dei gene and a deiChO-1353-GFP reporter in the cap and ligament cells as well (Figure 3I-L). In parallel to the repression of dei, ectopic expression of pros was sufficient for upregulating scolopale-specific genes and, moreover, for driving the formation of ectopic scolopale-specific structures within the affected cap cells. Most notably, the Pros-expressing cap cells manifested scolopale rods and ectopically expressed Crumbs and α-Catenin in a scolopale-characteristic pattern (Figure 3M-N).

D-Pax2/Sv and Pros regulate the transcription of dei via deiChO-262

The fact that the expression of the deiChO transcriptional reporters was affected similarly to the endogenous dei gene by both sv and pros loss- and gain-of-function, suggested that both D-Pax2/Sv and Pros regulate dei’s transcription in the ChOs through this regulatory module. To test this hypothesis, we deleted the deiChO-262 region from the fly genome by CRISPR/Cas9-mediated genome editing, resulting in a new regulatory allele of dei (deiΔChO). As expected, in homozygous deiΔChO embryos the expression of dei was lost from the cap and ligament cells but remained intact in the rest of the dei-expressing cells: CA, LA and tendon cells (Figure 4A-B). This observation strongly suggests that the deiChO-262 enhancer constitutes the sole regulatory module driving dei expression in the cap and ligament cells.

Figure 4.
Figure 4. D-Pax2/Sv and Pros regulate the transcription of dei via the deiChO-262 regulatory module.

(A-B) Stage 16 wt (A) and deiΔChO (B) embryos stained for Dei (cyan) and αTub85E (red). Note that in (B) Dei is still evident in the cap-attachment and ligament-attachment cells (CA and LA, arrows in A, circled in A’’), as well as in tendon cells (arrowheads), but is lost from the cap and ligament cells. (C) An embryo in which sv was expressed under the regulation of en-Gal4 in a deiΔChO background. Sv was unable to induce Dei expression in the cap and ligament cells in the absence of the deiChO-262 enhancer. Ectopic expression of αTub85E is evident within the en domain (arrowheads in C’). (D-E) wt (D) and A pros17 deiΔChO homozygous embryo (E) stained for Dei (cyan) and anti-Futsch (red). The pros17 deiΔChO embryo (E) presents a deiΔChO-like and not pros17-like expression pattern of the Dei protein, indicating that the deiΔChO deletion is epistatic to pros loss-of-function. The neurons present the typical pros axonal pathfinding defects.

To further test the notion that D-Pax2/Sv regulates dei expression via the deiChO-262 enhancer we examined the ability of D-Pax2/Sv to activate dei expression in the deiΔChO background. We found that ectopic expression of D-Pax2/Sv failed to induce ectopic dei expression in the deiΔChO background (Compare Figure 4C and 2L), indicating that the deiChO-262 enhancer is indispensable for the ability of D-Pax2/Sv to activate dei transcription. In a complementary experiment, we tested the effect of pros loss-of-function on the expression of dei in the deiΔChO background. We found that the deiΔChO regulatory mutation was epistatic to pros loss-of-function, so that no ectopic expression of dei was observed in the pros-deficient scolopale cells in embryos homozygous for the deiΔChO mutation (Compare Figure 4D-E and Figures 3B, D). Based on these results we concluded that the expression of dei in ChOs depends on the presence of the deiChO-262 regulatory region and that this enhancer integrates the positive and negative inputs of D-Pax2/Sv and Pros, respectively, to drive a lineage-specific dei expression.

D-Pax2/Sv and Pros are direct transcriptional regulators of dei

Our genetic analyses revealed that D-Pax2/Sv and Pros regulate the expression of dei in opposing manners through the function of the deiChO-262 enhancer. In addition, the Y1H screen identified a direct interaction between D-Pax2/Sv and deiChO-389 (which include the deiChO-262 module). We therefore hypothesized that the deiChO-262 enhancer contains binding sites for D-Pax2/Sv and Pros. Motif search analysis predicted that the deiChO-262 sequence encodes one canonical binding site for D-Pax2/Sv (Figure 5B, D-Pax2/Sv Site 2). On the other hand, we were unable to predict binding sites for Pros in the deiChO-262 sequence.

Figure 5:
Figure 5: deiChO-262 contains two binding sites for the activator D-Pax2/Sv and three binding sites for the repressor Pros

