Abstract
Argonaute proteins use nucleic acid guides to find and bind specific DNA or RNA target sequences. Argonaute proteins can be found in all kingdoms of life, and play diverse biological functions including genome defense, gene regulation, and chromosome partitioning. Many Argonautes retain their ancestral endoribonuclease activity, cleaving the phosphodiester bond between target nucleotides t10 and t11. In animals, a specialized class of Argonautes, the PIWI proteins, use 21–35 nt PIWI-interacting RNAs (piRNAs) to direct transposon silencing, protect the germline genome, and regulate gene expression during gametogenesis1. The piRNA pathway is required for fertility in one or both sexes of nearly all animals. Both piRNA production and function require RNA cleavage catalyzed by PIWI proteins. Spermatogenesis in mice and other placental mammals requires three distinct, developmentally regulated PIWI proteins: MIWI (PIWIL1), MILI (PIWIL2), and MIWI2 (PIWIL4)2–4. The piRNA-guided endoribonuclease activities of MIWI and MILI are essential to produce functional sperm5, 6. piRNA-directed silencing in mice and insects also requires Gametocyte-Specific Factor 1 (GTSF1), a PIWI-associated protein of unknown function7–12. Here, we report that GTSF1 potentiates the weak, intrinsic, piRNA-directed RNA cleavage activities of PIWI proteins, transforming them into efficient endoribonucleases. GTSF1 represents the first example of an auxiliary protein that potentiates the catalytic activity of an Argonaute protein.
Main
In animals, 21–35 nt PIWI-interacting RNAs (piRNAs) direct PIWI proteins to silence transposons and regulate gene expression1, 13–27. Invertebrates produce piRNAs and PIWI proteins in both the soma and the germline28–35 but mammalian piRNAs act only in the germline36–43. Mice lacking any of their three PIWI proteins—MIWI2 (PIWIL4), MILI (PIWIL2), and MIWI (PIWIL1)—or other proteins required for piRNA production are invariably male sterile1–4. As in other animals, mouse piRNA production requires catalytically active PIWI proteins, MILI and MIWI5, 6. Transposon silencing is the ancestral function of piRNAs; uniquely, placental mammals also produce pachytene piRNAs, which first appear shortly after the onset of meiosis I (refs. 40–42,44–46) and reach a peak abundance in spermatocytes rivalling that of ribosomes16. Pachytene piRNAs tune the abundance of mRNAs required for spermiogenesis, the process by which round spermatids become sperm47–50. Pachytene piRNAs have been proposed to direct MIWI and MILI to cleave specific mRNAs, ensuring appropriate levels of their protein products47, 50–52. Testing this idea has been thwarted by the absence of a cell-free system in which MIWI or MILI can be loaded with synthetic piRNAs of defined sequence.
Recombinant MIWI loaded with a piRNA of defined sequence
We used lentiviral transduction to engineer a stable HEK293T cell line over-expressing epitope-tagged MIWI. Tagged MIWI was captured from cell lysate using anti-FLAG antibody coupled to paramagnetic beads, incubated with a synthetic piRNA bearing a monophosphorylated 5′ terminus and 2′-O-methylated 3′ end, and eluted from the magnetic beads using 3XFLAG peptide. MIWI loaded with a synthetic piRNA (MIWI piRISC; Fig. 1a), but not unloaded apo-MIWI (Extended Data Fig. 1a), cleaved a 5′ 32P-radiolabled target RNA fully complementary to the synthetic guide (Extended Data Fig. 1b, c and Supplementary Data Fig. 1a).
Recombinant MIWI bound stably to an RNA guide bearing a 5′ monophosphate but not to a guide with a 5′ hydroxyl group (Extended Data Fig. 1d). The MID domain of Argonaute proteins contains a 5′ monophosphate-binding pocket that anchors the RNA guide to the protein53–59. Mutations predicted to disrupt 5′ monophosphate-binding perturb PIWI function55, 60–64. We immobilized MIWI on paramagnetic beads via its 3XFLAG tag, incubated it with guide RNA, washed the beads, eluted the MIWI piRISC with 3XFLAG tag peptide, and tested its ability to cleave a fully complementary target RNA. Incubation with a 5′ monophosphorylated but not an otherwise identical 5′ hydroxy guide yielded MIWI piRISC that cleaved target RNA (Extended Data Fig. 1d). In vivo, the methyltransferase HENMT1 adds a 2′-O-methyl group to the 3′ ends of piRNAs. Henmt1−/− male mice and henn1−/− worms are sterile65–71. Terminal 2′-O-methyl modification likely stabilizes small RNAs against degradation by cellular ribonucleases rather than secures the guide to the protein72, 73. Consistent with this function for 2′-O-methylation, piRNAs bearing a 3′ terminal 2′ hydroxyl or 2′-O-methyl were equally functional in directing target cleavage, provided that the piRNA was 5′ monophosphorylated (Extended Data Fig. 1d).
Purified MIWI RISC is a sluggish enzyme
Although affinity-purified MIWI loaded with a piRNA bearing 5′ monophosphorylated and 3′, 2′-O-methylated termini specifically cleaved a fully complementary target RNA at the phosphodiester bond that links target nucleotides t10 to t11, the rate of cleavage (0.01 min−1) was >300 times slower than that catalyzed by mouse AGO2 RISC (≥ 3 min−1)74, 75. At physiological temperature (37°C), mouse AGO2 RISC catalyzes multiple rounds of target cleavage76. By contrast, 5 nM MIWI piRISC cleaved only ∼15% of the target RNA (5 nM) after 1 h (Fig. 1b, Extended Data Fig. 1e, and Supplementary Data Fig. 1b). Inefficient target cleavage by MIWI piRISC was not caused by the presence of the amino-terminal 3XFLAG-SNAP tandem tag: removing the tandem tags using tobacco etch virus protease generated an untagged protein (Extended Data Fig. 1f and Supplementary Data Fig. 1c) whose target cleavage kinetics were identical to that of piRISC assembled with the tagged MIWI (Extended Data Fig. 1g).
The ubiquitously expressed arginine methyltransferase PRMT5 modifies the amino terminus of PIWI proteins, allowing it to bind Tudor domain-containing proteins, many of which are required for piRNA biogenesis, gametogenesis, and fertility77–79. A potential explanation for the sluggish activity of recombinant MIWI piRISC is that it lacks arginine methylation. We used mass spectrometry to map the positions of methyl arginine in our affinity-purified MIWI. All of the arginine residues previously shown to be methylated in endogenous MIWI immunoprecipitated from mouse testis77 were methylated in recombinant MIWI produced in HEK293T cells (Extended Data Fig. 1h).
Another possible explanation for the inefficiency of target cleavage by MIWI piRISC is that the recombinant protein, although properly arginine methylated, lacks other post-translational modifications. To test this idea, we immobilized apo-MIWI, incubated it with wild-type (C57BL/6) mouse testis lysate in the presence of an ATP regenerating system at 25°C for 15 min, removed the testis lysate by washing, and then loaded MIWI with a synthetic piRNA and eluted the resulting piRISC. Pre-incubation of MIWI with testis lysate either before or after loading with a piRNA failed to increase its target cleaving activity (Extended Data Fig. 2a, b). We conclude that neither a missing post-translational modification nor a tightly associated protein partner is likely to explain the low activity of MIWI piRISC compared to AGO2 RISC.
MIWI piRISC requires an auxiliary factor to efficiently cleave its target
Adding testis lysate increased the rate of target cleavage by affinity-purified MIWI piRISC ∼20-fold (Fig. 1b; Extended Data Fig. 2b). This effect cannot be attributed to the lysate contributing additional piRISC, because testis lysate alone failed to generate detectable cleavage product (Fig. 1b).
