ABSTRACT
AXIN family members control diverse biological processes in eukaryotes. As a scaffolding protein, AXIN facilitates interactions between cellular components and provides specificity to signaling pathways. Despite its crucial roles in metazoans and discovery of a large number of family members, the mechanism of AXIN function is not very well understood. The C. elegans AXIN homolog PRY-1 provides a powerful tool to identify interacting genes and downstream effectors that function in a conserved manner to regulate AXIN-mediated signaling. Previous work demonstrated pry-1’s essential role in developmental processes such as reproductive system, seam cells, and a P lineage cell P11.p. More recently, our lab carried out a transcriptome profiling of pry-1 mutant and uncovered the essential role of the gene in lipid metabolism, stress response, and aging. In this study, we have extended the work on pry-1 by reporting a novel interacting gene picd-1 (pry-1-interacting CABIN1 domain containing). Our findings have revealed that picd-1 plays an essential role in C. elegans and is involved in several pry-1-mediated processes including regulation of stress response and lifespan maintenance. In support of this, picd-1 expression overlaps with pry-1 in multiple tissues throughout the lifespan of animals. Further experiments showed that picd-1 inhibits CREB-regulated transcriptional coactivator homolog CRTC-1 function, which promotes longevity in a calcineurin-dependent manner. These data provide evidence for an essential role of the CABIN1 domain protein PICD-1 in mediating PRY-1 signaling in C. elegans.
INTRODUCTION
Signaling pathways confer the ability on cells to communicate with each other and with their environment. Because of their essential roles, activities of pathway components are regulated via interactions with a host of cellular factors. Scaffolding proteins such as Axin family are a group of proteins that bring together different proteins to facilitate interactions, which regulate their activity 1. Axin was initially discovered as a negative regulator of WNT-mediated signaling cascade, but subsequent work revealed a much broader role of family members in other pathways 1–3.
In the nematode C. elegans, the Axin homolog PRY-1 controls processes such as embryogenesis, neuronal differentiation, vulval development, P11.p cell fate, and seam cell development 1,4–6. More recently, work from our lab has shown that PRY-1 is also essential for lipid metabolism, stress response, and lifespan maintenance7–9. While WNT-dependent function of PRY-1, e.g., in vulval cells, involves its interactions with APR-1 (APC family) and GSK-3 (GSK3β), leading to phosphorylation of BAR-1 (β-Catenin) 4, little is understood about factors that interact with PRY-1 in non-WNT-dependent processes.
A thorough understanding of PRY-1 function not only requires identification of interacting proteins but also its downstream effectors. We earlier reported a transcriptome profiling of PRY-1, which revealed many differentially expressed genes involved in lipid regulation and aging 7. In this study, we report characterization of a novel downstream effector of pry-1 signaling, namely picd-1 that plays essential roles in regulating multiple developmental and post-developmental processes. PICD-1 shares a domain with the mammalian calcineurin-binding protein 1 (CABIN1). CABIN1 negatively regulates calcineurin signaling, the pathway known to affect a wide array of cellular functions including stress response and lifespan 10–13. Our data suggests that PICD-1 negatively regulates CREB-regulated transcriptional coactivator (CRTC) homolog, CRTC-1, function to promote longevity mediated by calcineurin signaling 14. These results form the basis of future investigations to understand the mechanism of PICD-1 function in PRY-1-mediated signaling.
RESULTS
picd-1 encodes a CABIN1 domain containing protein
During a CRISPR-based screen to isolate alleles of pry-1, we recovered a secondary mutation (gk3701) in F56E10.1, now named as picd-1 (pry-1 interacting CABIN1 domain containing, see Methods). The pry-1(gk3681); picd-1(gk3701) double mutants exhibit a significant increase in Pvl phenotype (77%, compared to 66% in pry-1 mutants alone) and pronounced protrusions that result into frequent bursting at the vulva (Table 1, Figure 1A and B). Sequence analysis of PICD-1 identified orthologs in other nematode species (Figure 1C), all of which contain a domain similar to Histone transcription regulator 3 (Hir3)/Calcineurin-binding protein (CABIN1) family members (IPR033053, https://www.ebi.ac.uk/interpro/) (Figure 1C and D). Alignments of PICD-1 with the human CABIN1 (isoform a) showed 26% (729/2853) identity and 38% (1080/2853) similarity (EMBOSS stretcher pairwise alignment tool, https://www.ebi.ac.uk/Tools/psa/). Human CABIN1 is known to be part of a histone H3.3 chaperone complex, HUCA (HIRA/UBN1/CABIN1/ASF1a) that is involved in nucleosome assembly. Likewise, Gene Ontology analysis (www.wormbase.org) identified that picd-1 is associated with the biological process ‘DNA replication-independent nucleosome assembly’ (GO:0006336) and the cellular component ‘nucleus’ (GO:0005634). Thus, picd-1 is likely to encode a nuclear protein with function in chromatin assembly and regulation of gene expression. In support of this, in silico analysis revealed that PICD-1 contains 49 amino acid residues predicted to bind DNA (http://biomine.cs.vcu.edu/servers/DRNApred/#References 15) (Table S1).
