Abstract
During the female lifetime, the enlargement of the epithelial compartment dictated by the ovarian cycles is supported by a transient increase in the MaSC population. Notably, activation of Wnt/β-catenin signaling is an important trigger for MaSC expansion. Here, we report that the miR-424/503 cluster is a novel modulator of canonical Wnt-signaling in the mammary epithelium that exerts its function by targeting the LRP6 co-receptor. Additionally, we show that the loss of this microRNA cluster is associated with breast cancers possessing high levels of Wnt/β-catenin signaling.
Introduction
The mammary gland is a very dynamic organ that undergoes continuous tissue remodeling during the female lifetime (Macias & Hinck, 2012). Expansion and regression of the mammary epithelium dictated by the ovarian hormones involve alternating cycles of cell death and proliferation. During this process, enlargement of the epithelial compartment is supported by a transient increase in the mammary epithelial stem cell population (MaSC) (Asselin-Labat et al, 2010; Joshi et al, 2010). These cycles are tightly regulated in time and space to ensure proper organ function and avoid pathological consequences.
Numerous studies have elucidated some of the major signaling events within the mammary epithelium. For instance, TGFβ has been implicated as a negative regulator of proliferation during ductal elongation (Macias & Hinck, 2012). The induction of apoptosis via the Jak/Stat pathway as well as a number of matrix metalloproteases (MMPs) are involved in the remodeling of the mammary epithelium during involution (Watson, 2006a). RANK ligand is critical for lobuloalveologenesis (Fernandez-Valdivia et al, 2009). Importantly, canonical Wnt signaling via β-catenin has been shown to be essential for mammary gland development (Alexander et al., 2012). Specifically, paracrine Wnt-signaling mediated by multiple Wnt-ligands induces mammary epithelial expansion through its effect on MaSCs. In these cells, the expression of Wnt co-receptors LRP5 and LRP6 is the limiting factor for canonical Wnt signaling (Alexander et al, 2012; Goel et al, 2012). Remarkably, deregulation of Wnt/β-catenin signaling in the mammary gland induces pathological consequences, and hyperactivation of this pathway has been found in some aggressive breast cancer subtypes (Xu et al, 2020). Despite the above, our understanding of how canonical Wnt signaling is properly regulated to maintain mammary gland homeostasis is far from complete.
Recently, we have investigated the landscape of miRNAs expressed in the mammary epithelium and found that the miR-424(322)/503 is a TGF-β-induced regulator of involution in the mammary epithelium (Llobet-Navas et al, 2014a). This cluster expresses two microRNAs, miR-424(miR-322 in mice) and miR-503, that belong to the miR-16 family (Rissland et al, 2011). We have also described that this microRNA cluster is commonly lost in breast cancers and that miR-424(322)/503 knock-out mice develop mammary tumors over time that are promoted by pregnancy (Rodriguez-Barrueco et al, 2017). Remarkably, we noticed that tumors emerging in miR-424(322)/503-/- mice presented phenotypical characteristics found in tumors with activated canonical Wnt-signaling. Thus, we decided to investigate a potential link between the loss of miR-424/503 and the Wnt/β-catenin pathway. Here, we report that the miR-424/503 cluster is a novel modulator of the canonical Wnt signaling in the mammary epithelium that exert its function by decreasing the expression of the LRP6 co-receptor. Additionally, we also show that the loss of this miR-cluster is associated with breast cancers with hyperactivation of Wnt/β-catenin signaling.
Results and Discussion
Commonly, mammary tumors emerging in transgenic mice expressing potent oncogenes present aggressive anaplastic and metaplastic characteristics (Li et al, 2003). In the cases where some differentiated characteristics are present, these tumors tend to express defined markers of luminal or basal cancers but rarely both (Pfefferle et al, 2013). In contrast to this, we observed that tumors emerging in miR-424/503-/- mice were moderately differentiated and comprised of ducts with layers of epithelial cells showing a high nucleus-to-cytoplasm ratio and extensive fibrosis (Fig. 1A). Additionally, immunohistochemistry staining with cytokeratin (CK) markers revealed that these tumors contained a mix of both luminal and basal cell types (Supplemental Fig. S1A). As these characteristics resemble tumors with activated Wnt/β-catenin signaling we decided to investigate the staining of β-catenin as well as CK6, a marker associated with precursor cells that are found in tumors with hyperactivated canonical Wnt-signaling (Li et al., 2003). Remarkably, we found strong staining of both markers including accumulation of nuclear β-catenin in miR-424 /503-/- tumors (Fig. 1A and Supplemental Fig. S1B).