(A) Schematic representation of the deiChO-262 enhancer. Green and orange boxes represent the location of the D-Pax2/Sv and Pros binding sites identified by systematic EMSAs using oligos corresponding to the regions represented by boxes 1-7. (B) Sequence alignment between six Drosophila species for the region of the deiChO-262 enhancer containing the three D-Pax2/Sv and Pros sites (labeled and highlighted in green and orange, respectively). Dashes indicate gaps in the aligned sequence. (C) D-Pax2/Sv binds to two sites in deiChO-262, one low affinity site in fragment 3 (D-Pax2 site 1) and one high affinity site in fragment 7 (D-Pax2 site 2), as demonstrated with EMSA. The full screen is shown in Supplementary Figure S3. (D) Pros binds to three sites in deiChO-262: Pros site 1 in fragment 3, Pros site 2 in an overlapping sequence in fragments 4 and 5, Pros site 3 in fragment 6, as demonstrated with EMSA. The full screen is shown in Supplementary Figure S4. (E-L) Expression of wild-type (E) and mutated (F-L) deiChO-262-lacZ reporter constructs in abdominal segments A2-A6 of representative stage 16 embryos. The name of the construct is indicated in the bottom of each panel. The green arrows in E point to the cap cells of the various ChO of one abdominal segment: LCh1-lateral ChO1, LCh5-pentascolopidial organ, VChB and VChA are two ventral ChOs. The green arrows in J and L point to cap, scolopale (Sco) and ligament (Lig) cells of LCh5 organs where elevated level of reporter expression is evident. The arrowheads in I and K point to ligament cells of the ventral ChOs. in (M-N) Quantification of reporter activity in nuclei of cap (M) and scolopale cells (N) from LCh5 of segment A2 in embryos carrying the indicated constructs (n=10 embryos for each genotype). In violin plots, each point represents an individual nucleus, median is shown as dark gray dashed line. Asterisks denote significant difference from wild-type activities, (*) - P<0.05, (****) – P<0.0001, n.s. – not significant (Dunnett’s multiple comparison test).

To test whether D-Pax2/Sv actually binds to the predicted site, and to search for additional D-Pax2/Sv binding sites and for Pros binding sites, we systematically screened the deiChO-262 sequence with electrophoretic mobility shift assays (EMSAs, Figure 5 and Supplementary Figures S3 and S4). As shown in Figure 5C, purified D-Pax2/Sv DNA-binding domain bound strongly to the region containing the predicted binding site (probe 7). In addition, we identified another region (in probe 3), that bound D-Pax-2/Sv at a lower affinity (Figure 5C and Supplementary Figure S3). Using purified Pros-S DNA-binding domain we found that four fragments - probes 3, 4, 5 and 6 - bound Pros in vitro (Figure 5D). Comprehensive mutagenesis and competition assays revealed three Pros conserved binding sites within these fragments (Supplementary Figure S4), one of them partially overlapping the low-affinity binding site of D-Pax2/Sv (Figure 5B). Interestingly, none of these identified binding sites resemble the known binding sites for Pros identified by SELEX (Hassan et al., 1997), by functional studies (Cook et al., 2003), or by single-cell omics analyses (Bravo González‐Blas et al., 2020).

To test the in vivo role of the D-Pax2/Sv sites identified in vitro, we mutated them either individually, or in combinations, in the context of a deiChO-262 reporter transgene encoding for nuclear β-galactosidase. Mutation of the canonical D-Pax2/Sv site 2 reduced the expression level driven by deiChO-262 in cap cells (Figure 5G and 5M). Mutation of D-Pax2/Sv site 1 had no significant effect on its own (Figure 5F and 5M) but led to a complete suppression of deiChO-262 function when combined with a mutation in D-Pax2/Sv site 2 (Figure 5F and 5M). These results suggest that D-Pax2/Sv regulates the expression of dei in cap cells by binding to two D-Pax2/Sv binding sites within the deiChO-262 enhancer.

We next tested whether the Pros sites identified by EMSA function in vivo to suppress deiChO-262 activity in scolopale cells. Mutating the Pros site 2 resulted in ectopic expression of the reporter gene in the scolopale cells of LCh5 (Figure 5J and 5M). In contrast, disruption of either Pros site 1 or site 3 had no detectable effects on the expression of deiChO-262 in the scolopale cells of LCh5 (Figure 5I, 5K and 5M) but induced ectopic expression in scolopale cells of the LCh1 and VChA/B organs (Figure 5I and 5K, arrowheads). In addition, the disruption of Pros site 3 led to elevation in the reporter’s level in the LCh5 ligament cells (Figure 5K). Simultaneous mutation of all three Pros binding sites in deiChO-262 resulted in intensified ectopic expression in the scolopale cells of all ChOs (Figure 5L and 5N). Based on these results we conclude that Pros represses dei expression in the scolopale cell by binding to three low-affinity binding sites in deiChO-262 that function additively.

The deiChO-262 enhancer is essential for normal ChO function and larval locomotion

We have previously shown that the cap cell plays a crucial role in propagating muscle-generated mechanicals signals to the sensory neuron (Hassan et al., 2019). To test whether dei expression in the cap and ligament cells, mediated solely by the deiChO-262 enhancer, is essential for the proprioceptive function of the ChO, we analyzed the pattern of locomotion of freely moving deiΔChO larvae and compared it to wild-type larvae and larvae homozygous for the deiKO-mCherry null allele. As shown in Figure 6, wild-type larvae crawled persistently 94.5 ± 12.4% (n=27) of the time with a very few changes of direction or head swipes (Figure 6A, E, H, and Video S1-2). In contrast, the deiKO-mCherry larvae exhibited frequent changes of moving direction and longer pauses, walking on average only 38.9 ± 19.4% (n=25) of the time. While pausing, the deiKO-mCherry larvae swiped their heads extensively (Figure 6B, F, H, and Video S3-4). The deiΔChO larvae exhibited locomotion phenotypes that were similar to, though slightly less severe and more variable than, those of the deiKO-mCherry larvae (Figure 6C, G and H, Video S5-6). On average, the deiΔChO larvae crawled 51.9 ± 24.9% (n=24) of the time and swiped their heads often; in 15.8% of the time their body angle was higher than 250° or lower than 110°, compared to 9.9% in deiKO-mCherry and 1.2% of the time in wt larvae (Figure 6H). These results demonstrate that the deiChO-262 regulatory element is crucial for proper function of the ChO as its deletion resulted in sensory dysfunction and uncoordinated movement.