picd-1 is expressed in multiple tissues
To gain further insights into the function of picd-1, we created transgenic animals carrying picd-1p::GFP transcriptional reporter. The analysis of transgenic animals revealed GFP fluorescence during development in tissues such as pharynx, intestine, body wall muscles, hypodermis (seam cells), gonad, and vulva (Figure 2). This pattern of expression resembles that of pry-1 recently described by our group 8. As picd-1::GFP animals entered adulthood, fluorescence was localised to the intestine and certain head neurons (Figure 2) which persisted throughout the life of animals (data not shown). A broad range of picd-1 expression is also supported by previously published RNA-seq and microarray studies16,17. Overall, our expression analysis suggests that picd-1 functions in multiple tissues and may play roles in pry-1-mediated processes. Data presented in the following sections support this conclusion.
Mutations in picd-1 cause Pvl and Egl defects
In addition to using the gk3701 strain to examine mutant phenotypes, we generated a new allele bh40 that contains multiple in-frame stop codons in exon 1 (see Methods and Figure 3A and B). qPCR analysis showed that bh40 and gk3701 greatly reduce picd-1 transcript levels (Figure 3C). Interestingly, while the Pvl phenotype of pry-1(mu38) is enhanced by both alleles (Figure 1A and B), neither has an obvious impact on the Muv penetrance of pry-1(mu38) animals. In fact, the double mutants are slightly less Muv compared to the pry-1(mu38) alone (Table 1, Figure 1B), which may be due to morphogenetic defects since vulval induction is not affected by any of the picd-1 mutations (Figure 3D, Table 1). Similar phenotypes are also observed following picd-1 RNAi (Figure S1).
Phenotypic analysis of both picd-1 mutant strains revealed that animals do not show any obvious sign of sickness. Upon careful plate-level examination, we found that the gene is involved in the development of the egg laying system. While both alleles show weak Pvl phenotypes on their own, i.e., independent of pry-1 mutations, bh40 appears to be a stronger loss of function allele (gk3701: 5% Pvl and bh40: 16.7%) (Table 1). Furthermore, picd-1(bh40), but not picd-1(gk3701), animals exhibit abnormal vulval invagination (Figure 4A), indicating that defects in morphogenetic processes may contribute to enhanced Pvl phenotype of mutant animals. We also observed that the vulval morphology phenotype of bh40, but not gk3701, was dominant over pry-1(mu38) (Figure 4A). Among other defects, we observed that picd-1(gk3701) worms lay eggs normally, but picd-1(bh40) are weakly Egl (Figure S2, Video 1) and both Pvl and Egl phenotypes of picd-1(bh40) animals are enhanced when grown at 25°C (Figures 4B and S2).
Since picd-1::GFP pattern overlaps with that of pry-1 and picd-1 mutation enhances pry-1 Pvl phenotype, we examined whether pry-1 affects picd-1 expression. qPCR experiments showed that picd-1 level is drastically reduced in pry-1 mutants (Figure 4C). Overall, results described in this section lead us to conclude that picd-1 is required for the development of the reproductive system and functions genetically downstream of pry-1.
picd-1 mutations worsen the phenotypes of pry-1 mutants
We also investigated the involvement of picd-1 in other pry-1-mediated developmental and post-developmental processes. picd-1 mutants are slow growing and take longer time to reach adulthood compared to either wildtype or pry-1(mu38) animals (Figure 5A). It was found that the slower growth phenotype of pry-1 and picd-1 double mutants is significantly worse than either single mutant (Figure 5A).