We have previously reported that the miR-424/503 locus is deleted in ∼14% of all breast cancers and that this correlates with lower expression of both miR-424 and miR-503 (Rodriguez-Barrueco et al., 2017). Thus, we reasoned that we could investigate the link between the miR-424/503 and canonical Wnt-signaling in human samples by evaluating the accumulation of β-catenin in breast cancers with deletion and/or reduced expression of the miR-cluster. For this, we analyzed the reverse phase protein arrays data (RPPA) that are available for the BRCA-TCGA data set (Cancer Genome Atlas, 2012) and which contains information regarding β-catenin expression at a protein level. In agreement with the observation in mice, both deletion and low expression of miR-424/503 were associated with accumulation of β-catenin (Fig. 1B-1C). Additionally, we performed gene set enrichment analysis to investigate whether this high level of β-catenin impacts the activity of Wnt-signaling. As expected, a significant increase of Wnt-targets was found in tumors deficient in miR-424/503 expression (Fig. 1D). Importantly, this association was confirmed when an independent breast cancer data set containing CNA and expression data for over 2,500 samples (METABRIC (Curtis et al, 2012)) was analyzed (Fig 1D). It is well known that a fraction of human breast cancers enriched in triple-negative characteristics have hyperactivation of Wnt-signaling (Pohl et al, 2017). However, alterations in signaling components that are commonly found mutated in other tumors (ex. APC, β-catenin) are rare in breast tumors (Sanchez-Vega et al, 2018). Genomics analysis has recently classified triple-negative breast cancers (TNBC) in at least four subtypes with different molecular characteristics (Lehmann et al, 2011; Lehmann et al, 2016). Remarkably, these include two subtypes (∼50% of all TNBCs), basal-like 2 (BL2) and mesenchymal (M), characterized by signatures of epithelial-mesenchymal-transition and hyperactivation of Wnt-signaling (Lehmann et al., 2011; Lehmann et al., 2016). Thus, we wondered whether deletion of miR-424/503 could be associated with these molecular subtypes. Remarkably, we found a strong association of miR-424/503 deletion with the BL2 and M subtypes (Fig. 1E).
Overall, all the above confirms that deregulation of miR-424/503 influences canonical Wnt-signaling, and that deletion of this microRNA cluster is associated with breast cancers with hyperactivation of Wnt-signaling.
In the mammary gland, Wnt/β-catenin signaling is a critical regulator of epithelial tree homeostasis (Alexander et al., 2012). During regular ovarian cycles and pregnancy, elevated hormonal level promotes secretion of Wnt-ligands in the luminal cells which in turn induces the expansion of MaSCs (Diaz-Guerra et al, 2012; Joshi et al., 2010). Expansion of MaSCs supports the enlargement of the mammary epithelial compartment. Previously, we have reported that miR-424(322)/503 is expressed at a low level in resting luminal and basal mammary epithelial subpopulations (Llobet-Navas et al., 2014a; Llobet-Navas et al, 2014b). Based on the new data connecting this cluster with Wnt-signaling we decided to look in more detail its expression in MaSCs. For this, we purified the basal, luminal, and an enriched MaSC subpopulation from 4–6-month-old WT FVB female mice in the estrus and diestrus phase; then, expression of miR-424(322) and miR-503 was assessed by QRT-PCR. In brief, non-epithelial cells were removed from single-cell suspension by incubation with CD31-, CD-45-, Ter119- and BP-1-biotin. The remaining epithelial cells were separated by FACS into two main populations, basal (EpCAMlowCD49fhi) and luminal (EpCAMhighCD49flow) (Smalley et al, 2012). Luminal cells were further subdivided in hormone receptor-positive and negative (HR+/-) by Sca1 (Ly6a/e) levels, HR-(EpCAMhighCD49flowSca-1-) and HR+ (EpCAMhighCD49flowSca-1+) (Smalley et al., 2012). Finally, a population enriched in MaSCs was purified from the basal compartment by PROCR expression, MaSC EpCAMlowCD49fhighPROCR+ (Wang et al, 2015). Remarkably, the expression of miR-424(322) was found to be up to 30-fold higher in MaSCs than in any other subpopulation during the estrus phase. However, during the expansion phase of the epithelium (diestrus), its expression was strongly reduced (Fig. 2A).
