Abstract
Metazoans have evolved various stress response mechanisms to cope with cellular stress inflicted by external and physiological conditions. The Integrated Stress Response (ISR) is an evolutionarily conserved pathway that mediates adaptation to cellular stress via the transcription factor, ATF4. Loss of function of Drosophila ATF4, encoded by the gene cryptocephal (crc), results in lethality during pupal development. The roles of crc in Drosophila disease models and adult tissue homeostasis thus remain poorly understood. Here, we report that a protein-trap MiMIC insertion in the crc locus generates a crc-GFP fusion protein that allows visualization of crc activity in vivo, and acts as a hypomorphic mutant that uncovers previously unknown roles for crc. Specifically, the crc protein-trap line shows crc-GFP induction in a Drosophila model for Retinitis Pigmentosa (RP). This crc allele renders photoreceptors more vulnerable to age-dependent retinal degeneration. crc mutant adult animals also show greater susceptibility to amino acid deprivation and reduced levels of known crc transcriptional targets. Furthermore, this mutant allele shows defects in wing veins and oocyte maturation, uncovering previously unknown roles for crc in the development of these tissues. Together, our data establish physiological and pathological functions of crc-mediated ISR in adult Drosophila tissues.
Introduction
Virtually all organisms have evolved stress response mechanisms to mitigate the impact of homeostatic imbalance. The Integrated Stress Response (ISR) pathway, conserved from yeast to humans, is one such mechanism initiated by stress-responsive eIF2α kinases. ISR pathway has been linked to the etiology of a number of human diseases including neurodegenerative disorders, diabetes, and atherosclerosis, amongst others (Chan et al. 2016; Ivanova and Orekhov 2016; Back et al. 2012; Ma et al. 2013). There is thus significant interest in better understanding the ISR signaling pathway.
Each ISR kinase responds to a different type of stress: PERK, an ER-resident kinase, responds to disruption in endoplasmic reticulum (ER) homeostasis (e.g. misfolding proteins, calcium flux); GCN2, a cytoplasmic kinase, responds to amino acid deprivation; PKR, a cytoplasmic kinase, responds to double stranded RNA, and; HRI, a cytoplasmic kinase, that responds to oxidative stress (Donnelly et al. 2013). When activated by the corresponding cellular stress, the ISR kinases phosphorylate the same downstream target: the α-subunit of the initiator methionyl-tRNA (Met-tRNAiMet) carrying complex, eIF2. Such phosphorylation of eIF2α kinases leads to decreased availability in Met-tRNAiMet resulting in lowered cellular translation (Sonenberg and Hinnebusch 2009). However, the translation of some mRNAs with unusual 5’ leader arrangements, such as the one encoding the ISR transcription factor ATF4, is induced even under such inhibitory conditions (Hinnebusch et al. 2016). ATF4 is a bZIP (basic Leucine Zipper) transcription factor that induces the expression of stress response genes, including those involved in protein folding chaperones, amino acid transporters, antioxidant genes (Back et al. 2009; Han et al. 2013; Fusakio et al. 2016; Shan et al. 2016).
The number of ISR kinases varies depending on organismal complexity, e.g. GCN2 in yeast, GCN2 and PERK in Caenorhabditis elegans (worms) and Drosophila melanogaster (flies), and all four ISR kinases in Danio rerio (zebrafish) and other higher vertebrates (Ryoo 2015; Mitra and Ryoo 2019). ATF4 remains the best-characterized transcription factor that is induced downstream of these kinases (Donnelly et al. 2013), and Drosophila has a functionally conserved ortholog referred to as cryptocephal (crc) (Fristrom 1965; Hewes et al. 2000). In addition to its well-characterized roles during cellular stress, a plethora of studies have demonstrated roles for ISR signaling components during organismal development (Pakos-Zebrucka et al. 2016; Mitra and Ryoo 2019). In Drosophila, both Gcn2 and Perk mutants survive to adulthood (Kang et al. 2017; Vasudevan et al. 2020), and the emerging adults show phenotypes in the gut, wings and female ovaries (Wang et al., 2015; Armstrong et al. 2014; Malzer et al. 2018). On the other hand, crc mutants fail to reach adulthood (Fristrom 1965; Hewes et al. 2000). The crc hypomorphic point mutant, crc1, which causes a single amino acid change, results in delayed larval development and subsequent pupal lethality (Fristrom 1965; Hewes et al. 2000; Vasudevan et al. 2020). The most striking phenotype of the crc1 mutants is the failure to evert the adult head during pupariation, along with a failure to elongate their wings and legs (Fristrom 1965; Hewes et al. 2000; Vasudevan et al. 2020; Hewes et al. 2000; Gauthier et al. 2012).