Mutations in picd-1 enhance developmental defects of pry-1(mu38) animals as well that include a P lineage cell P11.p and seam cells. While 70-80% of pry-1 mutants showed an extra P12.pa cell in the place of P11.p, the phenotype was fully penetrant in picd-1(bh40); pry-1(mu38) double (Table 1). The seam cell defect in pry-1 mutants is caused by changes in asymmetric cell divisions at the L2 stage (Gleason et al 2010, Mallick et al 2019). While RNAi knockdown of picd-1 showed no obvious seam cell defect, it enhanced the phenotype of pry-1(mu38) animals (Figure 5B). Moreover, both picd-1 and pry-1 mutants exhibited defects in alae, structures that are formed by differentiated seam cells (Figure 5C) (Mallick et al 2019). These data show that picd-1 interacts with pry-1 to affect P11.p and seam cell development.
In addition to developmental defects, we observed several other post-developmental abnormalities in picd-1 mutant animals. The analysis of brood size revealed defects in picd-1(bh40) but not in picd-1(gk3701) animals (Figure 6A and B). While bh40 allele does not affect embryonic viability, it drastically enhances the low brood count and embryonic lethality of pry-1 mutants (p < 0.001) (Figure 6A-C). We also analyzed gonad morphology and oocytes and found that neither allele affects these phenotypes. Interestingly pry-1(gk3681); picd-1(gk3701) and pry-1(mu38); picd-1(bh40) double mutants showed abnormal oocytes and gonads; respectively (Figure 7A-C). More specifically, 46 +/− 6% (n=45) of pry-1(mu38); picd-1(bh40) animals lacked oocytes in the posterior gonad arm (Figure 7C and D). No such phenotype was observed in either single mutant.
picd-1 mutants are sensitive to stress and exhibit a short lifespan
We reported earlier that pry-1 plays a role in stress response maintenance 6,8. It was found that all three heat shock chaperons, i.e., hsp-4 (ER-UPR), hsp-6 (MT-UPR), and hsp-16.2 (cytosolic heat shock response, HSR) are upregulated in pry-1 mutant animals (Figure 8A). picd-1 mutants showed increased expression of two of these, hsp-4 and hsp-16.2, and the oxidative stress response gene sod-3 (Figure 8B). Consistent with these results, both pry-1 and picd-1 mutants show electrotaxis defects (Figure 8C), a phenotype observed in animals due to abnormalities in UPR signaling18.
To further investigate the stress sensitivity of animals lacking picd-1 function, we examined survivability following chemical treatments. Both gk3701 and bh40 mutants were sensitive to paraquat and tunicamycin although the effect was more pronounced following paraquat exposure (Figure 8D and E). Interestingly, bh40 did not enhance paraquat sensitivity of pry-1(mu38) animals (Figure 8F), which could be explained by significantly reduced expression of picd-1 in pry-1 mutants. Finally, as expected from bh40 being a stronger loss of function allele, the responses of picd-1(bh40) animals to chemical exposures were more pronounced than picd-1(gk3701).
Since increased stress sensitivity can affect lifespan and pry-1 mutants are short lived, we analyzed whether picd-1 plays a role in aging. The results showed that neither picd-1(gk3701) nor picd-1(RNAi) enhanced lifespan defects of pry-1 mutants (Figure 9A and B, Table 2). It may be that further knockdown of picd-1 is unable to exacerbate the phenotype of short-lived pry-1 mutant animals due to reduced picd-1 expression as mentioned above. Alternatively, it is plausible that picd-1 is not involved in lifespan maintenance. To investigate this further, we examined the lifespan of picd-1 mutant and RNAi-treated animals. The results showed that both gk3701 and bh40 alleles caused animals to be short lived. While picd-1(bh40) worms showed a significantly reduced lifespan at both 20 °C and 25 °C, such a defect was only seen at 25 °C for picd-1(gk3701) animals (Figures 9B and C, Table 2). The results are also supported by RNAi experiments. The analysis of age-associated biomarkers revealed a progressive age-associated decline in both the body bending and pharyngeal pumping rates (Figures 9E and F). Overall, the data suggest that picd-1 plays an essential role in maintaining the normal lifespan of animals.
In addition to lifespan defects, we showed earlier that PRY-1 regulates lipid metabolism7. This prompted us to analyze whether picd-1 affects lipid levels and expression of genes involved in fatty acid synthesis. The analysis of Δ9 desaturases showed that while fat-5 and fat-7 are down, fat-6 is unaffected (Figure 9G). Among the three transcription factors that regulate expression of Δ9 desaturases, nhr-80 (NHR family) is downregulated, but sbp-1 (SREBP1 homolog) levels are up (Figure 9G)19. These results suggest that picd-1 is needed for normal expression of a subset of lipid synthesis genes. We also quantified lipids by Oil Red O staining and saw no change in picd-1 mutants (Figure 9H), possibly due to functional redundancies within the fat family 20,21 and nhr family of genes19. We conclude that picd-1 is not involved in pry-1-mediated lipid regulation.