MIWI is first produced as spermatogonia enter meiosis and differentiate into spermatocytes3, 80. To determine whether the MIWI-potentiating factor is differentially expressed during spermatogenesis, we supplemented the target cleavage assay with lysate prepared from FACS-purified germ cells: piRISC-potentiating activity was greatest in lysate from secondary spermatocytes (Fig. 1c), a cell type in which pachytene-piRNA-directed target cleavage is readily detected in vivo47, 50. Moreover, the potentiating activity was testis-specific: lysates from brain, liver, or kidney failed to enhance piRNA-directed target cleavage by MIWI (Extended Data Fig. 3a). Finally, the potentiating activity was specific for PIWI proteins and had no effect on the rate of target cleavage by mouse AGO2 (Extended Data Fig. 3b).
Three lines of evidence suggest that the MIWI-potentiating activity contains one or more structural Zn2+ ions. First, pre-treating testis lysate with the sulfhydryl alkylating agent N-ethylmaleimide inactivated the potentiating activity (Extended Data Fig. 3c), indicating reduced cysteine residues, which often bind divalent metal cations81, are essential. Second, the MIWI-potentiating activity was unaltered by EGTA, which chelates Ca2+, but was irreversibly inactivated by EDTA, which chelates many divalent metals, and by 1,10-Phenanthroline, which specifically chelates Zn2+ (Extended Data Fig. 3d). Adding additional metal ions failed to rescue the activity (Extended Data Fig. 3e–g), suggesting that loss of Zn2+ irreversibly denatures the MIWI-potentiating factor, a characteristic of zinc-finger proteins82, 83. Third, the MIWI-potentiating activity bound more tightly to an immobilized metal-affinity resin charged with Zn2+ than to resin charged with Ni2+ (Extended Data Fig. 3h).
To identify the MIWI-potentiating activity, we developed a chromatographic purification scheme using cation-exchange, hydrophobic-interaction, and size-exclusion chromatography (Fig. 2a). Notably, the activity eluted from a Superdex 200 size-exclusion column as a single ∼17 kDa peak (Fig. 2b). Taken together, our data suggest that the MIWI-potentiating activity corresponds to a small, testis-specific, Zn2+-binding protein abundantly expressed in meiotic and post-meiotic male germ cells (Fig. 2c).
GTSF1 is necessary and sufficient for efficient target cleavage by MIWI
Gametocyte Specific Factor 1 (GTSF1) is a conserved, 19,083 Da, tandem CHHC-type zinc-finger protein essential for piRNA function and fertility in flies7, 8, 10, silk moths11, worms84, and mice9, 12. Like Miwi and Mili, the mRNA abundance of Gtsf1, as well as its paralogs Gtsf1L and Gtsf2, rises sharply as male germ cells enter meiosis I, peaks in secondary spermatocytes, and then declines in round spermatids (Extended Data Fig. 4a). Immobilized mouse GTSF1 captures all three PIWI proteins from testis lysate, but GTSF1 and PIWI proteins co-expressed in HEK293T cells do not co-immunoprecipitate, leading to the suggestion that the GTSF1-PIWI interaction requires additional protein or RNA components9. MIWI2-bound piRNAs are lost in Gtsf1−/− male mice9, which are sterile12 likely because loss of GTSF1 causes loss of MIWI2-directed retrotransposon promoter methylation4, 85–87. Although RNA cleavage by MIWI2 is not required for piRNA biogenesis or function, production of MIWI2 piRISC requires MILI-dependent piRNA amplification, a process that requires the endonuclease activity of MILI6. In flies, piRNA-directed transcriptional silencing of transposons by Piwi, but not Piwi piRISC-assembly, requires the GTSF1 ortholog Asterix7, 8.
To test whether the MIWI-potentiating activity in the testis lysate corresponded to GTSF1, we used CRISPR-Cas9 to engineer a mouse strain with a 3XFLAG-HA epitope tag inserted into the endogenous Gtsf1 coding sequence (Gtsf1KI; Fig. 2d). Because the MIWI potentiating activity was greatest in secondary spermatocytes, we prepared lysate from FACS-purified secondary spermatocytes from homozygous Gtsf1KI/KI male mice. Incubation with anti-FLAG antibody coupled to paramagnetic beads depleted the lysate of both epitope-tagged GTSF1 (Fig. 2e) and the MIWI-potentiating activity (Fig. 2f). The activity was recovered from the beads by elution with 3XFLAG peptide (Fig. 2f). In contrast, lysate from C57BL/6 secondary spermatocytes retained the MIWI-potentiating factor after incubation with anti-FLAG antibody, and no activity was eluted from the beads after incubation with FLAG peptide. Thus, GTSF1 is necessary to potentiate the catalytic activity of MIWI.
GTSF1 is also sufficient to potentiate the catalytic activity of MIWI. Adding purified recombinant GTSF1 (Extended Data Fig. 4b) to MIWI-piRISC increased the rate of target cleavage by MIWI 19–100-fold for three different piRNA sequences (Fig. 3a-c). First, the addition of 500 nM GTSF1 to MIWI programmed with an artificial, 30-nt piRNA (5 nM) caused the pre-steady-state rate (kburst) of target cleavage to increase from 0.010 min−1 to 1.5 min−1 (Fig. 3b), a rate similar to that of AGO2 (≥ 3 min−1)74, 75. Second, programming MIWI with an endogenous mouse piRNA sequence from the 9-qC-10667.1 locus (pi9) that is antisense to the L1MC transposon increased the pre-steady-state rate of cleavage of a fully complementary target RNA ∼19-fold: kburst = 0.033 min−1 for piRISC alone and 0.62 min−1 with GTSF1 added (Fig. 3c and Extended Data Fig. 5). Finally, for a 6-qF3–28913(−),8009(+) locus (pi6) piRNA that directs cleavage at a partially complementary site in the Scpep1 mRNA in diplotene spermatocytes 47, GTSF1 increased kburst 80-fold, from 0.0040 min−1 to 0.32 min−1 (Fig. 3c and Extended Data Fig. 5).
Our data suggest that GTSF1 does not promote product release or turnover: the steady-state rate (kss <0.005 min−1) of target cleavage under multiple-turnover conditions (i.e., GTSF1 >> target RNA >> MIWI) was essentially unchanged from the rate in the absence of GTSF1 (Fig. 3b). Perhaps MIWI remains bound to the cleaved products, preventing it from catalyzing multiple rounds of target cleavage. Supporting this idea, at incubation times >15 min, 3′-to-5′ exonucleases present in testis lysate degrade the uncut, full-length target RNA, but the 5′ cleavage product remains stable, consistent with its being protected by MIWI bound to its 3′ end (Fig. 1b). In vivo, product release has been proposed to be facilitated in insects and mammals by the RNA-stimulated ATPase Vasa (DDX4)88–90 and the Vasa-like protein DDX43 (ref. 91).
RNA-binding is essential for GTSF1 function
Only three known eukaryotic proteins contain CHHC zinc-fingers: the spliceosomal RNA-binding protein U11-48K, the TRM13 tRNA methyltransferase, and GTSF1 and its paralogs92. In vitro, the first zinc-finger of GTSF1 directly binds RNA; RNA binding requires four basic surface residues (R26, R29, K36 and K39)93). Potentiation of target cleavage required RNA-binding by GTSF1: purified mutant GTSF1R26A,R29A,K36A,K39A (Extended Data Fig. 4b) did not detectably increase the rate of catalysis by either MIWI or MILI (Fig. 3d–f and Extended Data Table 2), suggesting that GTSF1 must interact with RNA to function.