Figure 6.
Figure 6. The deiChO-262 enhancer is essential for normal larval locomotion

(A-C) Crawling trajectories of 25 wild-type (A) deiKO-mCherry (B) and deiΔChO (C) larvae. Each trajectory is shown in a square that represents 40×40mm area. (D) schematic representation of the body angle, γ, defined as the angle between the head and the body axis. (E-G) Representative time evolutions of the body angle of a wild-type (E), deiKO-mCherry (F) and deiΔChO (G) larvae. The wild-type larva walks persistently, and the body angle stays 180 degrees most of the time (a 40 sec interval is shown, after which the larva exited the filmed arena). The deiKO-mCherry and deiΔChO mutant larvae display frequent changes in the direction of motion and long pauses accompanied by extensive head swiping (120 sec intervals are shown). (H) A graph showing the average fraction of the time the larvae were crawling (GoPhase) and the fraction of time in which the body was bended more than 70 degrees (the measured angle γ was higher than 250 degrees or lower than 110 degrees). n=24-27 for all genotypes; error bars represent the standard deviation. *** p<0.0001, * p<0.05, ns= non-significant. P values were calculated using the unpaired two-tailed Mann-Whitney test.

DISCUSSION

Opposing activities of D-Pax2 and Pros dictate cap versus scolopale differentiation programs by regulating the dei gene

In this work we identify a small GRN that governs the alternative differentiation programs of two ‘cousins once removed’ cells within the ChO lineage - the cap cell and the scolopale cell. We show that Pros and D-Pax2/Sv are direct regulators of dei that together dictate its expression in the cap cell and its repression in the scolopale cell. Both D-Pax2/Sv and Pros exert their effects on dei transcription via a 262 bp chordotonal-specific enhancer (deiChO-262) in which two D-Pax2/Sv and three Pros binding sites were identified. Following primary cell fate decisions within the ChO lineage, Pros expression becomes restricted to the scolopale cell (Doe et al., 1991; Vaessin et al., 1991), whereas D-Pax2/Sv expression becomes restricted to the scolopale and cap cells (Figure 1A), similar to its behavior in the external sensory lineages (Johnson et al., 2011; Kavaler et al., 1999). D-Pax2/Sv activates the expression of dei in the cap cell but is unable to do so in the scolopale cell where Pros is co-expressed. If D-Pax2/Sv activity is compromised, the cap cell fails to express dei and loses some of its differentiation markers, such as the expression of αTub85E. In contrast, if Pros activity is lost, dei is ectopically expressed in the scolopale cell that, as a consequence, acquires some cap cell features including the expression of αTub85E (Figure 7). The observed D-Pax2/Sv- and Pros-associated phenotypes do not reflect genuine cell fate transformations, suggesting that D-Pax2/Sv and Pros do not affect primary cell fate decisions within the ChO lineage. Rather, the observed phenotypes reflect a failure of the cap and scolopale cells to follow the cell type-specific differentiation programs responsible for bringing about their characteristic cellular phenotypes. In the adult external sensory lineage Pros was shown to be important for the specification of the pIIb precursor, which gives rise to the neuron and sheath cell (the scolopale counterpart). However, the absence of Pros from the pIIa precursor, which gives rise to the hair and socket cells (the cap and cap-attachment cells counterparts) was even more critical for proper development of this branch of the lineage (Manning and Doe, 1999). This phenomenon is somewhat conserved in the larval ChO. While Pros is required for proper differentiation of the scolopale cell, its absence from the cap cell is critical for adopting the correct differentiation programs within the lineage.

Figure 7.
Figure 7. Summary of the relations between Sv, Pros and Dei in the ChO lineage and their effect on ChO development

(A) A wt ChO lineage. The cap (C) and ligament (L) cells are depicted in green, the scolopale cell (S) is depicted in orange and the neuron (N) is depicted in blue. Cells that expressed Dei are circled in light blue. (B) the loss of pros leads to upregulation of Dei in the scolopale cell and to failure of scolopale cell differentiation. In contrast, the loss of Sv leads to loss of Dei expression from the cap cell and failure of cap cell differentiation. The Sv-deficient scolopale cells are also abnormal. The CA cells which depend on the cap cell for their development/maintenence also appear abnormal is sv mutants. Misexpression of Pros leads to repression of Dei in the cap and ligament cells, preventing their normal differentiation. The Pros-expressing cap cells adopt some scolopale-specific features. In contrast, over-expression of Sv leads to ectopic expression of Dei. Due to the presence of Pros, the level of expression of dei in the scolopale cell is restricted. (C) A schematic summary showing the relations between Pros, Sv and Dei and their relations to cell type-specific differentiation programs. In the CA cells, dei is activated by Sr via the deiattachment enhancer. Both Sr and Dei are required there for the activation of CA-specific genes. In the cap cell dei is activated by Sv via the deiChO-262 enhancer. Sv is required for activating cap-specific genes in both Dei-dependent and independent ways. In the scolopale cells dei is repressed by Pros via the deiChO-262 enhancer. Pros is required in addition for activating scolopale-specific genes. Dei is also expressed in the ligament cells and is required for their correct differentiation. The regulators of dei in the ligament cell are yet to be identified.