Based on the high level of expression of miR-424(322)/503 in MaSCs and its association with Wnt-signaling we reasoned that its loss may impact the number of MaSCs in the mammary gland. Thus, we compared the amount of MaSCs present in WT and KO animals. FACS-based strategies to obtain MaSCs only render enriched populations. Thus, the number of MaSCs is normally estimated by using functional assays. For this, we performed a mammary organoid assay (Zhang et al, 2016). This assay is based on the ability of MaSC and luminal precursors to form colonies when grown in matrigel suspension and functions as a surrogate marker of the number of MaSCs with repopulation ability. Here, we observed that basal-containing MaSCs (EpCAMlowCD49fhigh) from KO mice that were FACS-purified and grown in this assay consistently formed more organoids than those from age and stage-matched WT cells (Fig. 2B). As expected, the increased ability to form organoids was maintained when primary structures were disaggregated and plated again to form secondary organoids (Supplemental Fig. S2). Finally, the number of luminal precursors forming colonies observed when luminal (EpCAMhighCD49flow) cells were plated did not significantly change between WT and KO cells, indicating that the absence of miR-424(322)/503 is MaSC specific.
Next, we transitioned our studies to a tractable model where miR-cluster expression and WNT/β-catenin activation could be fully controlled, miR-cluster-Dox-MCF-10A (Llobet-Navas et al., 2014a; Llobet-Navas et al., 2014b). This is an in vitro model where the expression of miR-424/503 can be experimentally increased at will by using a doxycycline (Dox) inducible system in human basal MCF-10A cells. Additionally, these cells accumulate nuclear β-catenin and upregulate Wnt-responsive genes upon the addition of WNT-ligands (Fig. 2C-2D). Notably, upon upregulation of miR-424/503, both the accumulation of β-catenin and the upregulation of Wnt targets induced by adding WNT3a ligand into the culture media was strongly reduced (Fig. 2C-2D). This result confirms that miR-424/503 expression has a role in modulating canonical Wnt-signaling.
Generally, microRNAs exert their function by binding to a 20-22 nucleotide sequence in the 3’UTR of targeted mRNAs reducing their overall expression by multiple mechanisms (Grimson et al, 2007). Thus, to explain the impact of miR-424/503 on WNT/β-catenin signaling, we hypothesized that one or more of its targets are components of this pathway. Computational prediction of targets based on seed sequence conservation as well as non-conserved sites is a widely used strategy to identify miRNA targets. We used the TargetScan algorithm (http://www.targetscan.org), which has been shown to have one of the highest specificities in preselecting putative target genes (Shirdel et al, 2011). Notably, TargetScan identified several components that positively regulate the canonical Wnt-pathway and that could explain its activation upon miR-424/503 loss. These putative targets include Wnt-ligands, receptors, and proteins associated with signal transduction. In fact, two of these, LRP6 and TBL1XRL, were in the top 10% of the list when the putative targets were ordered based on their probability of conserved targeting score (PCT) (Fig 3A).
As MaSCs cells are sensor cells that react to Wnt-ligands, we decided to focus our studies on signaling components. Thus, we investigated the top two predicted putative targets, Lrp6 and TBL1XRL, which contain 2 and 3 conserved binding sites respectively (Fig 3A and 3B). To investigate whether these putative target genes are regulated by miR-424(322)/503, we first utilized a reporter system measuring the capacity of each predicted binding site to regulate gene expression upon experimental upregulation of miR-424 and miR-503 microRNAs. We then cloned a portion of the gene 3’UTR containing the predicted wild-type binding site downstream of a luciferase reporter gene. Next, we co-transduced 293T cells with the corresponding Luc-UTR reporter, a Renilla luciferase expression vector lacking any UTR and used for normalization purposes, and microRNA mimics corresponding to miR-424(322) and miR-503. Twenty-four hours after transfection, we quantified the expression of the Luc reporter (Fig 3B). These experiments revealed that miR-424 and miR-503 were able to significantly attenuate the expression of Luc when both conserved sites in LRP6 and 2 out of the 3 conserved sites in TBL1XR1 were cloned in the 3’UTR. The reduction in Luc expression was equivalent to the reduction observed in the positive control (CDC25A binding site) (Fig. 3B). In contrast, none of the non-conserved sites showed any effect. We also cloned the binding sites, conserved and non-conserved, from GSKIP, a predicted target that had a much lower PCT value. Notably, none of its biding sites had any effect on the expression of the reporter (Fig. 3B). To finally demonstrate that the reduction in reporter expression was mediated by the interaction between the miRNA and the targeted mRNA, we mutated the seed sequence of the binding sites (Grimson et al., 2007) to disrupt microRNA binding. As expected, this completely abrogated any reduction in reporter expression (Fig 3C).