GTSF1 function requires PIWI-binding
In flies and mice, GTSF1 interacts with PIWI proteins through conserved aromatic residues in its central region7, 9 (Fig. 2c). Mutating these residues in the recombinant protein—W98A, W107A, and W112A for mouse GTSF1—reduced the stimulatory effect of mouse GTSF1 on MIWI in a concentration-dependent manner, supporting the idea that GTSF1 binds MIWI directly when potentiating target cleavage (Fig. 3g and Extended Data Table 2) and suggesting that W98, W107, and W112 define a conserved surface of GTSF1-that interacts with PIWI proteins. We measured the pre-steady-state catalytic rate (kburst) as a function of GTSF1 concentration. Fitting the data to a hyperbolic function revealed that GTSF1 binds MIWI piRISC >60-fold more tightly than GTSF1W98A,W107A,W112A (GTSF1: KD = 8 nM, 95% confidence interval [C.I.] = 6 – 9 nM; GTSF1W98A,W107A,W112A: KD = 500 nM, 95% C.I. = 100 – 900 nM) (Fig. 3g). Moreover, PIWI-binding appears to be the sole defect in GTSF1W98A,W107A,W112A, since the first-order rates of target cleavage by MIWI at saturating concentrations of either wild-type or mutant GTSF1 were essentially indistinguishable. (wild-type: 1.2 min−1, 95% C.I. = 0.7 – 2 min−1; mutant GTSF1: 0.8 min−1, 95% C.I. = 0.6 – 0.9 min−1).
The PIWI-stimulatory function of GTSF1 orthologs is evolutionarily conserved
GTSF1 orthologs can be found in many metazoan genomes92, suggesting that GTSF1 may potentiate target cleavage by PIWI proteins in many animals. Supporting this idea, purified recombinant Gtsf1 from the arthropod Bombyx mori (Extended Data Fig. 4b) potentiated the catalytic activity of the B. mori PIWI protein, BmSiwi (Extended Data Fig. 6b).
The structure and kinetics of EfPiwi from the sponge Ephydatia fluviatilis were recently described64. Like MIWI, EfPiwi possesses inherently weak catalytic activity, a feature common to all PIWI proteins examined to date. Although the E. fluviatilis genome is yet to be sequenced, the closely related, fully sequenced genome of Ephydatia muelleri contains a readily identifiable GTSF1 ortholog. Purified recombinant EmGtsf1 (Extended Data Fig. 4c) stimulated the single-turnover catalytic rate of EfPiwi piRISC ∼28 fold (Fig. 3h). Sponges (Porifera) are the sister group to all other animals, the Eumetazoa, having separated ∼900 Mya. Thus, the last common ancestor of all animals likely required GTSF1 to potentiate target cleavage by PIWI proteins.
The GTSF1 tandem zinc-finger domains are conserved across phyla, whereas the GTSF1 central and carboxy-terminal sequence diverges substantially between mammals and arthropods (Extended Data Table 1). For example, the sequences of the mouse and rhesus macaque first and second zinc-fingers are 100% identical, whereas their C-terminal domains share 88.5% identity. The first zinc-finger of mouse GTSF1 is 37.5% and 45.8% identical to its fly and moth orthologs, but the mouse protein shares just 8% and 8.3% identity with the central and carboxy-terminal domains of the fly and moth proteins, respectively. Consistent with the evolutionary divergence of their central and carboxy terminal domains, testis lysate from rat or rhesus macaque enhanced target cleavage by mouse MIWI piRISC, whereas lysate from Drosophila melanogaster or Trichoplusia ni ovaries, T. ni Hi5 cells, or purified recombinant Bombyx mori BmGtsf1 did not (Extended Data Fig. 4c, 5a, b and Supplementary Data Fig. 1d).
GTSF1 paralogs can distinguish among PIWI proteins within a species
Animal genomes often encode more than one GTSF protein92 (Extended Data Fig. 5c). For example, D. melanogaster has four GTSF paralogs. The D. melanogaster OSC and OSS cell lines, which derive from somatic follicle cells that support oogenesis, express Piwi but lack the PIWI paralogs Aub or Ago3. Piwi-mediated, piRNA-guided transposon silencing in these cells requires Asterix, a GTSF1 ortholog7, 8, 10. In vivo, asterix mutants phenocopy piwi mutants and are female sterile, even though Piwi is successfully loaded with piRNAs and transits to the nucleus in the absence of Asterix7, 8. Whether the other fly GTSF paralogs have a function in vivo, perhaps as auxiliary factors for Aub or Ago3, remains to be tested. Like fly Asterix, mouse GTSF1 is essential for piRNA function and fertility. In mice, two GTSF1 paralogs, GTSF1L and GTSF2 are also expressed during spermatogenesis and interact with PIWI proteins94. Unlike GTSF1, single and double Gtsf1l and Gtsf2 knockout males are fertile94. Genes encoding the Gtsf paralogs are syntenic in mammals, while Gtsf2 is lost in primates (Extended Data Fig. 6).
The central and carboxy-terminal domains of GTSF orthologs are more similar among closely related species than among GTSF paralogs within the same species (Extended Data Fig. 4b and 5c and Extended Data Table 1), further supporting the view that this domain has evolved to bind specific PIWI proteins. Consistent with this idea, mouse GTSF1, GTSF1L, and GTSF2 differ in their ability to potentiate target cleavage by MIWI and MILI. While GTSF1 accelerated target cleavage by both MIWI and MILI, purified, recombinant GTSF1L and GTSF2 (Extended Data Fig. 4b) efficiently potentiated target cleavage by MIWI but not MILI (Fig. 3d–f and Extended Data Table 2). GTSF2 was unable to detectably increase the rate of target cleavage by MILI. Although GTSF1L had a modest effect on the rate of target cleavage by MILI piRISC, this enhancement was less than one-sixteenth that provided by GTSF1 and half that of the PIWI-binding mutant GTSF1W98A,W107A,W112A (Fig. 3d–f and Extended Data Table 2). We conclude that GTSF1L and GTSF2 are specialized to potentiate target cleavage by MIWI piRISC.
Silk moth BmGtsf1-like is more similar to mouse GTSF1 than to BmGtsf1 (Extended Data Fig. 6c and Extended Data Table 1); BmGtsf1-like increased amount of target cleaved by MIWI piRISC by 2.6-fold (S.D. = 0.1; p = 0.0027 by ANOVA with Dunnett’s post-hoc test) but had no detectable effect on MILI (Extended Data Fig. 6b), further supporting the idea that the GTSF central domain determines the affinity of the protein for specific PIWI proteins. In vivo, BmGtsf1 interacts with Siwi and is required for transposon silencing and sex determination11. BmGtsf1 increased the rate of target cleavage by affinity-purified BmSiwi but not that of the other silk moth PIWI protein, BmAgo3 (Extended Data Fig. 6b).
Target cleavage by MIWI or MILI requires extensive pairing between piRNA and target
piRNA:target RNA complementarity from g2–g22 (i.e., 21 base-pairs) is required for efficient target cleavage directed by endogenous piRNAs loaded into MIWI piRISC immunoprecipitated from adult mouse testis5. However, GTSF1 does not detectably co-immunoprecipitate with MIWI piRISC from mouse testis5, 77. A requirement for 21 bp complementarity between target and guide is unprecedented among Argonaute proteins: fly Ago2 slices a target with as few as 11 contiguous base pairs95; mammalian AGO2 requires only 11 contiguous base pairs for detectable cleavage96; and the eubacterial DNA-guided DNA endonuclease TtAgo requires as few as 14 (ref. 97).