The larval and pupal lethality of known crc alleles have however limited our understanding of crc’s roles in adult tissues. crc is cytogenetically close to the widely used FRT40 element, which has impeded efforts to study this mutation using FRT-mediated mitotic clones. Here, we report that a GFP protein-trap reporter allele in the crc locus acts as a hypomorphic mutant that survives to adulthood. We use this allele to discover that loss of crc results in accelerated retinal degeneration in a Drosophila model of autosomal dominant retinitis pigmentosa (adRP), a human disease whose etiology is linked to ER stress. Adult crc mutants show increased susceptibility to amino acid deprivation, consistent with what was previously known for GCN2. Additionally, we observe several developmental defects in adult tissues, including reduced female fertility due to a block in oogenesis. We also observe wing vein defects and overall reduced wing size in both male and female crc mutants.
Results
crcGFSTF is a faithful reporter for endogenous crc levels
In seeking endogenous reporters of crc activity, we examined a “protein trap” line for crc generated as part of the Gene Disruption Project (Nagarkar-Jaiswal, DeLuca, et al. 2015; Nagarkar-Jaiswal, Lee, et al. 2015; Venken et al. 2011). The protein trap line is based on a MiMIC (Minos Mediated Integration Cassette) element inserted randomly into various regions in the Drosophila genome. The cassette can be subsequently replaced with an EGFP-FlAsH-StrepII-TEV-3xFlag (GFSTF) multi-tag cassette using recombination mediated cassette exchange. One such insertion recovered through this project is in the intronic region of the Drosophila crc locus, which has been subsequently replaced with an EGFP-FlAsH-StrepII-TEV-3xFlag (GFSTF) multi-tag cassette using recombination mediated cassette exchange (Fig. 1). The splice donor and acceptor sequences flanking the cassette ensure that the GFSTF multi-tag is incorporated in the coding sequence of most abundantly expressed crc splice isoform, crc-RA (Hewes et al. 2000), to generate a multi-tag crc fusion protein (Fig. 1). Henceforth, this crc reporter allele is referred to as crcGFSTF, with the encoded fusion protein referred to as crc-GFP.
Our lab and others have utilized acute misexpression of Rh1G69D, an ER stress-imposing mutant protein, in third instar larval eye disc tissues using a GMR-Gal4 driver (GMR>Rh1G69D) as a facile method to activate the Perk-crc pathway (Ryoo et al. 2007; Kang et al. 2015; Kang et al. 2017). We tested the utility of crcGFSTF allele as an endogenous reporter for crc levels, and found robust induction of crc-GFP in third instar larval eye discs specifically in response to misexpression of Rh1G69D protein but not control lacZ protein in the crcGFSTF/+ background (Fig. 2a, b). To validate that such induction was downstream of PERK activation by misfolding Rh1G69D, we generated Perk mutant FRT clones negatively marked by DsRed expression in the GMR compartment using ey-FLP. While control clones showed no change in the induction of crc-GFP (Fig. 2c), Perke01744 mutant clones showed a complete loss of crc-GFP in GMR>Rh1G69D eye imaginal discs (Fig. 2d). We also validated these observations in whole animal Perke01744 mutants, where we observed a complete loss of crc-GFP in GMR>Rh1G69D eye imaginal discs (Fig. S1a, b).