Loss of picd-1 promotes CRTC-1 nuclear localization and upregulates CRTC-1 target genes
Research in C. elegans has shown that calcineurin (a calcium-activated phosphatase) signaling promotes nuclear localization of the CREB-regulated transcriptional coactivator (CRTC) homolog CRTC-1, leading to a reduction in lifespan14. Given that human CABIN1 negatively regulates calcineurin signaling10,22, we investigated whether knocking down picd-1 could affect the subcellular localization of a translational fusion protein CRTC-1::RFP. The results revealed that RNAi knockdown of picd-1 caused nuclear localization of CRTC-1, which is consistent with short lifespan of picd-1 mutants (Figures 9C-D and 10A). Moreover, expression of two CRTC-1 responsive genes, dod-24 and asp-12 23, was found to be significantly upregulated in picd-1(bh40) mutants (Figure 10B). Altogether, the data suggest that PICD-1 inhibits CRTC-1 function to regulate the lifespan of C. elegans.
DISCUSSION
We have identified a new gene, picd-1, in C. elegans that interacts with pry-1 and plays essential roles in multiple larval and adult processes. picd-1 is predicted to encode a nuclear protein containing a conserved CABIN1 domain. In humans, CABIN1 is a member of the HUCA histone chaperone complex (HIRA/UBN1/CABIN1/ASF1a)24. The HUCA complex is implicated in diverse chromatin regulatory events where it preferentially deposits a histone variant H3.3 leading to transcriptional activation by nucleosome destabilization or transcriptional repression through heterochromatinization25. Consistent with its important role, CABIN1 is expressed broadly in all human tissues with subcellular localization in the nucleoplasm and cytoplasm26,27. Work in other systems has also uncovered homologous proteins. For example, the yeast S. cerevisiae contains Hir1p and Hir2p (both HIRA orthologs) and three proteins namely Hir3, Hpc2, and Asf1p that are orthologs of CABIN1, Ubinuclein (UBN1), and ASF1a, respectively25.
Our study provides the first genetic evidence of a CABIN1 domain-containing protein in regulating biological processes in C. elegans. Other complex components in worms include HIRA-1 (HIRA homolog), ASFL-1, and UNC-85 (both ASF1a homologs)28–30. We have shown that mutations in picd-1 lead to multiple defects such as Pvl, Egl, low brood size, developmental delay, stress sensitivity and short lifespan. Interestingly, loss of picd-1 function enhances various phenotypes of pry-1 mutants, some of which are not seen in the picd-1 mutant alone. For example, pry-1 and picd-1 double mutants are Pvl and exhibit P11.p cell fate changes. Also, picd-1 RNAi enhances seam cell defects in pry-1 mutant animals. Interestingly, mutations in picd-1 do not enhance VPC induction and Muv phenotypes of pry-1 mutants. Overall, these results suggest that picd-1 participates in a subset of pry-1-mediated processes.
We also analyzed the role of picd-1 in other PRY-1-mediated non-developmental events such as egg-laying, embryonic survivability, aging, stress response and lipid metabolism. Loss of picd-1 function worsened the embryonic lethality of pry-1 mutants. Moreover, pry-1; picd-1 double mutants have very low brood size due to defects in gonad arms. Similar phenotypes are seen in mutants of other HIRA complex components. Thus, knockdown of hira-1 leads to embryonic lethality, asfl-1 or unc-85 single mutants have low brood size, and asfl-1; unc-85 double mutants are sterile29–31. Together, these data show that pry-1 and picd-1 interact to regulate embryonic viability and fertility of animals. However, it remains to be seen whether PRY-1 and PICD-1 interact with other HIRA complex components to mediate their function.
Among other roles, we found that picd-1 is needed for normal stress response maintenance. Specifically, picd-1 mutants show enhanced sensitivity to paraquat and tunicamycin. Consistent with this, mutant animals exhibit increased levels of UPR markers. Both the picd-1 and pry-1 mutants significantly increase hsp-16.2, and hsp-4, suggesting that the genes are involved in regulating ER-UPR and HSR. More work is needed to determine whether the two genes uniquely affect MT-UPR and oxidative stress, and their biological significance.