Affinity-purified MIWI, programmed with either of two different synthetic, 30 nt piRNAs, readily cleaved target RNA complementary to guide nucleotides g2–21 but not a target complementary to g2–g16 (Extended Data Fig. 7a, b). Under multiple-turnover conditions with saturating amounts of purified, recombinant GTSF1 ([GTSF1] >> [target] > [piRISC]), MIWI readily cleaved a target RNA with 19 nucleotides (g2–g20) complementary to its synthetic piRNA guide (Fig. 4a, top). The lower background of single-turnover experiments ([GTSF1] >> [piRISC] > [target]) allowed longer incubation times. Using these conditions, we could detect GTSF1-stimulated cleavage of a target RNA with as few as 15 complementary nucleotides (g2–g16; Fig. 4a, bottom). We note that the pachytene stage of meiosis in mouse spermatogenesis lasts about 175 h, and the pachytene piRNA pathway components are expressed until at least the round spermatid stage, a time interval spanning >400 h.
Guide length limits the rate of target cleavage by MIWI
In vivo, piRNAs are trimmed to a length characteristic of the PIWI protein in which they reside: ∼30 nt for MIWI and ∼26–27 nt for MILI41, 42, 87. An attractive hypothesis is that these piRNA lengths are optimal for target cleavage catalyzed by the specific PIWI protein. Our data suggest a more complex relationship between piRNA length, PIWI protein identity, and target complementarity. In the presence of GTSF1, MIWI loaded with a 30 nt piRNA and MILI loaded with a 26 nt piRNA readily cleaved a fully complementary target RNA in a 60 min reaction (Fig. 4b). By contrast, neither piRISC cleaved a target complementary to piRNA positions g2–g16 (Fig. 4a, b and Extended Data Fig. 7a, b). Similarly, MIWI loaded with a 26 nt or MILI loaded with a 26 or 21 nt guide produced little cleavage for a target complementary to positions g2–g16 although both guide lengths supported cleavage of a fully complementary target (Fig. 4b). In fact, for MIWI, a 21mer was more active than a 30 nt guide (Fig. 4b). Without GTSF1, MIWI or MILI loaded with any of these guide lengths produced little cleaved target in 60 min (Fig. 4b). Remarkably, MIWI or MILI loaded with a 16 nt guide RNA, a piRNA length not present in vivo, readily cleaved the RNA target (Fig. 4b).
GTSF1 accelerates the rate of pre-steady state target cleavage (kburst) by MIWI and MILI but has little effect on the nearly slow rate of steady-state cleavage (kss), suggesting that piRISC remains bound to its cleavage by-products (Fig. 3e). We incubated GTSF1 and MIWI—loaded with a 30, 26, 21, or 16 nt guide—with a target RNA fully complementary to each guide and measured kburst and kss (Fig. 4c). As the guide length decreased, kburst decreased and kss increased. Compared to its native 30 nt guide length, the 16 nt guide increased kss ∼9-fold and decreased kburst >50-fold. These data suggest that as the guide was shortened, the cleaved products were released more rapidly.
We estimated the binding affinity (ΔG) of the piRNA for its target using the nearest-neighbor rules for base pairing at 37°C. As the strength of the piRNA base pairing to the target increased, the rate of pre-steady-state cleavage increased (Fig. 5a), consistent with base pairing serving to extract the 3′ end of the piRNA from the PAZ domain, facilitating the transition to a more catalytically competent piRISC conformation98. Conversely, decreased base-pairing strength increased the steady-state rate of target cleavage, supporting the view that for biologically relevant piRNA lengths, product release is the rate-determining step for MIWI-catalyzed target cleavage (Fig. 5a).
Discussion
In nearly all animals, both piRNA biogenesis and piRNA function require the PIWI endoribonuclease activity. Yet purified mouse MIWI and MILI are intrinsically slow to cleave complementary target RNAs. Our data show that unlike AGO proteins, PIWI proteins require an auxiliary factor, GTSF1, to efficiently cleave their RNA targets.
The ability of GTSF1 to potentiate PIWI-catalyzed target cleavage provides a biochemical explanation for the genetic requirement for this small zinc-finger protein in the piRNA pathway. GTSF1 function requires that it bind both RNA and the PIWI protein, and differences among carboxy-terminal domains restrict individual GTSF1 paralogs to specific PIWI proteins.
We propose a testable kinetic scheme for target cleavage by MIWI (Fig. 5b, c and Extended Data Fig. 8) that incorporates the requirement for GTSF1 and the observation that a 16 nt guide changes the rate-determining step of target cleavage catalyzed by MIWI. As originally proposed for fly Ago2 (ref. 98), piRISC bound to a target is presumed to exist in two-states: one in which the piRNA 3′ end is secured in the PAZ domain and a competing, pre-catalytic conformation in which the piRNA is fully base paired to its target. Structures of Piwi-A from the freshwater sponge Ephydatia fluviatilis show that extensive pairing between a piRNA and its target induces a catalytically competent conformation in which the PAZ domain is rotated away from the piRNA 3′ end64. We propose that the PAZ-bound state is more favorable for guides bound to PIWI proteins than to AGOs, requiring a high degree of complementarity between guide and target to extract the piRNA 3′ terminus from the PAZ domain. Our data also suggest that a slow rate of product release after cleavage results directly from the extensive piRNA-target RNA complementarity required for this conformational change. A 16 nt piRNA allows MIWI more easily to assume a pre-catalytic state, perhaps because the 3′ end of the short guide cannot reach the PAZ domain. Notably, single-stranded siRNA guides as short as 14 nt allow mammalian AGO3, initially believed to have lost its endonuclease activity, to efficiently cleave RNA targets99. In golden hamsters, piRNAs bound to PIWIL1 are initially ∼29 nt long, but a shorter population of ∼23 nt piRNAs appears at metaphase II and predominates in two-cell embryos100. piRNAs bound to PIWIL3, a female-specific PIWI protein absent from mice, are ∼19 nt long in hamster and ∼20 nt in human oocytes100, 101. We speculate that these short piRNAs allow PIWIL1 and PIWIL3 to function as multiple-turnover endonucleases.
Our model proposes that GTSF1 recognizes the pre-catalytic piRISC state, facilitating a second conformational change in PIWI proteins that may occur spontaneously in AGO clade proteins. GTSF1 binding likely stabilizes the catalytically active conformation, facilitating target cleavage, but has no detectable effect on subsequent release of the cleaved products. Slow product release may be a general property of PIWI proteins: purified Ephydatia fluviatilis (freshwater sponge) PIWI similarly catalyzes only a single round of target cleavage64.
Methods
Plasmids and cell lines
Supplementary Data Table 1 provides the sequences of all oligonucleotides used. To create pScalps_Puro_EGFP, an IRES-driven EGFP was inserted downstream of the multiple cloning site and upstream of the puromycin coding sequence of the lentivirus transfer vector pScalps_Puro. MIWI cDNA was obtained from Mammalian Gene Collection (https://genecollections.nci.nih.gov/MGC/). MILI cDNA was amplified by RT-PCR from mouse testis total RNA. Gibson assembly and restriction cloning were used to clone the MILI and MIWI coding sequences into pScalps_Puro_EGFP, fusing them in-frame with N-terminal 3XFLAG and SNAP tags. Lentivirus transfer vectors were packaged by co-transfection with psPAX2 and pMD2.G (4:3:1) using TransIT-2020 (Mirus Bio) in HEK293T cells. Supernatant containing lentivirus was used to transduce HEK293T cells in the presence of 16 ug/ml polybrene (Sigma) to obtain stable PIWI-expressing cell lines. Three sequential transductions were performed to maximize recombinant protein production. The transduced cells were selected in the presence of 2 ug/ml Puromycin for two weeks, then the cells expressing the 5–10% highest EGFP fluorescence were selected by FACS (UMASS Medical School Flow Cytometry Core). Selected cells stably expressing the recombinant PIWI proteins were expanded, harvested, and cell pellets flash-frozen and stored at −80°C.