Next, we tested if the miR-424/503 can modulate the endogenous levels of LRP6 and TBLR1. First, we used the miR-cluster-Dox-MCF-10A model. Here, upon dox induction of the microRNA cluster, western-blot studies showed a clear downregulation in LRP6 protein while a smaller effect was observed for TBLR1 (Fig. 3D). As expected, independent transduction of miR-424 and miR-503 mimics in MCF-10A cells showed that both can downregulate LRP6 (Supplemental Fig. S3). To complement our studies, we also performed loss-of-function in MCF-10A cells. For this, we blocked miRNA-424/503 with the introduction of miRNA hairpin inhibitors into cells. In agreement with the gain of function studies, we observed a clear upregulation of LRP6 while almost no effect was found for TBLR1 (Fig. 3E). Finally, we compared the expression of these putative targets in WT and KO basal-derived organoids in the presence or absence of WNT3a ligand. Again, KO cells showed higher basal expression levels of LRP6 than the WT counterpart, while no main differences were observed for TLBR1 (Fig. 3F). Overall, these results support that miR-424/503 modulates LRP6 expression, but not TLBR1.
MicroRNAs downregulate the expression of targeted genes by recruiting mRNAs to the RNA-induced silencing complex (RISC) (Grimson et al., 2007). To finally demonstrate the role of miR-424/503 on LRP6 expression, we performed additional validation using PAR-CLIP (Hafner et al, 2010). Briefly, PAR-CLIP is a biochemical assay where the RISC complex and the mRNAs being targeted are immunoprecipitated (IP) using antibodies for the RISC component AGO2. The amount of a particular mRNA bound to RISC is enriched in the IP when a microRNA that modulates its expression is experimentally upregulated. Additionally, the enrichment of RISC in a particular binding site can be determined by simple QRT-PCR. As expected, we observed a significant enrichment of LRP6 mRNA bound to RISC when the miR-cluster was induced in the miR-cluster-Dox-MCF-10A model (Fig. 3G).
Overall, our study provides compelling evidence that LRP6 is regulated by miR-424(322)/503 in the mammary epithelium and that its loss promotes upregulation of the WNT/β-catenin signaling. As LRP6 is a rate-limiting factor of the WNT/β-catenin pathway (Brennan & Brown, 2004) it is likely that LRP6 is the most significant miR-424(322)/503 target for WNT pathway regulation. We have previously shown that miR-424/503 targets genes such as IGF1R and BCL2 in the mammary epithelium and that its loss affects developmental processes (involution) and tumorigenesis (Llobet-Navas et al., 2014a; Rodriguez-Barrueco et al., 2017). The newly discovered regulation of WNT-signaling presents a clearer and more complete view of the function of this microRNA-cluster modulating mammary epithelial fate. Thus, to integrate our results with the current understanding of mammary gland development and cancer we propose the following model (Fig. 4). During regular ovarian cycles, at the diestrus phase, there is an increase in the mammary epithelial content of the mammary gland, the purpose of which is to prepare the mammary gland for a potential pregnancy. If pregnancy occurs, gland remodeling becomes widespread (Macias & Hinck, 2012). Expansion of the mammary epithelium during diestrus and pregnancy is mediated by a profound and transient increase of the MaSC pool (Asselin-Labat et al., 2010; Joshi et al., 2010; van Amerongen et al, 2012). This is due to the activation of Wnt/β-catenin signaling in MaSCs responding to RANK and WNT ligands secreted from luminal/HR+ cells (Alexander et al., 2012; Goel et al., 2012). After expansion, the mammary epithelium involutes to return to its original state; this process includes reduction of the number of MaSCs (Asselin-Labat et al., 2010). During periods of epithelial expansion, miR-424(322)/503 is reduced in MaSCs to promote Wnt/β-catenin signaling. During periods of epithelial regression miR-424(322)/503 upregulation in luminal and basal cells attenuates BCL2 and IGF1R expression inducing cell death/apoptosis (Llobet-Navas et al., 2014a; Rodriguez-Barrueco et al., 2017) and reducing Wnt/β-catenin signaling in MaSCs by targeting LRP6. Loss of miR-424(322)/503 in breast cancers (Rodriguez-Barrueco et al., 2017) and miR-KO mice sensitizes MaSCs to WNT stimuli during phases of epithelial expansion and promotes aberrant survival of mammary epithelial cells due to upregulation of BCL2 and IGF1R during periods of epithelial regression. This accumulates through the female lifetime promoting tumorigenesis (Rodriguez-Barrueco et al., 2017).