Opposing effects of D-Pax2 and Pros activities on cell differentiation have been previously identified in the regulation of neuronal versus non-neuronal cell fate decisions in the developing eye, where they play a role in modulating the Notch and Ras signaling pathway (Charlton-Perkins et al., 2011). Interestingly, in the R7 equivalence group Pros and D-Pax2 can only alter the cell type-specific differentiation program of cells that already express the other gene (Charlton-Perkins et al., 2011). Similarly, in the ChO lineage, ectopic expression of Pros in the cap and ligament cells transforms the D-Pax2-positive cap cell towards a scolopale cell identity but does not affect the D-Pax2-negative ligament cell in a similar fashion, even though the ectopic expression of Pros does repress the transcription of dei in both cell types. Additionally, a loss of Pros activity in the scolopale cell can transform the identity of this cell towards a cap cell identity only in the presence of D-Pax2.

We do not know how Pros opposes the effect of D-Pax2 and inhibits the expression of dei in the scolopale cell. The results of the DNA-binding assays suggest that the inhibitory effect of Pros is not mediated through binding competition with D-Pax2 at the D-Pax2 high-affinity site (site 2), since this site does not overlap with a Pros-binding site (Figure 5B). The D-Pax2 low-affinity site does overlap with a Pros binding site, however, while being important for robust dei expression, this site is dispensable in the presence of the high-affinity site. It is possible that binding of Pros to the deiChO-262 enhancer targets this sequence to a repressed heterochromatin domain as was recently shown for other Pros target genes in differentiating neurons (Liu et al., 2020).

How is dei regulated in other ChO cell types?

dei is expressed in four out of six cell types comprising the ChO: the cap-attachment and ligament-attachment cells, in which dei transcription is activated by Sr via the deiattachment regulatory module (Nachman et al., 2015), and the cap and ligament cells in which the expression of dei is regulated via the deiChO-262 enhancer. We now show that D-Pax2 activates dei transcription in the cap cell, and that Pros inhibits its expression in the scolopale cell. The identity of the positive regulator/s of dei in the ligament cell, whose cell-fate is determined by the glial identity genes gcm and repo (Campbell et al., 1994; Halter et al., 1995; Jones et al., 1995), and the identity of the negative regulator/s of dei in the neuron remains unknown. Interestingly, the expression of dei was found to be altered in response to ectopic expression of gcm in the embryonic nervous system; its expression was upregulated at embryonic stage 11, but was repressed in embryonic stages 15-16 (Egger et al., 2002). This observation points to GCM as a potential regulator of dei expression in the ligament cells. Another interesting candidate for repressing dei in the sensory neuron is the transcriptional repressor Lola. Lola has been identified as a putative direct regulator of dei in the Y1H screen and was shown to be required in post-mitotic neurons in the brain for preserving a fully differentiated state of the cells (Southall et al., 2014). The possible involvement of Gcm and Lola in the regulation of dei awaits further studies. The observed upregulation of the deiChO-262 reporter in the ligament cells of embryos with mutated Pros binding sites may reflect an early role of Pros in the pIIb precursor before its restriction to the scolopale cell, which prevents dei expression in the ligament cell.

The deiChO-262-driven Dei expression is critical for organ functionality

Although the loss of dei in the genetic/cellular milieu of the ligament cell (unlike the cap cell), even when accompanied by ectopic expression of Pros, is not sufficient for transforming ligament cell properties towards those of scolopale cells, we know that the expression of dei in the ligament cell is critical for its proper development. Ligament-specific knockdown of dei leads to failure of the ligament cells to acquire the right mechanical properties and leads to their dramatic over-elongation (Hassan et al., 2018). By analysing the locomotion phenotypes of larvae homozygous for a dei null allele and the newly generated cap and ligament-specific deiΔChO allele, we could show that the expression of dei in the cap and ligament cells is crucial for normal locomotion. Thus, we conclude that the correct expression of dei within the ChO is critical for organ functionality. Surprisingly, the gross morphology of LCh5 of deiΔChO larvae appears normal (Data not shown). Yet, in a way that remains to be elucidated, the Dei-deficient cap and ligament cells fail to correctly transmit the cuticle deformations to the sensory neuron, most likely due to changes in their mechanical properties.

MATERIALS AND METHODS

Fly strains

The following mutant and reporter alleles of sv and pros were used: sv6/act-GFP, sv7/act-GFP, (Kavaler et al., 1999), Dpax2D1-GFP (Johnson et al., 2011), pros17/TM6B, Tb1 (BDSC:5458). The following Gal4 drivers and UAS strains were used: deiChO-1353-GFP,deiattachment-RFP;en-Gal4 (Halachmi et al., 2016), en-Gal4 (Brand and Perrimon, 1993), P{UAS-3xFLAG-pros.S}14c, y1 w*; Pin1/CyO (BDSC:32245). UAS-sv-RNAi (VDRC:107343), UAS-sv (Kavaler et al., 1999), UAS-D-α-Catenin-GFP (Oda and Tsukita, 1999).