Mouse GTSF1 cDNA was synthesized at Twist Biosciences and cloned into pCold-GST (Takara Bio) bacterial expression vector by restriction cloning. GTSF1 mutants, GTSF1L, and GTSF2- expressing pCold-GST vectors were synthesized at Twist Biosciences. pIZ-FLAG6His-Siwi was described previously102. FLAG-tagged MILI and MIWI-expressing vectors were the kind gift of Shinpei Kawaoka (Kyoto University, Kyoto, Japan). MmGtsf1 cDNA was amplified by RT-PCR from mouse spermatogonial stem cell total RNA103. BmGtsf1 and BmGtsf1-like cDNAs were amplified by RT-PCR from BmN4 cell total RNA. The amplified cDNA fragment and a DNA fragment coding V5SBP were cloned into pcDNA5/FRT/TO vector (Thermo Fisher Scientific) by In-fusion cloning (Takara). The Ephydatia muelleri Gtsf1 coding sequence was obtained from 104 and cloned into bacterial expression vector pSV272 (IJM).
Mice
Generation of 3XFLAG-HA-tagged GTSF1 mice (Gtsf1KI/KI) was performed at Cyagen. The coding sequence for the tags was inserted into the endogenous locus by CRISPR-Cas9. Briefly, fertilized mouse embryos were injected with the sgRNA targeting the sequence GTCTTCCATGCTGATGGCAAAGG (PAM), a 3XFLAG-HA-tag cassette HDR donor, and Cas9 mRNA. Supplementary Data Table 1 provides the sequences of the HDR donor and oligonucleotide primers used for genotyping. Founder F0 animals were genotyped and bred to generate F1 animals carrying the germline-transmitted knock-in allele. Mice were maintained and used according to the guidelines of the Institutional Animal Care and Use Committee of the University of Massachusetts Chan Medical School (A201900331). C57BL/6J mice (RRID: IMSR_JAX:000664) were used as wild-type control, where indicated.
Recombinant protein purification
PIWI proteins
PIWI-expressing stable cells were harvested by centrifugation and stored at −80°C until lysed in 10 ml lysis buffer (30 mM HEPES-KOH, pH 7.5, 100 mM potassium acetate, 3.5 mM magnesium acetate, 1 mM DTT, 0.1% v/v Triton X-100, 20% v/v glycerol, and 1× protease inhibitor cocktail [1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride [Sigma; A8456], 0.3 μM Aprotinin, 40 μM betanin hydrochloride, 10 μM. E-64 [Sigma; E3132], 10 μM leupeptin hemisulfate]) per g frozen cells. Cell lysis was monitored by staining with trypan blue. Crude cytoplasmic lysate was clarified at 20,000 (S20) or 100,000 × g (S100) for 30 min, aliquoted, flash-frozen, and stored at −80°C. To capture PIWI proteins, clarified lysate was incubated with 20 μl Anti-FLAG M2 paramagnetic beads (Sigma) per ml of lysate for 2 h to overnight rotating at 4°C. Beads were washed five times with high salt wash buffer (30 mM HEPES-KOH, pH 7.5, 2 M potassium acetate, 3.5 mM magnesium acetate, 1 mM DTT), twice with low salt buffer (high salt wash buffer except containing 100 mM potassium acetate and 0.01% v/v Triton X-100). To assemble RISC, beads were resuspended in low salt buffer containing 100 nM synthetic guide piRNA and incubated with rotation at 37°C or room temperature for 30 min. MIWI RISC or unloaded apo-MIWI was eluted from the beads with 200 ng/ul 3XFLAG peptide in lysis buffer without 0.1% v/v Triton X-100 or protease inhibitors for 2 h at 4°C. Eluate containing PIWI piRISC was aliquoted and stored at −80°C. EfPiwi piRISC purification has been described64. AGO2 siRISC was purified using oligo-affinity purification as described105.
GTSF1, GTSF1 mutants, and GTSF1 homologs
pCold-GST GTSF-expression vectors were transformed into Rosetta-Gami 2 competent cells (Novagen). Cells were grown in the presence of 1 μM ZnSO4 at 37°C until OD600 ∼0.6–0.8, then chilled on ice for 30 min to initiate cold shock. Protein expression was induced with 0.5 mM IPTG for 18 h at 15°C. Cells were harvested by centrifugation, washed twice with PBS, and cell pellets were flash frozen and stored at −80°C. Cell pellets were resuspended in lysis/GST column buffer containing 20 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM DTT, 5% v/v glycerol, and complete EDTA-free protease inhibitor cocktail (Roche). Cells were lysed by a single pass at 18,000 psi through a high-pressure microfluidizer (Microfluidics M110P), and the resulting lysate clarified at 30,000 × g for 1 h at 4°C. Clarified lysate was filtered through a 0.2 µm low-protein binding syringe filter (Millex Durapore; EMD Millipore) and applied to glutathione Sepharose 4b resin (Cytiva) equilibrated with GST column buffer. After draining the flowthrough, the resin was washed with 50 column-volumes GST column buffer. To elute the bound protein and cleave the GST tag in a single step, 50 U HRV3C Protease (Novagen) was added to the column, the column was sealed and incubated for 3 h at 4°C, following which, the column was drained to collect the cleaved protein. The protein was diluted to 50 mM NaCl and further purified using a Hi-Trap Q (Cytiva) anion exchange column equilibrated with 20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM DTT, and 5% v/v glycerol. The bound protein was eluted using a 100–500 mM NaCl gradient in the same buffer. Peak fractions were analyzed for purity by SDS-PAGE and the purest were pooled and dialyzed into storage buffer containing 30 mM HEPES-KOH, pH 7.5, 100 mM potassium acetate, 3.5 mM magnesium acetate, 1 mM DTT, 20% v/v glycerol. To avoid precipitation of GTSF2, which has a pI = 7.3, 20 mM Tris-HCl, pH 8.8, was substituted for HEPES-KOH during purification and dialysis.
For Extended Data Fig.6b, HEK293T cells were transfected with mouse and insect GTSF1 coding sequences cloned into pcDNA5 expression vectors using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were harvested 36 h later and homogenized in lysis buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1.5 mM MgCl2, 0.15% v/v Triton X-100, 100 μg/ml RNase A (Qiagen), 0.5 mM DTT, 1× Complete EDTA-free protease inhibitor (Roche)]. After centrifugation at 17,000 × g for 20 min at 4°C, additional NaCl (0.65 M f.c.) and 1% v/v Triton X-100 (f.c.) were added to the supernatant and the lysate was incubated with Streptavidin-Sepharose High Performance (Cytiva) beads at 4°C for 1 h. The beads were washed with wash buffer [20 mM Tris-HCl (pH 7.4), 1 M NaCl, 1.5 mM MgCl2, 1% v/v Triton X-100, 0.5 mM DTT] five times and rinsed with lysis buffer without RNase A. SBP-tagged recombinant proteins were eluted with elution buffer (30 mM HEPES-KOH, pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, 2.5 mM biotin, 0.5 mM DTT).