Since the induction of crc in response to PERK activation occurs due to eIF2α phosphorylation (Sonenberg and Hinnebusch 2009), we examined whether crc-GFP induction we observed in Fig. 2a-d similarly occurs through this mechanism. Specifically, we generated a phospho-mimetic transgenic line where the Ser51 in eIF2α is mutated to Asp51 (UAS-eIF2αS51D). We also generated a corresponding control transgenic line containing wild type eIF2α (UAS-eIF2αWT). We next expressed these transgenes in flies containing crcGFSTF. While GMR>eIF2αWT discs showed no detectable levels of crc-GFP, we found that GMR>eIF2αS51D led to robust induction of crc-GFP in eye discs as detected by immunostaining with anti-GFP (Fig. 2e, f). These data demonstrate the applicability of crcGFSTF as a reliable reporter of endogenous crc expression downstream of ISR activation.
crcGFSTF is a hypomorphic crc mutant allele
Similar to the previously characterized crc hypomorphic mutant allele, crc1, we observed that flies homozygous for crcGFSTF exhibited a delay in head eversion and showed anterior defects (Fristrom 1965; Hewes et al. 2000). To further assess the effects of the crcGFSTF allele, we performed a lethal phase analysis of development starting at the first instar larval stage. We found that a little over 50% of crcGFSTF homozygotes were larval lethal (Fig. 3a), which is remarkably similar to larval lethality we previously reported for crc1 (Vasudevan et al. 2020). However, unlike crc1 homozygotes, only a small percentage of crcGFSTF homozygotes showed prepupal and pupal lethality, with ∼30% of animals eclosing as adults (Fig. 3a). To ensure that these developmental defects cannot be attributed to background mutations in the crcGFSTF, we performed lethal phase analysis on crcGFSTF in transheterozygotic combination with the hypomorphic crc1 allele. We found that crcGFSTF/crc1 transheterozygotes showed similar levels of larval and pupal lethality to crcGFSTF homozygotes, with ∼25% of animals surviving to adulthood (Fig. 3a). These data together suggested that the crcGFSTF allele may function as a crc loss-of-function allele.
To examine if crc transcript levels are affected in crcGFSTF mutants, we performed qPCR in the wandering 3rd instar larval stage when crc activity is known to be high in fat tissues (Kang et al. 2015; Kang et al. 2017). We found that crcGFSTF homozygotes show ∼65% decrease in crc transcript levels in comparison to control animals (Fig. 3b). We also tested crc activity by measuring mRNA levels of the well-characterized crc transcriptional target, 4E-BP (Drosophila Thor). We observed ∼40% lower levels of Thor in crcGFSTF in comparison to control animals (Fig. 3b). This reduction in transcript levels of crc targets was also reproducible crcGFSTF/crc1 transheterozygotes (Fig. 3b). Taken together, these data indicate that crcGFSTF acts as a mild hypomorphic mutant allele of crc.
crc has a protective role in age-related retinal degeneration and amino acid deprivation
Nearly 30% of all adRP mutations are found in the Rhodopsin gene (Kaushal and Khorana 1994; Illing et al. 2002). Several of these Rhodopsin mutations impose stress in the ER (Kroeger et al. 2019). However, the role of ATF4 in adRP has remained unclear, and we sought to resolve this using the crcGFSTF allele in a Drosophila model of adRP.
Clinically, adRP is characterized by age-related loss of peripheral vision, resulting in ‘tunnel vision’, and night blindness due to degeneration of rod photoreceptors (Kaushal and Khorana 1994). The Drosophila genome encodes several Rhodopsin genes, including ninaE that encodes the Rhodopsin-1 (Rh1) protein. The ninaEG69D mutation captures essential features of adRP etiology: Flies bearing one copy of the dominant ninaEG69D allele exhibit the age-related retinal degeneration as seen by photoreceptor cell death (Colley et al. 1995; Kurada and O’Tousa 1995). We found that crcGFSTF/crc1; ninaEG69D/+ animals exhibited rapid retinal degeneration in comparison to crcGFSTF/+; ninaEG69D/+ control animals, as monitored by pseudopupil structures in live flies over a time course of 30 days (Fig. 4a). While the earliest time point when control animals exhibit retinal degeneration is typically 13-15 days, crc homozygous mutant animals exhibited retinal degeneration as early as 2 days, with all animals displaying loss of pseudopupil structures by day 14 (Fig. 4a). Interestingly, we also found that crcGFSTF/crc1 animals exhibited age-dependent retinal degeneration even in the absence of ninaEG69D, indicating a protective role for crc in photoreceptors under physiological conditions during aging (Fig. 4a).