Finally, an important finding of our study is the high level of miR-424/503 deletions in TNBCs of the BL2 and M subtypes. It has been long recognized that Wnt-signaling is activated in some breast cancers, especially in the TNBC group (Lehmann et al., 2011). However, the molecular alterations linked to it have remained elusive. Thus, our study has unveiled a molecular alteration that can explain a large fraction (∼25%) of all cases.
In summary, the results presented here unveil an unknown link between the miR-424/503, the regulation of WNT-signaling, MaSC fate, and tumorigenesis.
Author Contributions
JS, and DLL conceived, designed, and supervised the research and wrote the manuscript. JS, DLL, EN, and RRB developed the experimental methodology. JY and KKY coordinated and performed the computational analysis. EN and RRB had equal contributions coordinating and performing the wet lab studies described in the text. RLW and PM contributed to the animal studies. All authors contribute to data analysis and manuscript editing and wrote different parts of the material and method section.
Declaration of Interests
The authors do not have any conflict of interest.
Supplemental Figures
Materials and Methods
Animal models
The generation of miR-424(322)/503-/- animals has been previously described (Llobet-Navas et al., 2014a; Rodriguez-Barrueco et al., 2017).
Patient data analysis
Patient data from TCGA-BRCA (Cancer Genome Atlas, 2012) consists of breast cancer samples with available whole-genome DNA copy number alterations, mRNA expression data, clinicopathological and reverse-phase protein array (RPPA) data. Patient data from METABRIC (Curtis et al., 2012) was analyzed for whole-genome DNA copy number alterations and mRNA expression data.
Cell culture
Cell lines were obtained from the American Type Culture Collection (ATCC). MCF10A cells were cultured in DMEM/Ham’s F-12 media supplemented with 1% Penicillin-Streptomycin, EGF (20 ng/ml), insulin (10 µg/ml), cholera toxin (100 ng/ml), hydrocortisone (500 ng/ml) and 5% horse serum. We cultured 293T cells in DMEM media with 1% Penicillin-Streptomycin and 10% FBS. In some cases, described in the text, Wnt3a ligand (R&D systems 5036-WN) at 100ng/ml was added to the culture. MiRNA inhibition in MCF-10A cells was achieved by transducing cells with a miRNA inhibitor against hsa-miR-424-5p and hsa-miR-503-5p (Genecopoeia #HmiR-AN0494-AM03 and #HmiR-AN0550-AM03 respectively). Control cells were generated by transducing a scrambled control (Genecopoeia #CMIR-AN0001-AM039).
miR-cluster-Dox-MCF-10A
The generation of these cells has been previously described (Llobet-Navas et al., 2014a; Rodriguez-Barrueco et al., 2017). Doxycycline was added to the media at 100ng/ml to induce the expression of miR-424/503.