The deiChO-Gal4 driver was constructed by cloning the deiChO-1353 regulatory module described in (Nachman et al., 2015) into the pChs-gal4 vector which was then used for the generation of transgenic fly strains (insertions are available on the X, 2nd and 3rd chromosome). The deiChO-262-lacZ strain was generated as previously described in (Nachman et al., 2015). For mutational analysis of the putative binding sites, wild-type and mutated deiChO-262 fragments were synthesized by GenScript (USA) and cloned into the reporter constructs placZattB (Table S4). Plasmids were integrated into the attP2 landing site by BestGene Inc (Chino Hills CA, USA).

The deiΔChO allele was generated by GenetiVision (Houston TX, USA) via multiplex targeting with two sgRNAs: 5’GCACTTGTTTGCGTTTACATTAC3’ and 5’GGCGAGAAGTATTCCCTGCG3’; creating a defined deletion of 307 bps spanning the deiChO-262 fragment. The presence of the desired deletion was verified by sequencing.

Embryo staining and image analysis

Immuno-staining of whole-mount embryos was performed using standard techniques. The following primary antibodies used in this study were: Rabbit anti Sv/D-Pax2 (1:10,000) (Johnson et al., 2011), Rabbit anti α85E-Tubulin (1:200) (Klein et al., 2010), Mouse anti α85E-Tubulin (1:20) (Nachman et al., 2015), Rabbit anti Dei (1:50)(Egoz-Matia et al., 2011), Rabbit anti Spalt (1:500) (Halachmi et al., 2007), Rat anti NRG (1:1000) (Banerjee et al., 2006), and Mouse anti-βGal (1:1000, Promega). The following antibodies were obtained from the Developmental Studies Hybridoma Bank: Mouse anti Pros (MR1A, 1:20), Mouse anti Futsch (22C10, 1:20), Rat anti-ELAV (7E8A10, 1:50), Mouse anti-Eys (21A6, 1:20), Mouse anti-Repo (8D12, 1:10), Mouse anti Crb (Cq4, 1:10). Chicken anti-Sr (1:20) was made against amino acids 707-1180 of the Sr protein fused to GST in the pGEX-KG expression vector. The ~80kDa fusion protein was purified on Glutathione-agarose beads followed by elution with reduced glutathione. Antibodies against the GST-Sr fusion protein were produced in Chickens by Dr. Enav Bar-Shira (Department of Animal Sciences, Robert H. Smith Faculty of Agriculture Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel). The IgY antibody fraction was isolated from the egg yolk and cleaned on Glutathione-agarose beads to reduce background of anti-GST antibodies. Secondary antibodies for fluorescent staining were Cy3, Cy2, Cy5 or Alexa Fluor-647-conjugated anti-Mouse/Rabbit/Rat/Chicken/Guinea pig (1:100, Jackson Laboratories, Bar-Harbor, Maine, USA). Stained embryos were mounted in DAKO mounting medium (DAKO Cytomation, Denmark) and viewed using confocal microscopy (Axioskop and LSM 510, Zeiss).

For the analysis of reporter gene expression, images were analyzed using ImageJ software (http://rsb.info.nih.gov/ij/) as previously described (Preger-Ben Noon et al., 2018). Briefly, maximum projections of confocal stacks were assembled, and background was subtracted using a 50-pixel rolling-ball radius. Then, we manually segmented visible nuclei of cap and scolopale cells from LCh5 of abdominal segments A2 and measured the fluorescence mean intensities of each nucleus. Statistical analyses and graphing were performed using GraphPad Prism version 8, GraphPad Software, La Jolla California USA, www.graphpad.com.

Yeast-one-hybrid screen

The screen was performed by Hybergenics Services on a Drosophila whole embryo library (ULTImate Y1H screen vs Drosophila Whole Embryo RP2 0-12+12-24hr), using the deiChO-389 sequence as a bait. Screening was performed using the Aureobasidin A selection system. 146 clones that were found to grow on the selective medium containing 400 ng/ml of the yeast antibiotic agent Aureobasidin A were sequenced (Table S1).

Protein purification

D-Pax2-HD and Pros-S-HD expression plasmids were a kind gift from Brian Gebelein and Tiffany Cook (Cook et al., 2003; Li-Kroeger et al., 2012). Proteins were purified from E.coli (BL21) as described previously (Uhl et al., 2010) with the following modifications. Protein expression was induced at 37°C using 0.1mM IPTG for 4 hours (Pros-S/L-HD) or 0.4mM IPTG for 4 hours (D-Pax2-HD).

Pros-S-HD: After induction, bacterial pellet was resuspended in PBS supplemented with complete protease inhibitor mix (Roche) and lysed on ice using sonication (10 cycles of 30 sec on/off). GST-tagged Pros-S-HD in soluble fraction was purified using Glutathione-Agarose beads (Sigma). The bound proteins were eluted in elution buffer (50 mM Tris, pH 8, 10 mM reduced Glutathione).