To measure the expression of crc in aging photoreceptors, we performed western blotting of adult fly heads from young and old (2-week) flies to detect crc-GFP. While young control flies (crcGFSTF/+) showed very low levels of crc-GFP, flies bearing one copy of ninaEG69D showed a substantial induction of crc-GFP (Fig. 4b, c). We observed that crc-GFP increases with age in both 2-week old control flies (crcGFSTF/+), with a concomitant increase in crc-GFP in ninaEG69D/+ flies as well (Fig. 4b, c). These data substantiate the engagement of crc in photoreceptors in response to ER stress inflicted by the ER stress-imposing Rh1G69D, thus providing a basis for the protective roles of Perk in retinal degeneration.
In addition to rendering a protective effect during ER stress inflicted by Rh1G69D, we also tested if crc had an effect during amino acid deprivation in adult animals. We tested this by subjecting crcGFSTF/crc1 animals to amino acid deprivation by rearing animals on 5% sucrose-agar. While a majority of control animals survived up to 8 days, crcGFSTF/crc1 animals steadily succumbed to amino acid deprivation starting at day 2 with no survivors by day 6 (Fig. 4d). This is consistent with the idea that crc mediates the GCN2 response to amino acid deprivation in adult Drosophila.
crc mutants show wing size and vein defects
crcGFSTF provided an opportunity to examine previously unreported roles for crc in adult flies. We first observed that wings from both crcGFSTF homozygotes and crcGFSTF/crc1 transheterozygotes showed a range of venation defects (Fig. 5a-c). The Drosophila wing has five longitudinal veins (annotated L1-L5) and two cross veins, anterior and posterior, ACV and PCV respectively (Fig. 5a). Severe wing defects in crcGFSTF homozygous female and male flies were characterized by ectopic venation on L2, between L3 and L4, on L5, and also ectopic cross veins adjacent to the PCV (Fig. 5b, b’). crcGFSTF/crc1 transheterozygotes largely showed milder wing defects, characterized by ectopic venation on the PCV and on L5 (Fig. 5c, c’). We quantified these wing phenotypes in over forty animals of each sex and found that the penetrance and severity of the phenotypes were much stronger in females than in males (Fig. 5d). We also observed that crc mutant wings were smaller than in control animals (Fig. 5a-c). Quantification of wing area from animals of each sex revealed a statistically significant decrease in wing blade size in crcGFSTF and crcGFSTF/crc1 males and females (Fig. 5e). To exclude the possibility of dominant negative effects of crcGFSTF, we also tested wings from crcGFSTF/+ heterozygotes but found no wing defects in these animals (Fig. S2). It is notable that Gcn2 depletion in the wing reportedly causes venation defects (Malzer et al. 2018). Thus, our results suggest that Gcn2-mediated crc activation is involved in proper wing vein development.
crc mutants exhibit decreased fertility due to defects in oogenesis
In trying to establish a stock of crcGFSTF, we observed that when mated to each other crcGFSTF homozygotic males and females produced no viable progeny with very few of the eggs laid hatched to first instar larvae. To determine if this loss of fertility in crcGFSTF is due to loss of fertility in males, females or both, we separately mated crc mutant females to healthy control (genotype; yw) males and vice versa. We observed that while crcGFSTF and crcGFSTF/crc1 males produced viable progeny at similar rates to control yw males (data not shown), crc mutant females showed ∼50% reduction in egg laying in comparison to control females (Fig. 6a), again with very few of the eggs laid hatching to first instar larvae. Upon closer observation, we saw defects in the dorsal appendages of eggs laid by crc mutant females, with mild phenotypes such as shortening of the appendages to complete absence of one or both appendages (Fig. 6b). These data indicated that the fertility defects in crc mutants were due to the loss of crc function in female flies.