RNA and protein analysis
To perform microRNA expression analysis by qRT-PCR, RNA was extracted using the miRVANA miRNA isolation Kit (Ambion #AM1561) according to manufacturer’s instructions. Reverse transcription and qPCR were performed according to the TaqMan microRNA Assay protocol and as previously described using probes for murine miR-322, miR-503, and snoRNA-202 (ThermoFisher #001076, 002456, and 001232, respectively). The thermal cycler conditions were: activation at 95°C for 10 minutes, denaturation 95°C for 15 seconds, and annealing/extension 60°C for 1 minute (repeat for 40 cycles). Ct values (2-ΔΔCT) were calculated by normalizing to an endogenous reference gene (snoRNA-202). To assess the expression of Wnt/ β-catenin target genes, total RNA was converted into cDNA using the High Capacity cDNA Reverse Transcription Kit (Roche #4368814) according to manufacturer’s instructions. Two microliters of the reverse transcription reaction were used as a template for real-time detection on a BioRad MYIQ Single-Color Real-Time PCR Detection System. For coding genes, the Real-time PCR reaction was performed with 10uL FastStart SYBR Green Master Mix (Roche #04673492001), 2 uL of complementary DNA (cDNA), and 1uL of each primer in RNAse-free water adjusted to 20uL volume reaction. The following were the thermal cycler conditions: AmpliTaq activation 95°C for 3 minutes, denaturation 95°C for 10 seconds, and annealing/extension 60°C for 30 seconds (repeat 40 times). Triplicate Ct values were further analyzed (2-ΔΔCT) by normalizing to an endogenous reference gene (GAPDH). Results are presented as the relative mRNA amount compared to the untreated samples. Primers used: GAPDH (F CATCTTCTTTTGCGTCGC, R AAAAGCAGCCCTGGTGAC), MMP7 (F GAGTGAGCTACAGTGGGAACA, R CTATGACGCGGGAGTTTAACAT), AXIN2 (F CAACACCAGGCGGAACGAA, GCCCAATAAGGAGTGTAAGGACT), LEF1 (F AGAACACCCCGATGACGGA, R GGCATCATTATGTACCCGGAAT), MYC (F TCCCTCCACTCGGAAGGAC, CTGGTGCATTTTCGGTTGTTG), TWIST1 (F GTCCGCAGTCTTACGAGGAG, R GCTTGAGGGTCTGAATCTTGCT).
Western blotting
Cells were lysed in RIPA buffer with 30 mM NaF, 1 mM Na3VO4, 40 mM β-glycerophosphate, 0.1 mM PMSF, and protease inhibitors. Protein concentrations were determined by the Protein Assay Kit (Bio-Rad #500-0006). We subjected equal amounts of proteins to SDS-PAGE and transferred them to nitrocellulose membranes (GE Healthcare #10401197). Non-specific binding was blocked by incubation with TBST plus 5% non-fat milk. We incubated the membranes with primary antibodies overnight at 4°C and with secondary HRP-conjugated antibodies (Amersham #NA9350V, #NA931V, and #NA934V) for 1 hour at room temperature. Signal was detected with SuperSignal West Pico or Dura Extended Duration Chemiluminescent Substrate (Thermo #34079 or #34076). The primary antibodies we used for these studies are: anti-β-catenin (abcam #ab2365), anti-LRP6 (Cell Signaling #3395), anti-TBLR1 (Bethyl #A300-408A), and anti-GAPDH (Cell Signaling #14C10). Quantification of western blot signal was performed using a ChemiDoc Imaging Systems and the Image Lab Software package (Bio-Rad).
Whole Mount Preparations and Immunohistochemistry
Mammary glands were fixed in formalin (Fischer #175) for immunohistochemistry (IHC) analysis. Whole-mount carmine red staining to visualize the mammary tree branching was prepared as follows: mammary glands were dissected and fixed in paraformaldehyde 4% for 1 hour. Afterward, samples were stained with carmine red (Sigma #C1022) overnight at room temperature. The next day samples were dehydrated in increasing concentrations of ethanol (70, 95, and 100%) and ultimately fixed in xylene.