D-Pax2-HD: The bacterial pellet was resuspended in 20 mM Tris, pH 7.5 supplemented with protease inhibitor. His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris, pH7.5, 300 mM NaCl, 50 mM NaH2PO4 pH 8.0), 2 column volumes of wash buffer 2 (20 mM Tris, pH7.5, 300 mM NaCl, 5 mM DTT, 10 mM Imidazole), and bound proteins were eluted in the same buffer supplemented with 250 mM Imidazole.

All samples were dialyzed against 500 ml of dialysis buffer (20 mM HEPES, pH 7.9, 200 mM NaCl, 10% Glycerol, 2 mM MgCl) for 18 hours at 4°C. Protein concentrations were measured with NanoDrop and confirmed by SDS-PAGE and Coomassie blue analysis.

Electromobility shift assay (EMSA)

DNA probes were generated by annealing 5’ IRDye®700 labeled forward oligonucleotides with unlabeled reverse oligonucleotides (Integrated DNA Technologies) to a final concentration of 5 μM in PNK buffer (New England Biolabs). One hundred femtomoles of labeled IRDye®700 probes were used in a 20-μl binding reaction containing 10 mM Tris, pH 7.5; 50 mM NaCl; 1 mM MgCl2; 4% glycerol; 0.5 mM DTT; 0.5 mM EDTA; 50 μg/ml poly(dI–dC); 200 μg/ml of BSA and purified proteins (see Table SX for amount of each protein used). The binding reactions were incubated at room temperature for 30 min, and run on a native 4% polyacrylamide gel for 1.5 hours at 180 V. For competition assays, the appropriate amount of cold competitor was added with the IRDye®700-labeled probe prior to the incubation. The polyacrylamide gel cassettes were imaged using an Odyssey Infrared Imaging System and image analysis was performed using ImageQuant 5.1 software. All experiments were performed at least three times.

Locomotion assays

Larvae used in the locomotion assays were collected from 8-12-hour egg collections that aged at 24°C until reaching the wandering 3rd instar stage (115-140 hours). 25-30 larvae of each genotype were individually transferred to a fresh 2% agar 10cm plate, prewarmed to 24°C. Larvae were let to adjust for 30 seconds prior to 2-minute recording at a rate of 30 frames per second. The wild-type larvae often exited the filmed arena before the completion of the full 2 min recording time. Larval locomotion was recorded using a Dino-Lite digital microscope placed above the plate. We used VideoPad software to convert Dino-Lite files into Tiff files. ImageJ and FIMTrack (Risse et al., 2017) tracking software were used for following larval (center of mass) movements and body angle.

Acknowledgements

We wish to thank Joshua Kavaler, Tiffany Cook, Anna Jazwinska, Manzur Bhat, the Bloomington Stock Center and the Developmental Studies Hybridoma Bank at the University of Iowa for sending us antibodies and fly strains. We are very grateful to Enav Bar-Shira for her kind help in generating the chicken anti-Sr antibodies and to Abeer Hassan for helping us with the analysis of the locomotion assays’ data. This work was supported by a grant (No. 674/17) to AS from The Israel Science Foundation.

Footnotes

  • Figure 6 was revised: Following the identification of a calculation error in the analysis of larval locomotion presented in Figure 6H of version #1, we have re-analysed all the larval locomotion data. The corrected values are presented in Figure 6H of the new version. This change does not affect any of the conclusions of the work. The abstract was revised