For Figure 3h, EmGtsf1 expression vector was transformed into BL21(DE3) cells (New England Biolabs). Transformed cells were grown in LB supplemented with 1 μM ZnSO4 at 37°C until OD600 ∼0.6–0.8. The incubation temperature was lowered to 16°C and protein expression was induced by addition of 1 mM IPTG for 4 h. Cells were harvested by centrifugation and cell pellets were flash frozen in liquid nitrogen and stored at −80°C for future use. Thawed cell pellets were resuspended in lysis buffer (50 mM Tris, pH 8, 300 mM NaCl, 0.5 mM TCEP) and passed through a high-pressure (18,000 psi) microfluidizer (Microfluidics M110P) to induce cell lysis. The resulting lysate was clarified by centrifugation at 30,000 × g for 20 min at 4°C. Clarified lysate was applied to Ni-NTA resin (Qiagen) and incubated for 1 h. The resin was extensively washed with Nickel Wash Buffer (300 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, 50 mM Tris, 8). Protein was eluted in four column volumes of Nickel Elution Buffer (300 mM NaCl, 300 mM imidazole, 0.5 mM TCEP, 50 mM Tris, pH 8). TEV protease was added to the eluted protein to induce cleavage and removal of the N-terminal His6 and MBP tags. The resulting mixture was dialyzed against Hi-Trap Dialysis Buffer (300 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, 50 mM Tris, pH 8) at 4°C overnight. The dialyzed protein was then passed through a 5-ml Hi-Trap Chelating column (Cytiva) and the unbound material collected. Unbound material was concentrated and further purified by size exclusion chromatography using a Superdex 200 Increase 10/300 column (Cytiva) equilibrated in 50 mM Tris, pH 8, 300 mM NaCl, and 0.5 mM TCEP. Peak fractions were analyzed for purity by SDS-PAGE, and the purest were pooled, concentrated to 150 µM, aliquoted, and stored at −80°C.
Immunodepletion and Western Blotting
Approximately 300,000 FACS-purified Secondary Spermatocytes (Sp2) from wild-type (C57BL/6) or 3XFLAG-HA-GTSF1-expressing (Gtsf1KI/KI) mice were lysed in lysis buffer (30 mM HEPES-KOH, pH 7.5, 100 mM potassium acetate, 3.5 mM magnesium acetate, 1 mM DTT, 0.1% v/v Triton X-100, 20% v/v glycerol, and 1× protease inhibitor cocktail [1 mM 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride [Sigma; A8456], 0.3 μM Aprotinin, 40 μM betanin hydrochloride, 10 μM. E-64 [Sigma; E3132], 10 μM leupeptin hemisulfate]). Crude cytoplasmic lysate was clarified at 20,000 × g (S20) for 30 min at 4°C. The S20 protein concentration was measured using Bradford Assay. The S20 was incubated with Anti-FLAG paramagnetic beads overnight at 4°C. The supernatant was removed, and the beads washed thrice with lysis buffer but containing 1M potassium acetate (high salt wash) and then twice with lysis buffer. Bound proteins were eluted by incubation with 200 ng/ul 3XFLAG peptide for 2 h at 4°C. The extent of depletion was assayed by western blotting. Briefly, the samples were resolved on SDS-PAGE and transferred to nitrocellulose membrane (Amersham Protran 0.45 NC; Cytiva). The membrane was probed using mouse anti-FLAG antibody (Sigma, F3165; 1:1,000 in blocking buffer, Rockland Immunochemicals, MB-070) and rabbit anti-Tubulin (Cell Signaling, 2144; 1:1000) for 2 hours at room temperature. After washing 5× with TBS (+0.1% v/v Tween-20), the membrane was incubated with secondary antibodies - donkey anti-rabbit IRDye 680RD (LI-COR, 926-68073; 1:15,000) and goat anti-mouse IRDye 800CW (LI-COR, 926-32210; 1:15,000) for 30 minutes at room temperature. The membrane was washed 5× with TBS (+0.1% v/v Tween-20) and imaged using Odyssey Infrared Imaging System (LI-COR).
Northern Blotting
Northern blotting was performed as described106. Briefly, piRNA guide standards and PIWI RISCs were first resolved on a denaturing 15% polyacrylamide gel, followed by transfer to Hybond-NX (Cytiva) neutral nylon membrane by semi-dry transfer at 20 V for 1 h. Next, crosslinking was performed in the presence of 0.16 M EDC in 0.13 M 1-methylimidazole, pH 8.0, at 60°C for 1 h. The crosslinked membrane was pre-hybridized in Church’s buffer (1% w/v BSA, 1 mM EDTA, 0.5 M phosphate buffer, and 7% w/v SDS) at 45°C for 1 h. Radiolabeled, 5′ 32P-DNA probe (25 pmol) in Church’s buffer was added to the membrane and allowed to hybridize overnight at 45°C, followed by five washes with 1× SSC containing 0.1% w/v SDS. The membrane was air dried and exposed to a storage phosphor screen.
Chromatographic fractionation of the MIWI-potentiating activity
Dissected animal tissues were homogenized in lysis buffer in a Dounce homogenizer using 10 strokes of the loose-fitting pestle A, followed by 20 strokes of tight-fitting pestle B. Lysate was clarified at 20,000 × g, followed by 0.2 µm filtration to yield an S20 for further chromatographic purification. Lysates used without further purification were directly prepared in 30 mM HEPES-KOH, pH 7.5, 100 mM potassium acetate, 3.5 mM magnesium acetate, 1 mM DTT, and 20% v/v glycerol (“dialysis buffer”) with 1× protease inhibitor homemade cocktail; column fractions were dialyzed into this buffer before assaying. Protein concentration was measured using the BCA assay. Chromatography buffers were filtered prior to use.
For chromatography, lysate was prepared as described except using 30 mM HEPES-KOH, pH 7.5, 50 mM NaCl, 1 mM DTT, 5% v/v glycerol, and protease inhibitors. The lysate was applied to HiTrap SP column (Cytiva) equilibrated with the lysis buffer. The column was washed, and the bound proteins eluted stepwise using increasing NaCl concentrations. The NaCl content of the SP column fractions containing the peak MIWI-potentiating activity was adjusted to 2 M and applied to HiTrap Phenyl (Cytiva) equilibrated with column buffer containing 2 M NaCl. Bound proteins were eluted stepwise using decreasing NaCl concentrations. The peak MIWI-potentiating fractions elute from the HiTrap Phenyl column were pooled, concentrated (10 kDa MWCO Amicon Ultra filter), and applied to Superdex 200 Increase 10-300 GL size-exclusion chromatography column (bed volume ∼24 ml) equilibrated with the dialysis buffer but containing 5% v/v glycerol. The void volume (V0) of the gel filtration column was determined with blue dextran, and all fractions (0.5 ml each), starting from just before V0 to the end of the column (Vt) were assayed for MIWI potentiating activity. The molecular weight of the potentiating activity was determined relative to molecular weight markers (beta amylase, 200 kDa; alcohol dehydrogenase, 150 kDa; albumin, 66 kDa; carbonic anhydrase, 29 kDa; and cytochrome C, 12.4 kDa).
Zn2+ and Ni2+ immobilized-metal affinity chromatography
HiTrap Chelating HP (Cytiva) columns were charged with 0.1 M NiSO4 or ZnSO4, washed with water, and then equilibrated in column buffer (20 mM potassium phosphate buffer, pH 7.5, 500 mM NaCl, 0.5 mM DTT, 5% v/v glycerol). S20 testis lysate was applied to the column, the flow-through collected, and the column washed with the column buffer until absorbance at 280 nm stabilized. Bound proteins were eluted in two steps: first, with 20 mM potassium phosphate, pH 7.5, 2 M ammonium chloride, 0.5 mM DTT, 5% v/v glycerol (elution buffer 1), and, second, with 20 mM potassium phosphate, pH 7.5, 500 mM NaCl, 200 mM imidazole, pH 8.0, 0.5 mM DTT, 5% v/v glycerol (elution buffer 2). The peak of each step was dialyzed into the dialysis buffer and assayed for the ability to potentiate MIWI catalysis.