Formalin-fixed paraffin-embedded samples were first heated at 100°C for 3 minutes on a heat block to melt the paraffin. Subsequently, samples were deparaffinized by serial incubations with xylene for 3 minutes, 100% EtOH for 3 minutes, 95% EtOH for 3 minutes, and distilled water for 2 minutes. Peroxidase inactivation and antigen retrieval were achieved by incubating samples in 1% H2O2 for 15 minutes at room temperature and incubating slides with citric buffer (2mM citric acid, 8mM sodium citrate) in a steamer for 30 minutes. Samples were washed twice in PBS for 5 minutes and incubated in 10% whole goat blocking serum diluted in 2% BSA-PBS for 30 minutes at room temperature. Samples were then incubated in primary antibody diluted in 2% BSA-PBS+0.01% sodium azide for 2 hours at room temperature. Antibodies were used at 1:300 Anti-Cytokeratin 18 antibody (Abcam #ab668), 1:1000 Anti-Cytokeratin 5 (Covance #PRB-160P). The remaining antibodies used were the same as for WT-blotting but used at 1:100. Samples were then washed in PBS and incubated in 1:500 biotinylated anti-Rabbit IgG made in goat diluted in 2% BSA-PBS for 30 minutes at room temperature. Afterward, samples were washed and exposed to peroxidase substrate (Vector Laboratories #PK-6100) for 30 minutes at room temperature and subsequently permeabilized with PBS-0.5% Triton. Thereafter samples were incubated in chromogen 3,3’ Diaminobenzidine (DAB) and then washed in distilled water and counterstained. Counterstaining was performed by treating samples with hematoxylin for 1 second, dipped in 1% Hydrochloric acid, and finally washed in ammonia water for 1 second. Finally, dehydration was performed by incubating samples in 95% EtOH for 2 minutes, 100% EtOH for 2 minutes, and xylene for 4-5 minutes and ultimately mounted with a coverslip.
Nuclear fractionation
NF was performed using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents and following the instructions provided by the vendor (Life Technologies # 78833).
Luciferase reporter assays
To measure the targeting activity of miR-424(322)/503, we cloned oligonucleotides corresponding to the region of the 3’UTR containing each miRNA binding site (plus 30bp upstream and downstream) downstream of the luciferase reporter in the pMIR-REPORT vector (Life Technologies #AM5795M) using restriction enzymes. For the mutagenesis, the same method was followed except that we randomly mutated the 8 base pair sequence corresponding to the miRNA seed sequence. To measure luciferase activity, 293T cells were seeded at 70% confluence in 96-well plates. 24 hours later, we co-transfected the cells with 50 ng of pMIR-REPORT constructs containing the 3’UTR sequences together with 50 ng of a Renilla housekeeping control plasmid and 100 nM of miR-424 or miR-503 mimics or a miRNA negative control (Dharmacon #C-300717-05, #C-300841-05, or #CN-001000-01-05, respectively) using the TransIT-X2 reagent (Mirus 6003). 24 hours after transfection, we measured the relative luciferase units (RLU) using the Dual-Glo Luciferase Assay System (Promega #E2949).
PAR-CLIP
The PAR-CLIP assay to measure the enrichment of miR-424(322)/503 mRNA targets bound to AGO2 was performed as described previously (Hafner et al., 2010). Briefly, cells were pretreated with 50 uM of 4-thiouridine (Sigma #T4509) overnight and crosslinked at 150mJ/cm2 at 365nm UV on ice. Cells were reconstituted in lysis buffer [2.5 mM Hepes pH 7, 50 mM NaCl, 10% glycerol, 1% Triton X-100, proteinase inhibitor (Roche #04693159001), 0.2 mM DTT and 1 U/µl RNAseOUT (Invitrogen #10777-019)]. Mild (5 U/µl) RNase-T1 (Fermentas #EN0541) digestion was performed at 22°C for 15 minutes. Immunoprecipitation was performed using A-beads (Roche #11719408001), G-beads (Roche #11719416001), and 10 µg of anti-AGO2 antibody (Abnova #H00027161-M01) overnight at 4°C. Samples were subsequently washed twice with washing buffer 1 (50 mM Tris pH 7.5, 150 mM NaCl, 0.1% NP-40 and 1 mM EDTA) at 4°C for 30 minutes, digested with RNase-T1 (20 U/µl) at 22°C for 15 minutes, washed once with washing buffer 2 (50 mM Tris pH 7.5, 500 mM NaCl and 0.1% NP-40) at 4°C for 30 minutes and finally washed twice with washing buffer 3 (50 mM Tris pH 7.5 and 500 mM NP-40) at 4°C for 30 minutes. Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C. Finally, the extract was lysed, and RNA extracted using the miRVANA miRNA isolation Kit (Ambion #AM1561) according to the instructions provided. Primer sequence used to measure LRP6 binding site (BS) enrichment in RISC by qRT-PCR: LRP6-BS1 (F TTTGTACAGAAGAAAAGGAT, R AGTTTGCAAAAATAAAACTT), LRP6-BS2 (F GAATAATGGAAGCCTCTTT, R CTAGAATCATTCCACAGGT) and LRP6-BS3 (F TACCAAGAAGATTAAACTGG, R AGATTAAAGCTTAAGGGAAA). Primers for negative/positive controls were: GAPDH (F CATCTTCTTTTGCGTCGC, R AAAAGCAGCCCTGGTGAC), B2M (F TGCTGTCTCCATGTTTGATGTATCT, R TCTCTGCTCCCCACCTCTAAGT) and CDC25A (F GCCATTCTAGGTAGGGTTTT, R CCTAGCTTTCTGTCCGATAA).