Mutants that show sensitivity to stress are often short lived32–34. The analysis of lifespan phenotype revealed that similar to pry-1 mutants, picd-1(bh40) animals are short lived and exhibit defects in age-related physiological markers, which is consistent with both genes functioning together to regulate stress response and aging. However, there are functional differences between them. For example, lipid levels are greatly reduced in pry-1 mutants but unaffected in picd-1 mutants. We found that nhr-80 and fat-7 levels are reduced in picd-1 mutant animals, which is consistent with the known role of nhr-80 regulating fat-7 expression21. Overall, while picd-1 is needed for normal expression of fat-5, fat-7 and nhr-80, a lack of its function does not compromise lipid levels in animals. The differences between pry-1 and picd-1 with respect to lipid regulation suggest that picd-1 participates only in a subset of pry-1-mediated processes. However, to what extent the two genes interact in specific tissues and the precise nature of their interactions is unknown.
A possible mechanism of picd-1 function in lifespan maintenance may utilize calcineurin. AMPK and calcineurin modulation of CRTCs is conserved in mammals and C. elegans14. In C. elegans, AAK-2 and calcineurin regulate CRTC-1 post-translationally in an opposite manner, where activated AAK-2 causes nuclear exclusion of CRTC-1 and extends lifespan. Such a phenotype is also seen after deactivating calcineurin14. Our data shows that loss of picd-1 function causes nuclear localization of CRTC-1 and activates the expression of crtc-1 target genes. These findings together with the fact that mammalian CABIN1 inhibits calcineurin-mediated signaling10,22,35, suggests that PICD-1 may regulate CRTC-1 via downregulation of calcineurin in C. elegans. As the loss of picd-1/CABIN-1 should lead to increased calcineurin signaling, this may explain the shorter lifespan of picd-1 mutants. Given that picd-1 is downregulated in pry-1 mutants, and both genes are needed to delay aging and confer stress resistance, it suggests that pry-1 and picd-1 may interact to maintain stress response and lifespan of animals. There are many unanswered questions, for example, whether picd-1 is regulated by pry-1 in a Wnt dependent manner during aging and if such a mechanism involves pop-1, as well as if both stress response and lifespan processes are regulated by a common set of genes acting downstream of pry-1 and picd-1. Additionally, it is unclear if other HUCA complex components regulate lifespan and stress response by utilizing PICD-1 and PRY-1. Further work is needed to investigate these questions and to gain a deeper understanding of conserved mechanisms involving AXIN and CABIN1 function in eukaryotes.
MATERIALS AND METHODS
Worm strains
Animals were maintained at 20 °C on standard nematode growth media (NGM) plates seeded with OP50 E. coli bacteria.
N2 (wild-type C. elegans)
DY220 pry-1(mu38)
VC3710 pry-1(gk3682)
VC3709 pry-1(gk3681); picd-1(gk3701)
DY725 pry-1(mu38); picd-1(bh40)
DY678 bhEx287[pGLC150(picd-1p::gfp) + myo-3::wCherry]
DY698 picd-1(bh40)
DY694 picd-1(gk3701)
RG733 wIs78[(scm::GFP) + (ajm-1p::GFP)]
AGD418 uthIs205[crtc-1p::CRTC-1::RFP::unc-54 3’ UTR + rol-6(su1006)]
Mutant allele generation
The gk3701 allele that was created during the process of creating a CRISPR mutant of pry-1, removes 5bp (GGTGA) (flanking 25 nucleotides: GTGAAGAGGATGAGGACAATGGTGA and GGATTCAGAAGAAGAAGATGAAGAA) of the second exon. This frameshift mutation leads to a premature stop codon in the second exon followed by multiple consecutive stop codons (See primers used in Table S2).
The allele bh40 was created using the Nested CRISPR technique36. Here we replaced 84bp of the first exon with a sequence containing multiple stop codons both in frame and out of frame of the coding transcript (See primers used in Table S2). Both mutants have been out crossed twice with the wildtype N2 animals and sequence confirmed.
RNAi
RNAi mediated gene silencing was performed using a protocol previously published by our laboratory37. Plates were seeded with Escherichia coli HT115 expressing either dsRNA specific to candidate genes or empty vector (L4440). Synchronized gravid adults were bleached, and eggs were plated. After becoming young adult animals were analyzed for vulva or seam cell phenotype.