Target cleavage assays
Target RNA substrates for in vitro cleavage assays were prepared as described74, 107, 108. Briefly, piRNA target site-containing templates were amplified by PCR, in vitro transcribed with T7 RNA polymerase, purified by urea-PAGE, and radiolabeled using ɑ- 32P GTP (3000 Ci/mmol; Perkin Elmer), S-adenosyl methionine, and vaccinia virus RNA guanylyl transferase as described108. Unincorporated ɑ-32P GTP was removed using a G-25 spin column (Cytiva), and target RNA gel purified. In Extended Data Fig. 8a, target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol; Perkin Elmer) with 25 U T4 polynucleotide kinase (NEB) at 37°C for 1 h, followed by 70°C for 30 min to inactivate the kinase.
Radiolabeled target (3–100 nM f.c.) was added to purified PIWI piRISC (2–8 nM), plus ∼1 μg tissue or sorted germ cell lysate per 10 μl reaction volume or 0.5 μM (f.c.) of purified GTSF protein. At the indicated times, an aliquot of a master reaction was quenched in 4 volumes 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 25 mM EDTA, 1% w/v SDS, then proteinase K (1 mg/ml f.c.) was added and incubated at 45°C for 15 min. An equal volume of urea loading buffer (8 M urea, 25 mM EDTA) was added to the reaction time points, heated at 95°C for 2 min, and resolved by 7–10% denaturing PAGE. Gels were dried, exposed to a storage phosphor screen, and imaged on a Typhoon FLA 7000 (GE).
The raw image file was used to quantify the substrate and product bands, corrected for background. Data were fit to the reaction scheme using the burst-and-steady-state equation, Equation 1. The time-dependence of product formation corresponded to a pre-steady-state exponential burst (kburst = k2 + k3) followed by a linear steady-state phase, described by kcat, where kcat = kss = k2k3/(k2 + k3).
The affinity (KD) of wild-type or GTSF1W98A,W107A,W112A for MIWI piRISC-target ternary complex and the maximum observable rate (kpot) were estimated by measuring the pre-steady-state rate of target cleavage (kburst) of MIWI at increasing concentrations of GTSF1 (1–5,000 nM) and fitting the data to Equation 2 (ref. 109:
FLAG-Siwi, MIWI, and MILI target-cleavage assays
FLAG-tagged BmSiwi, MIWI, or MILI-expressing vectors were transfected into BmN4 cells with X-tremeGENE HP DNA Transfection Reagent (Sigma). Preparation of loading lysates and single-stranded RNA loading were as described110. After loading with synthetic guide RNAs in the cell lysate, piRISC was immunoprecipitated with anti-FLAG antibody (Sigma) conjugated to Dynabeads protein G superparamagnetic beads (Thermo Fisher Scientific). The beads were washed five times with lysis buffer containing 30 mM HEPES-KOH, pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, 0.5 mM DTT, and 0.1% v/v Empigen. Target cleavage assays were performed at 25°C for 3.5 h in 8 μl reaction containing 2.4 μl “40×” reaction mix108, 100 nM recombinant GTSF1 protein and 0.5 nM 32P cap-radiolabeled 28 nt target RNA as described24.
BmAgo3 target-cleavage assays
Naive BmN4 cells were resuspended in lysis buffer (30 mM HEPES-KOH, pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, 0.05% v/v Triton X-100, 0.5 mM DTT, 1× Complete EDTA-free protease inhibitor [Roche]) and lysed using a Dounce homogenizer. After centrifugation at 17,000 × g for at 4°C 20 min, the supernatant was incubated at 4°C for 1 h with anti-BmAgo3 antibody23 conjugated to Dynabeads protein G (Thermo Fisher Scientific). The superparamagnetic beads were washed five times with wash buffer (30 mM HEPES-KOH, pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, 0.5% v/v Empigen, 0.5% v/v Triton X-100, 0.5 mM DTT) and rinsed with lysis buffer. Target cleavage assays were performed at 25°C for 2.5 h in 8 μl reactions containing 2.4 μl “40×” reaction mix, 55 nM recombinant protein, and 0.5 nM 32P cap-radiolabeled target 1 (complementary to endogenous piRNA #1) or target 2 (complementary to endogenous piRNA #2), prepared by in vitro transcription as described111.
EfPiwi target cleavage assays
EfPiwi piRISC was purified as described64. Purified EfPiwi piRISC (100 nM f.c.) was incubated at 37°C with a 5′-32P-radiolabeled target RNA complementary to g2-g21 (10 nM f.c.) in reaction buffer composed of 20 mM Tris, pH 8.0, 100 mM NaCl, 2 mM MgCl2, 2 mM MnCl2, and 0.5 mM TCEP. Where indicated, purified Ephydatia muelleri GTSF1 (500 nM f.c.) or 0.1 mg/mL baker’s yeast tRNA were also included. Target cleavage was stopped at indicated times by mixing aliquots of each reaction with an equal volume of denaturing gel loading buffer (98% w/v formamide, 0.025% w/v xylene cyanol, 0.025% w/v bromophenol blue, 10 mM EDTA, pH 8.0). Intact and cleaved target RNAs were resolved by denaturing PAGE (15%) and visualized by phosphorimaging. Quantification of signal was performed using ImageQuant TL (GE Healthcare).
Mouse germ cell purification
Germ cells from mouse testes were sorted and purified as described16, 47. Briefly, freshly dissected mouse testes were decapsulated with 0.4 mg/ml collagenase type IV (Worthington) in 1× Gey’s balanced salt solution (GBSS) at 33°C for 15 min. The separated seminiferous tubules were treated with 0.5 mg/ml trypsin and 1 μg/ml DNase I in 1× GBSS at 33°C for 15 min. Trypsin was then inactivated by adding 7.5% v/v fetal bovine serum (FBS). The cell suspension was filtered through a 70-μm cell strainer, and cells pelleted at 300 × g at 4°C for 10 min. Cell staining was performed at 33°C for 15 min with 5 μg/ml Hoechst 33342 prepared in 1× GBSS, 5% v/v FBS, and 1 μg/ml DNase I, then the cells were treated with 0.2 μg/ml propidium iodide, followed by final pass through a 40-μm cell strainer before sorting. Sorted cells were pelleted at 100 × g for 5 min, the buffer removed, and the cell pellets flash frozen and stored at −80°C. Cell lysates were prepared as described for HEK293T cells. Protein concentration was estimated using the BCA assay, and an equal amount of total protein from each cell type was used to assay for the ability to potentiate MIWI catalysis.
Analysis of RNA-seq data
Publicly available datasets45, 112–114 were analyzed. rRNA reads were removed using Bowtie 2.2.5 with default parameters115. After rRNA removal, the remaining reads were mapped to corresponding genomes (mouse, mm10; rat, rn6; macaque, rheMac8; human, hg19) using STAR. 2.3 with default parameters that allowed ≤ 2 mismatches and 100 mapping locations (ref. 116). Mapped results were generated in SAM format, duplicates removed and translated to BAM format using SAMtools 1.8 (ref. 117). HTSeq 0.9.1 with default parameters was used to count uniquely mapping reads118 (steady-state transcript abundance was reported in reads per kilobase per million uniquely mapped reads [RPKM]).