REFERENCES

  1. ↵
    Avetisyan, A., Salzberg, A., 2019. Accurate elimination of superfluous attachment cells is critical for the construction of functional multicellular proprioceptors in Drosophila. Cell Death Differ. 1. doi:10.1038/s41418-018-0260-y
    OpenUrlCrossRef
  2. ↵
    Banerjee, S., Pillai, A.M., Paik, R., Li, J., Bhat, M.A., 2006. Axonal Ensheathment and Septate Junction Formation in the Peripheral Nervous System of Drosophila. J. Neurosci. 26, 3319–3329. doi:10.1523/JNEUROSCI.5383-05.2006
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Becker, S., Pasca, G., Strumpf, D., Min, L., Volk, T., 1997. Reciprocal signaling between Drosophila epidermal muscle attachment cells and their corresponding muscles. Development 124, 2615–2622.
    OpenUrlAbstract
  4. ↵
    Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415.
    OpenUrlAbstract
  5. ↵
    Bravo González‐Blas, C., Quan, X., Duran‐Romaña, R., Taskiran, I.I., Koldere, D., Davie, K., Christiaens, V., Makhzami, S., Hulselmans, G., Waegeneer, M., Mauduit, D., Poovathingal, S., Aibar, S., Aerts, S., 2020. Identification of genomic enhancers through spatial integration of single‐cell transcriptomics and epigenomics. Mol. Syst. Biol. 16. doi:10.15252/msb.20209438
    OpenUrlCrossRef
  6. ↵
    Brewster, R., Bodmer, R., 1995. Origin and specification of type II sensory neurons in Drosophila. Development 121, 2923–2936.
    OpenUrlAbstract
  7. ↵
    Campbell, G., Göring, H., Lin, T., Spana, E., Andersson, S., Doe, C.Q., Tomlinson, A., 1994. RK2, a glial-specific homeodomain protein required for embryonic nerve cord condensation and viability in Drosophila. Development 120, 2957–66.
    OpenUrlAbstract
  8. ↵
    Charlton-Perkins, M., Whitaker, S.L., Fei, Y., Xie, B., Li-Kroeger, D., Gebelein, B., Cook, T., 2011. Prospero and Pax2 combinatorially control neural cell fate decisions by modulating Ras- and Notch-dependent signaling. Neural Dev. doi:10.1186/1749-8104-6-20
    OpenUrlCrossRefPubMed
  9. ↵
    Cook, T., Pichaud, F., Sonneville, R., Papatsenko, D., Desplan, C., 2003. Distinction between Color Photoreceptor Cell Fates Is Controlled by Prospero in Drosophila. Dev. Cell 4, 853–864. doi:10.1016/S1534-5807(03)00156-4
    OpenUrlCrossRefPubMedWeb of Science
  10. ↵
    Czerny, T., Bouchard, M., Kozmi, Z., Busslinger, M., 1997. The characterization of novel Pax genes of the sea urchin and Drosophila reveal an ancient evolutionary origin of the Pax2/5/8 subfamily. Mech. Dev. doi:10.1016/S0925-4773(97)00119-6
    OpenUrlCrossRefPubMedWeb of Science
  11. ↵
    Doe, C.Q., Chu-LaGraff, Q., Wright, D.M., Scott, M.P., 1991. The prospero gene specifies cell fates in the drosophila central nervous system. Cell. doi:10.1016/0092-8674(91)90463-9
    OpenUrlCrossRefPubMedWeb of Science
  12. ↵
    Egger, B., Leemans, R., Loop, T., Kammermeier, L., Fan, Y., Radimerski, T., Strahm, M.C., Certa, U., Reichert, H., 2002. Gliogenesis in Drosophila: genome-wide analysis of downstream genes of glial cells missing in the embryonic nervous system. Development 129.
  13. ↵
    Egoz-Matia, N., Nachman, A., Halachmi, N., Toder, M., Klein, Y., Salzberg, A., 2011. Spatial regulation of cell adhesion in the Drosophila wing is mediated by Delilah, a potent activator of βPS integrin expression. Dev. Biol. 351. doi:10.1016/j.ydbio.2010.12.039
    OpenUrlCrossRefPubMed
  14. ↵
    Fu, W., Duan, H., Frei, E., Noll, M., 1998. shaven and sparkling are mutations in separate enhancers of the Drosophila Pax2 homolog. Development.
  15. ↵
    Halachmi, N., Nachman, A., Salzberg, A., 2016. A newly identified type of attachment cell is critical for normal patterning of chordotonal neurons. Dev. Biol. 411, 61–71. doi:10.1016/j.ydbio.2016.01.009
    OpenUrlCrossRef
  16. ↵
    Halter, D.A., Urban, J., Rickert, C., Ner, S.S., Ito, K., Travers, A.A., Technau, G.M., 1995. The homeobox gene repo is required for the differentiation and maintenance of glia function in the embryonic nervous system of Drosophila melanogaster. Development 121.
  17. ↵
    Hassan, A., Sapir, L., Nitsan, I., Greenblatt Ben-El, R.T., Halachmi, N., Salzberg, A., Tzlil, S., 2019. A Change in ECM Composition Affects Sensory Organ Mechanics and Function. Cell Rep. doi:10.1016/j.celrep.2019.04.092
    OpenUrlCrossRef
  18. ↵
    Hassan, A., Timerman, Y., Hamdan, R., Sela, N., Avetisyan, A., Halachmi, N., Salzberg, A., 2018. An RNAi Screen Identifies New Genes Required for Normal Morphogenesis of Larval Chordotonal Organs. G3 Genes|Genomes|Genetics 8, 1871 LP–1884.
    OpenUrl
  19. ↵
    Hassan, B., Li, L., Bremer, K.A., Chang, W., Pinsonneault, J., Vaessin, H., 1997. Prospero is a panneural transcription factor that modulates homeodomain protein activity. Proc. Natl. Acad. Sci. U. S. A. 94, 10991–6. doi:10.1073/pnas.94.20.10991
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Inbal, A., Volk, T., Salzberg, A., 2004. Recruitment of ectodermal attachment cells via an EGFR-dependent mechanism during the organogenesis of Drosophila proprioceptors. Dev Cell 7, 241–250. doi:10.1016/j.devcel.2004.07.001