Dorsal appendages are specified and develop in the final stage of oogenesis. Each Drosophila ovary is comprised of 14-16 developing follicles called ovarioles, with germline stem cells residing at the anterior apex undergoing differentiation along the ovariole in individual egg chambers (Lobell et al. 2017). Each egg chamber represents a distinct stage in ovulation, with stage 14 representing a mature egg. To further dissect the dorsal appendage defects, we examined ovaries from crc mutant animals. We observed that ovaries from crcGFSTF and crcGFSTF/crc1 were considerably swollen in comparison to control ovaries (Fig. S3a). Several ovarioles within crc mutant ovaries showed accumulation of stage 10 egg chambers, indicative of an arrest in oogenesis (yellow arrowheads in Fig. S3a). Indeed, examination of individual ovarioles from crc mutant ovaries counterstained for actin showed that loss of crc results in an abnormal arrangement of early stage egg chambers (Fig. 6c-e). While ovarioles from control animals showed sequentially staged and spaced egg chambers culminating in mature stage 14 eggs (Fig. 6c), ovarioles from crcGFSTF and crcGFSTF/crc1 appeared to be arrested in stage 10, with improper spacing between egg chambers in earlier stages (white arrowheads, Fig. 6d, e). We quantified the number of ovarioles that displayed such arrest and found that more than half of crc mutant ovarioles (∼9) in each ovary showed stage 10 arrest in comparison to an average of 2-3 ovarioles arrested in ovaries from corresponding control animals (Fig. 6f).
To determine if the arrested egg chambers underwent subsequent cell death, we immunostained ovaries with an antibody that detects proteolytically activated (cleaved) caspase, Dcp-1 (Vasudevan and Ryoo 2016). We observed that stage 10 egg chambers from several crcGFSTF and crcGFSTF/crc1 ovarioles showed strong cleaved Dcp-1 staining (Fig. 6g-i). These data strongly suggest that the decrease in fertility in crcGFSTF and crcGFSTF/crc1 females is associated with cell death in arrested egg chambers during oogenesis.
To examine which cell types express crc in the ovary, we immunostained ovaries with GFP antibody to detect crc-GFP. However, we were unable to detect crc-GFP in this tissue (Fig. S3b, c), suggesting that crc may regulate ovulation non-autonomously. We also attempted western blotting of ovary extracts to detect crc-GFP but did not observe any detectable signal (data not shown). A previous study had suggested a non-autonomous role for fat body Gcn2 in the regulation of oogenesis (Armstrong et al. 2014). Consistent with these observations, we were able to detect high levels of crc-GFP fusion protein in adult abdominal fat tissues from crcGFSTF animals (Fig. S3d,e). These data raise the possibility that crc mediates Gcn2-signaling in fat tissues to non-autonomously regulate oogenesis.
Discussion
ISR signaling is associated with various pathological conditions, but the role of Drosophila crc in adult tissues had remained unclear. This may be in part because the cytogenetic location of crc is very close to FRT40, and therefore, attempts to study crc function using conventional genetic mosaics have been unsuccessful. Thus far, our understanding of the role of crc in adult Drosophila tissues has entirely relied on RNAi experiments. Loss-of-function mutants, however, allow for unbiased discovery of developmental phenotypes, as is exemplified in our present study where we examined the role of crc in later developmental stages, adult tissues and during aging.
Generally, ER stress-imposing proteins such as Rh1G69D are thought to activate the PERK-mediated ISR response amongst other ER stress responses (Donnelly et al. 2013). It is worth noting here that while both Drosophila and mouse models of adRP describe a protective role for Perk in retinal degeneration (Chiang et al. 2012; Athanasiou et al. 2017; Vasudevan et al. 2020), there has been conflicting evidence on the role of ATF4 in the mouse adRP model (Bhootada et al. 2016). In this study, we show that loss of crc accelerates the age-related retinal degeneration in a Drosophila model of adRP. As we have previously shown that Perk mutants similarly accelerate retinal degeneration in this model (Vasudevan et al. 2020), we interpret that crc mediates the effect of Perk in this model. Our data finds that loss of crc renders photoreceptor susceptible to retinal degeneration with age in otherwise wild type animals (solid red line, Fig. 4a). Along with our observation showing an increase in crc protein levels in older flies (Fig. 4b, c), these data indicate that photoreceptors have physiological stress that requires crc for their survival during aging.