Methylarginine analysis
Recombinant MIWI was immunopurified and resolved by electrophoresis on a 4–20% gradient SDS-polyacrylamide gel. The gel was fixed, stained with Coomassie G-250 (Simply Blue, Invitrogen), and the recombinant MIWI band excised and analyzed at the UMASS Mass Spectrometry Core. Gel slices were chopped into ∼1 mm2 pieces, 1 ml water added, followed by 20 µl 45 mM DTT in 250 mM ammonium bicarbonate. Samples were incubated at 50°C for 30 min, cooled to room temperature, then 20 µl 100 mM iodoacetamide (IAA) was added and incubated for 30 min. The solution was removed, and the gel pieces were three times washed with 1 ml water, 1 ml 50 mM ammonium bicarbonate:acetonitrile (1:1), quenched with 200 µl acetonitrile, and dried in a SpeedVac. Gel pieces were then rehydrated in 50 ul 50 mM ammonium bicarbonate containing 4 ng/µl trypsin (Promega, Madison, WI) and 0.01% proteaseMAX (Promega) and incubated at 37°C for 18 h. Supernatants were collected and extracted with 200 µl an 80:20 solution of acetonitrile: 1% (v/v) formic acid in water. Supernatants were then combined, and the peptides lyophilized in a SpeedVac and re-suspended in 25 µl 5% acetonitrile, 0.1% (v/v) formic acid and subject to mass spectrometry analysis. Data were acquired using a NanoAcquity UPLC (Waters Corporation, Milford, MA) coupled to an Orbitrap Fusion Lumos Tribrid (Thermo Fisher Scientific, Waltham, MA) mass spectrometer. Peptides were trapped and separated using an in-house 100 µm I.D. fused-silica pre-column (Kasil frit) packed with 2 cm ProntoSil (Bischoff Chromatography, DE) C18 AQ (200 Å, 5 µm) media and configured to an in-house packed 75 µm I.D. fused-silica analytical column (gravity-pulled tip) packed with 25 cm ProntoSil (Bischoff; 100 Å, 3 µm) media. Mobile phase A was 0.1 % (v/v) formic acid in water; mobile phase B was 0.1 % (v/v) formic acid in acetonitrile. Following a 3.8 µl sample injection, peptides were trapped at flow rate of 4 µl/min with 5% B for 4 min, followed by gradient elution at a flow rate of 300 nl/min from 5–35% B in 90 min (total run time, 120 min). Electrospray voltage was delivered by liquid junction electrode (1.5 kV) located between the columns and the transfer capillary to the mass spectrometer was maintained at 275°C. Mass spectra were acquired over m/z 300– 1750 Da with a resolution of 120,000 (m/z 200), maximum injection time of 50 ms, and an AGC target of 400,000. Tandem mass spectra were acquired using data-dependent acquisition (3 s cycle) with an isolation width of 1.6 Da, HCD collision energy of 30%, resolution of 15,000 (m/z 200), maximum injection time of 22 ms, and an AGC target of 50,000.
Raw data were processed using Proteome Discoverer 2.1.1.21 (Thermo Fisher Scientific), and the database search performed by Mascot 2.6.2 (Matrix Science, London, UK) using the Swiss-Prot human database (download 04/09/2019). Search parameters were: semi-tryptic digestion with up to two missed cleavages; precursor mass tolerance 10 ppm; fragment mass tolerance 0.05 Da; peptide N-terminal acetylation, cysteine carbamidomethylation, methionine oxidation, N-terminal glutamine to pyroglutamate conversion, arginine methylation and arginine demethylation were specified as variable modifications. Peptide and protein validation and annotation was done in Scaffold 4.8.9 (Proteome Software, Portland, OR) employing Peptide Prophet119 and Protein Prophet120. Peptides were filtered at 1% FDR, while protein identification threshold was set to greater than 99% probability and with a minimum of two identified peptides per protein. Only arginine modification sites detected in all three replicates from separate immunoprecipitation experiments are reported in the figure.
Statistics and reproducibility
Figs. 1b, 3, 4 and Extended Data Figs. 4a, 5c show mean ± SD for three independent trials. Figs. 2a, b, Extended Data Figs. 1a–c and 1h (three independent trials) and Figs. 2e, 2f, Extended Data Figs. 1f–g, 2b, 3a, 3c (two independent trials) and 4b, 4c show representative data. The experiments in Figs. 1c, 4, 5a, and Extended Data Figs. 1d–e, 2a, 3b, 3d–h, 5a, 7a–b were performed once. Protein sequences were aligned using Clustal Omega; unrooted tree was constructed using Randomized Axelerated Maximum Likelihood with default parameters121 and visualized in Interactive Tree of Life122.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this paper.
Data availability
All data are available from the authors upon request.
Author contributions
A.A., P.D.Z., I.J.M., and Y.T. conceived and designed the experiments. A.A., S.M.B., N.I., T.A.A., D.M.O., C.A., performed the experiments. D.M.O. and I.G. provided and analyzed the sequencing data. P.D.Z. supervised the research. A.A. and P.D.Z. wrote the manuscript. All the authors discussed the results and approved the manuscript.
Competing interests
The authors declare no competing interests.
Additional information
Supplementary information is available for this paper at .
Correspondence and requests for materials should be addressed to P.D.Z.
Acknowledgements
We are grateful to Ken-Edwin Aryee (Greiner/Bremh Lab) for providing pScalps_Puro, psPAX2, pMD2.G plasmids and for guidance on lentiviral transduction; Pei-Hsuan Wu for help with mouse testis germ cell FACS and for providing sorted cells; Katharine Cecchini for mouse tissues; Elaine Norowski (Greiner/Bremh labs) for rat testes; Kyle Orwig (University of Pittsburgh) for rhesus macaque testes; Paul Albosta and Cindy Tipping for guidance with T. ni and D. melanogaster dissection; Leemor Joshua-Tor (Cold Spring Harbor Laboratory) for sharing data prior to publication; Tiffanie Gardner for help formatting the manuscript; the UMASS Flow Cytometry and Mass Spectrometry cores; and members of the Zamore lab for discussions and comments on the manuscript. This work was supported in part by NIGMS grants R37 GM062862 and R35 GM136275 (P.D.Z.) and R35 GM127090 (I.J.M) and JSPS KAKENHI grants 18H05271 (Y.T.) and 19K06484 (N.I.).
Footnotes
New data in Figure 3H shows that the GTSF1 is unaffected by the presence or absence of tRNA.
References
- 1.↵
- 2.↵
- 3.↵
- 4.↵
- 5.↵
- 6.↵
- 7.↵
- 8.↵
- 9.↵
- 10.↵
- 11.↵
- 12.↵
- 13.↵
- 14.
- 15.
- 16.↵
- 17.
- 18.
- 19.
- 20.
- 21.
- 22.
- 23.↵
- 24.↵
- 25.
- 26.
- 27.↵
- 28.↵
- 29.
- 30.
- 31.
- 32.
- 33.
- 34.
- 35.↵
- 36.↵
- 37.
- 38.
- 39.
- 40.
- 41.↵
- 42.↵
- 43.↵
- 44.
- 45.↵
- 46.
- 47.↵
- 48.
- 49.
- 50.↵
- 51.
- 52.↵
- 53.↵
- 54.
- 55.↵
- 56.
- 57.
- 58.
- 59.↵
- 60.↵
- 61.
- 62.
- 63.
- 64.↵
- 65.↵
- 66.
- 67.
- 68.
- 69.
- 70.
- 71.↵
- 72.↵
- 73.↵
- 74.↵
- 75.↵
- 76.↵
- 77.↵
- 78.
- 79.↵
- 80.↵
- 81.↵
- 82.↵
- 83.↵
- 84.↵
- 85.↵
- 86.
- 87.↵
- 88.↵
- 89.
- 90.↵
- 91.
- 92.↵
- 93.↵
- 94.↵
- 95.↵
- 96.↵
- 97.
- 98.↵
- 99.↵
- 100.↵
- 101.↵