    OpenUrlCrossRefPubMed
  21. ↵
    Johnson, S.A., Harmon, K.J., Smiley, S.G., Still, F.M., Kavaler, J., 2011. Discrete regulatory regions control early and late expression of D-Pax2 during external sensory organ development. Dev. Dyn. 240, 1769–1778. doi:10.1002/dvdy.22672
    OpenUrlCrossRefPubMed
  22. ↵
    Jones, B.W., Fetter, R.D., Tear, G., Goodman, C.S., 1995. glial cells missing: A Genetic Switch That Controls Glial versus Neuronal Fate, Cell.
  23. ↵
    Kavaler, J., Fu, W., Duan, H., Noll, M., Posakony, J.W., 1999. An essential role for the Drosophila Pax2 homolog in the differentiation of adult sensory organs. Development 126, 2261–2272.
    OpenUrlAbstract
  24. ↵
    Klein, Y., Halachmi, N., Egoz-Matia, N., Toder, M., Salzberg, A., 2010. The proprioceptive and contractile systems in Drosophila are both patterned by the EGR family transcription factor Stripe. Dev. Biol. 337. doi:10.1016/j.ydbio.2009.11.022
    OpenUrlCrossRefPubMed
  25. ↵
    Knoblich, J.A., 2008. Mechanisms of Asymmetric Stem Cell Division. Cell 132, 583–597. doi:10.1016/J.CELL.2008.02.007
    OpenUrlCrossRefPubMedWeb of Science
  26. ↵
    Lai, E.C., Orgogozo, V., 2004. A hidden program in Drosophila peripheral neurogenesis revealed: Fundamental principles underlying sensory organ diversity. Dev. Biol. doi:10.1016/j.ydbio.2004.01.032
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    Li-Kroeger, D., Cook, T.A., Gebelein, B., 2012. Integration of an abdominal Hox complex with Pax2 yields cell-specific EGF secretion from Drosophila sensory precursor cells. Development 139, 1611–9. doi:10.1242/dev.077842
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Liu, X., Shen, J., Xie, L., Wei, Z., Wong, C., Li, Y., Zheng, X., Li, P., Song, Y., 2020. Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation. Dev. Cell 52, 277–293.e8. doi:10.1016/J.DEVCEL.2019.11.019
    OpenUrlCrossRef
  29. ↵
    Manning, L., Doe, C.Q., 1999. Prospero distinguishes sibling cell fate without asymmetric localization in the Drosophila adult external sense organ lineage. Development 126.
  30. ↵
    Nachman, A., Halachmi, N., Matia, N., Manzur, D., Salzberg, A., 2015. Deconstructing the complexity of regulating common properties in different cell types: Lessons from the delilah gene. Dev. Biol. 403. doi:10.1016/j.ydbio.2015.05.009
    OpenUrlCrossRef
  31. ↵
    Oda, H., Tsukita, S., 1999. Dynamic features of adherens junctions during Drosophila embryonic epithelial morphogenesis revealed by a D α-catenin-GFP fusion protein. Dev. Genes Evol. 1999 2094 209, 218–225. doi:10.1007/S004270050246
    OpenUrlCrossRef
  32. ↵
    Preger-Ben Noon, E., Sabarís, G., Ortiz, D.M., Sager, J., Liebowitz, A., Stern, D.L., Frankel, N., 2018. Comprehensive Analysis of a cis-Regulatory Region Reveals Pleiotropy in Enhancer Function. Cell Rep. doi:10.1016/j.celrep.2018.02.073
    OpenUrlCrossRef
  33. ↵
    Reeves, N., Posakony, J.W., 2005. Genetic programs activated by proneural proteins in the developing Drosophila PNS. Dev. Cell 8, 413–425. doi:10.1016/j.devcel.2005.01.020
    OpenUrlCrossRefPubMedWeb of Science
  34. ↵
    Risse, B., Mangan, M., Webb, B., Del Pero, L., 2017. Visual Tracking of Small Animals in Cluttered Natural Environments Using a Freely Moving Camera, in: Proceedings - 2017 IEEE International Conference on Computer Vision Workshops, ICCVW 2017. doi:10.1109/ICCVW.2017.335
    OpenUrlCrossRef
  35. ↵
    Schweisguth, F., 2015. Asymmetric cell division in the Drosophila bristle lineage: from the polarization of sensory organ precursor cells to Notch-mediated binary fate decision. Wiley Interdiscip. Rev. Dev. Biol. 4, 299. doi:10.1002/WDEV.175
    OpenUrlCrossRef
  36. ↵
    Southall, T.D., Davidson, C.M., Miller, C., Carr, A., Brand, A.H., 2014. Dedifferentiation of neurons precedes tumor formation in Lola mutants. Dev. Cell 28, 685–96. doi:10.1016/j.devcel.2014.01.030
    OpenUrlCrossRefPubMed
  37. ↵
    Uhl, J.D., Cook, T.A., Gebelein, B., 2010. Comparing anterior and posterior Hox complex formation reveals guidelines for predicting cis-regulatory elements. Dev. Biol. 343, 154–66. doi:10.1016/j.ydbio.2010.04.004
    OpenUrlCrossRefPubMed
  38. ↵
    Vaessin, H., Grell, E., Wolff, E., Bier, E., Jan, L.Y., Jan, Y.N., 1991. prospero is expressed in neuronal precursors and encodes a nuclear protein that is involved in the control of axonal outgrowth in Drosophila. Cell. doi:10.1016/0092-8674(91)90367-8
    OpenUrlCrossRefPubMedWeb of Science
Back to top
Posted May 23, 2021.
Download PDF

Supplementary Material

Email
delilah, prospero and D-Pax2 constitute a gene regulatory network essential for the development of functional proprioceptors
Adel Avetisyan, Yael Glatt, Maya Cohen, Yael Timerman, Nitay Aspis, Atalya Nachman, Naomi Halachmi, Ella Preger-Ben Noon, Adi Salzberg
bioRxiv 2021.04.07.438778; doi: https://doi.org/10.1101/2021.04.07.438778
Digg logo Reddit logo Twitter logo Facebook logo Google logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area