One of the visible phenotypes in adult crc mutants is ectopic wing venation (Fig. 5). It has previously been demonstrated that Gcn2 depletion in the posterior compartment of imaginal discs results in ectopic wing vein formation (Malzer et al. 2010). The study proposed that GCN2 regulates BMP signaling by modulating mRNA translation in wing discs via eIF2α phosphorylation and 4E-BP induction. Our results are consistent with this proposal since 4E-BP is a transcription target of crc. In addition, we report here that crc loss affects wing size, a finding that has not been reported previously. Given that BMP signaling has also been extensively implicated in determining wing size (Gibson and Perrimon 2005; Shen and Dahmann 2005), it is possible that GCN2-crc signaling regulates wing size via BMP signaling. It is equally possible that GCN2-crc signaling affects tissue size through its role in regulating amino acid transport and metabolism through autonomous and non-autonomous means.
Drosophila fat body is an organ that orchestrates organismal metabolism in response to changes in nutrient availability. While wing development is not known to be sexually dimorphic, fat tissues are known to have sex-specific effects, with particularly profound effects on female fertility is in flies and in all other sexually dimorphic organisms (Valencak et al. 2017). It has been previously demonstrated that loss of crc in Drosophila larvae leads to reduced fat content and increased starvation susceptibility (Seo et al. 2009). Correlating with this, it had been found that starvation causes effector caspase activation and cell death during mid-oogenesis (McCall 2004; Hou et al., 2008; Jenkins et al., 2013). These observations prompt us to speculate that the caspase-mediated block in oogenesis in crc mutants (Fig. 6) may be due to metabolic changes in the female fat body. This hypothesis integrates well with our data showing high crc activity in adult fat tissues (Fig. S3d, e) and observations from a previous study that amino acid sensing by GCN2 in Drosophila adult adipocytes regulates germ stem cells in the ovary (Armstrong et al. 2014). However, it remains possible that crc acts autonomously in the ovary but is undetectable using our current methods (Fig. S3b, c).
In summary, our study has found utilities for the crcGFSTF allele in discovering a new role for ISR signaling in disease models and during development, and as an endogenous reporter for ISR activation.
Methods
Fly husbandry
Flies were reared on cornmeal-molasses media at 25°C under standard conditions except for retinal degeneration experiments when they were reared under constant light. All fly genotypes and sources used in the study are listed in Table S1.
Phenotype analysis
Lethal phase analysis was performed as described previously (Vasudevan et al. 2020). Right wings were severed from 1-4 day old flies and imaged using a Nikon SMZ1500 microscope outfitted with a Nikon 8MP camera with NIS-Elements software. Wing size was measured using regions of interest (ROI) feature in ImageJ software.
Female fertility was quantified by placing five 1-4 day old virgin females with five yw males in a vial containing standard media enhanced with yeast to encourage egg laying. After allowing a day for acclimatization, the flies were moved to a new vial and the number of eggs laid in a 24-hour period were counted and quantified. Eggs were imaged for Fig. 5b by placing them on an apple juice plate and captured with the Nikon SMZ1500 microscope outfitted with 8MP Nikon camera controlled by NIS elements software. Ovaries from female flies in this experiment were dissected in cold PBS and similarly imaged on apple juice plates for Fig. S3a.