Mammary gland dissociation and FACS
The 3rd and 4th mammary glands from female mice of the specified age, genotype, and estrous cycle phase were pooled in PBS and minced followed by enzymatic digestion in DMEM/F12 media containing 2 mg/ml Collagenase A (Roche #11088793001) and 100 U/ml Hyaluronidase (Sigma #H3506) for 2 hours at 37°C. Single-cell suspensions were obtained via sequential incubations in pre-warmed 0.25% Trypsin-EDTA followed by 5 mg/ml Dispase II (Life Technologies #17105-041) in PBS with 0.1 mg/ml DNase I (Stemcell #07900), pipetting up and down at each step. Finally, cells were incubated in Red Blood Cell Lysing Buffer (Sigma #R7757) and filtered through a 40 µm cell strainer. Then epithelial cells were obtained using the EasySep Mouse Epithelial Cell Enrichment Kit II (Stemcell #19758) according to the protocol provided. The epithelial cell-enriched suspensions were incubated with the following antibodies: EpCAM-PerCP/Cy5.5, CD49f-APC, PROCR-PE, and Sca-1-BV421 (BioLegend #118220, #313616, #141504, and BD #562729, respectively) to sort the different epithelial subpopulations. To determine cell viability, we used the LIVE/DEAD™ Fixable Aqua Dead Cell Stain (ThermoFisher #L34957). Antibody incubations were performed for 15 minutes on ice before sorting the cells using a FACSAria II cell sorter (BD).
Organoid culture
FACS sorted cells were seeded into 24-well ultra-low attachment plates at a density of 5,000 or 10,000 cells/well in EpiCult-B Mouse Medium (StemCell #05610) supplemented with 5% FBS, 10 ng/ml EGF, 20 ng/ml bFGF, 4 μg/ml heparin, 5 μM Y-27632, and 5% Matrigel (Corning #354230). After 7 days in culture, the organoids were measured. For the generation of secondary organoids, the organoids were dissociated by incubating primary organoids in 0.25% Trypsin-EDTA in PBS for 5 minutes at 37°C followed by mechanical disruption with a P1000 pipette. Finally, cells were filtered using a 40 µm cell strainer to ensure a single-cell suspension and seeded them again into 24-well ultra-low attachment plates and counted the number of organoids >100 μm in diameter after 7 days as described above. In some cases, described in the text, Wnt3a ligand (R&D systems 5036-WN) at 100ng/ml was added to the culture.
Acknowledgments
This study has been partially funded by the NY-state breast cancer grant program (Peter T. Roley) (JS); by the Instituto de Salud Carlos III (ISCIII) through the projects CP17/00063 (cofounded by European Regional Development Fund (ERDF) “a way to build Europe”) and MS17/00063 (cofounded by the European Social Fund (ESF), “investing in your future”), and by the Ministerio de Ciencia, Innovación y Universidades Gobierno de España, through the projects RyC-2016-19671 and RTI2018-095611-A-I00 (DLL). Ministerio de Ciencia, Innovación y Universidades Gobierno de España, through the projects RyC-2016-19671 and RTI2018-095611-A-I00 (RRB). The National Cancer Institute (NCI) of the National Institutes of Health (NIH) under award number F31CA232691 (EN) The data in this paper were used in a dissertation as partial fulfillment of the requirements for a Ph.D. degree at the Graduate School of Biomedical Sciences at Mount Sinai.