Fluorescent microscopy
Animals were paralyzed in 10mM Sodium Azide and mounted on glass slides with 2% agar pads and covered with glass coverslips for immediate image acquisition using Zeiss Apotome microscope and software.
Vulval induction, P12.pa, body bending, and pharyngeal pumping
Vulva phenotype in L4 stage animals was scored using a Nomarski microscope. VPCs were considered as induced if they contained progeny. Three VPCs are induced in Wild-type (N2) animals. Mutants carrying more than 3 induced VPCs were termed as ‘over-induced’. Muv and Pvl phenotypes were scored in adults.
P12.pa cell fates were quantified in L4 stage animals. Wild-type (N2) larvae have one P11.p and P12.pa cells. In pry-1 mutants, two P12.pa-like cells are observed and P11.p is missing.
Rate of body bending per 1 min and the rate of pharyngeal pumping per 30 sec for adults were analyzed over the period of 4 days6. Hermaphrodites were analyzed for these phenotypes under the dissecting microscope in isolation on OP50 plates. Pharyngeal pumping was assessed by observing the number of pharyngeal contractions for 30 sec. For body bending assessment, animals were stimulated by tapping once on the tail of the worm using the platinum wire pick where one body bend corresponded to one complete sinusoidal wave of the worm. Only animals that moved throughout the duration of 1 min were included in the analysis.
Lifespan analysis
Lifespan experiments were done following adult specific RNAi treatment using a previously described protocol8. Animals were grown on NGM OP50 seeded plates till late L4 stage after which they were transferred to RNAi plates. Plates were then screened daily for dead animals and surviving worms were transferred every other day till the progeny production ceased. Censoring was done for animals that either escaped, burrowed into the medium, showed a bursting of intestine from the vulva or underwent bagging of worms (larvae hatches inside the worm and the mother dies)38.
Stress assay
Oxidative (paraquat) and endoplasmic reticulum mediated stress (tunicamycin) stress experiments were performed using 100mM paraquat (PQ) (Thermo Fisher Scientific, USA) and 25ng/μL tunicamycin (Sigma-Aldrich, Canada) respectively. Animals were incubated for 1hr, 2hr, 3hr and 4hr, following the previous published protocol6. All the final working concentrations were made in M9 instead of water. At least 30 animals were tested for each strain in each replicate. Mean and standard deviation were determined from experiments performed in duplicate. Animals were considered dead if they had no response following a touch using the platinum wire pick and showed no thrashing or swimming movement in M9. Moreover, dead animals usually had an uncurled and straight body shape in comparison to the normal sinusoidal shape of worms.
Oil Red O staining
Neutral lipid staining was done on synchronized day-1 adult animals using Oil Red O dye (Thermo Fisher Scientific, USA) following the previously published protocol9. Quantification was then done using ImageJ software as described previously39.
Molecular Biology
RNA was extracted from synchronized L3 and day-1 adult animals. Protocols for RNA extraction, cDNA synthesis and qPCR were described earlier7. Briefly, total RNA was extracted using Trizol (Thermo Fisher, USA), cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad, Canada). Primers used for qPCR experiments are listed in Table S1.
Statistical analyses
Statistics analyses were performed using GraphPad prism 9, SigmaPlot software 11, CFX Maestro 3.1 and Microsoft Office Excel 2019. For lifespan data, survival curves were estimated using the Kaplan- Meier test and differences among groups were assessed using the log-rank test. qPCR data was analyzed using Bio-Rad CFX Maestro 3.1 software. For all other assays, data from repeat experiments were pooled and analyzed together and statistical analyses were done using GraphPad Prism 9. p values less than 0.05 were considered statistically significant.
AUTHORS CONTRIBUTIONS
AM initially characterized picd-1 mutants and generated many reagents for the study. AM, SM and SKBT performed several experiments. AM, SKBT, and BG analyzed data. BG supervised the study.
ACKNOWLEDGEMENT
We thank Hannan Minhas for his help with the electrotaxis experiments and Wouter van den Berg for his help during the screening of CRISPR mutant allele picd-1(bh40). This work was supported by NSERC Discovery grant to BG and NSERC CGS-D scholarship to AM. Some of the strains were obtained by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
Footnotes
Email: Avijit Mallick mallia1{at}mcmaster.ca, Shane K. B. Taylor taylos49{at}mcmaster.ca, Sakshi Mehta mehtas11{at}mcmaster.ca, Bhagwati P Gupta guptab{at}mcmaster.ca