qPCR analysis
Total RNA was prepared using TriZol (Invitrogen) from five wandering third instar larva, and cDNA was generated using random hexamers (Fisher Scientific) and Maxima H minus reverse transcriptase (Thermo Fisher) according to manufacturer’s protocol. qPCR was performed using PowerSYBR Green Mastermix (Thermo Fisher) using the following primers
crc-Fwd: GGAGTGGCTGTATGACGATAAC Rev: CATCACTAAGCAACTGGAGAGAA
Thor-Fwd: TAAGATGTCCGCTTCACCCA Rev: CGTAGATAAGTTTGGTGCCTCC
Rpl15-Fwd: AGGATGCACTTATGGCAAGC Rev: CCGCAATCCAATACGAGTTC
Immunostaining
Ovaries and fat bodies were dissected in cold PBS from female flies reared for 2-3 days along with yw males on standard media enhanced with yeast. Tissues were fixed in 4% PFA in PBT (0.2% Triton-X 100, 1X PBS) for 30 minutes, washed 3x with PBT, and blocked in 1% BSA, PBT for 3 hours, all at room temperature. Tissues were stained overnight at 4°C with the primary antibodies diluted in PBT, following which they were washed 3X with PBT and incubated with AlexaFluor-conjugated secondary antibodies (Invitrogen) in PBT for 3 hours at room temperature. Tissues were mounted in 50% glycerol containing DAPI.
Eye imaginal discs were dissected from wandering 3rd instar larva in cold PBS and fixed in 4% PFA in PBS for 20 minutes, following which they were washed 2x with PBS and permeabilized in 1X PBT for 20 minutes, all at room temperature. Discs were incubated in primary antibodies diluted in PBT for 2 hours, washed 3x in PBT, incubated in AlexaFluor-conjugated secondary antibodies (Invitrogen) in PBT for 1 hour and washed 3x in PBT prior to mounting in 50% glycerol containing DAPI.
Antibodies
Phalloidin-Alexa647 (1:1000, Invitrogen), chicken anti-GFP (1:500, Aves Labs), Rabbit anti-cleaved Dcp-1 (1:100, Cell Signaling), Mouse anti-4C5 for Rh1 (1:500, DSHB), Rabbit anti-eIF2α (1:500, AbCam), rabbit anti-S51 peIF2α (1:500, AbCam). All images were obtained on a Zeiss LSM 700 confocal microscope with ZEN elements software and a 20X air or 40X water lens.
Retinal degeneration
All experiments were performed in a white mutant background since crcGFSTF, crc1, and ninaEG69D, do not have eye color. 0-3 day old male flies were placed (20 animals/vial) under 1000-lumen light intensity, and their pseudopupil structures monitored under blue light at 3-day intervals for a 30-day period. Media was replaced every 3 days, and flies with disrupted pseudopupils in one or both eyes were marked as having retinal degeneration.
Western blotting
Fly head extracts were prepared from 6 severed male fly heads in 30 μl lysis buffer containing 10mM Tris HCl (pH 7.5), 150mM NaCl, protease inhibitor cocktail (Roche), 1mM EDTA, 1% SDS. Following SDS-PAGE and western blotting, proteins were detected using primary antibodies and IRDye-conjugated secondary antibodies (LI-COR) on the Odyssey system. Primary Rabbit anti-GFP (1:500, Invitrogen) and mouse anti-Tub (1:1000, DHSB).
Amino acid deprivation
0-3 day old female flies were placed (10 animals/vial) in standard media or in vials containing 5% sucrose, 2% agarose prepared in dH2O. The number of survivors was counted every 24 hours and survivors were moved to new media.
Contributions
D.V. and H.D.R. conceptualized the project, analyzed the data, and wrote the manuscript. H.K. performed all the wing phenotype analyses, G.T. executed all western blotting experiments, and D.V. performed all other experiments.
Funding
This project was supported by NIH R01 EY020866 and GM125954 to H.D.R., and K99EY029013 to D.V.
Competing Interest
None of the authors have competing interests to disclose.
Acknowledgements
We thank Hugo Bellen’s laboratory for making available the crc MIMIC RMCE line, and Drs. Lacy Barton and Lydia Grmai for discussions on the ovary phenotypes, and Drs. Erika Bach and Jessica Treisman and their laboratories for helpful discussions that improved this work. We thank the Bloomington Drosophila Stock Center (NIH P40OD018537) for supplying many of the fly stocks, and FlyBase (U41 HG000739) for curating sequence data used in this study.