Abstract
Cilia are essential for the ontogeny and function of many tissues, including the kidney. In mammals, Esrrγ has been previously established as a significant determinant of renal health, with decreased expression linked to age related dysfunction, cyst formation, and kidney disease. Here, we report that the Esrrγ vertebrate ortholog estrogen related receptor gamma a (esrrγa) is essential for proper cell fate choice within kidney functional units (nephrons) as well as ciliogenesis. Deficiency of esrrγa resulted in nephrons with alterations in proximodistal segmentation and a decreased multiciliated epithelial cell populace. Surprisingly, esrrγa deficiency disrupted renal ciliogenesis and caused a similar abrogation within the developing node and otic vesicle—all defects that occurred independently of changes in cell polarity or basal body organization. These phenotypes were consistent with interruptions in prostaglandin signaling, and we found that ciliogenesis was rescued in esrrγa deficient embryos with exogenous PGE2 or through overexpression of the cyclooxygenase enzyme Ptgs1. Through genetic interaction studies, we found that peroxisome proliferator-activated receptor gamma, coactivator 1 alpha (ppargc1a), which acts upstream of Ptgs1-mediated prostaglandin synthesis, has a synergistic relationship with esrrγa in the ciliogenic pathway. These data position esrrγa as a novel link between ciliogenesis and nephrogenesis through regulation of prostaglandin signaling and cooperation with ppargc1a, and highlight esrrγa as a potential new target for future ciliopathic treatments.
Introduction
Cilia are specialized surface organelles that are present on nearly every vertebrate cell where they serve critical functions including mechano- and chemo- sensing. In the case of motile cilia, primary cilia or multiciliated cells (MCCs) can facilitate fluid propulsion. During development, cilia are essential for the establishment and maintenance of planar cell polarity and organization of essential signaling molecules. For example, aberrant ciliogenesis results in disease states of several tissues, including the kidney, liver, pancreas, retina, and central nervous system (Pazour et al., 2019). Cilia defects have been linked to kidney disorders like polycystic kidney disease, Bardet-Biedl syndrome, Joubert syndrome, and many others (McConnachie et al., 2020). Etiologies for these conditions are varied, but many have been linked to mutations in a variety of specialized ciliary proteins. Production and maintenance of healthy cilia also require proper control of the ciliogenic transcriptional program. Such regulators include the RFX family of transcription factors, which are essential for both primary and motile cilia formation, and interactions with Foxj1 that can further regulate the development of motile cilia (Thomas et al., 2010). Furthermore, the hepatocyte nuclear factor 1B (HNF1B) regulates several ciliary genes, thereby contributing to kidney development and/or disease progression (Clissold et al., 2015, Gresh et al., 2004, Heisberger et al., 2005, Naylor et al., 2014, Sander et al., 2019, Thomas et al., 2010).
Recent studies have identified additional genetic networks that influence cilia formation. Among these, peroxisome proliferator-activated receptor (PPAR) gamma, coactivator 1 alpha (ppargc1a, known as PGC1α in mammals) regulates the ciliogenic program, in part, through control of prostanoid production (Chambers et al., 2018, Chambers et al., 2020). ppargc1a induces the biosynthesis of prostaglandin E2 (PGE2) by promoting the expression of prostaglandin- endoperoxide synthase 1 (ptgs1, also known as cyclooxygenase 1 (cox1)) in both the adult mammalian kidney and zebrafish embryonic kidney (Chambers et al., 2020, Tran et al., 2016). In turn, PGE2 is required for proper ciliary outgrowth by modulating intraflagellar transport (Jin et al., 2014). Interestingly, ppargc1a expression and PGE2 production are required for nephrogenesis, where they are involved in the pattern formation of nephron tubule segments and mitigate the fate choice between MCC and transporter cell lineages within these segments (Chambers et al., 2018, Chambers et al., 2020, Marra et al., 2019a, Poureetezadi et al., 2016).
Interestingly, ESRRγ, an orphan nuclear receptor, has been found to interact with both HNF1B and PGC1α in multiple contexts. ESRRγ and HNF1B cooperate in the regulation of mitochondrial function and proximal kidney cell development (Sander et al., 2019, Zhao et al., 2018). Similarly, ESRRγ and PGC1α bind common hormone response elements in kidney cells, and work synergistically in mitochondrial biogenesis (Liu et al., 2005, Fan et al., 2018, Wang et al., 2008). Phenotypes observed in Esrrγ knockout models further support its role in the regulation of energy production, as tissues with high energy demand, including the heart and kidney, are dysregulated. Specifically, Esrrγ knockout mice die soon after birth due to cardiac defects, and the renal tissue of these mice exhibits decreased ureteric branching (Alaynick et al. 2007, Berry et al., 2011). Furthermore, the kidney specific Esrrγ murine knockout results in kidney cysts and renal dysfunction (Zhao et al., 2018). Collectively, these phenotypes suggest that Esrrγ may play multiple roles in kidney and cilia development, yet neither analysis of nephron composition nor cilia formation has been reported to date.
Here, we report that esrrγa is necessary for proper nephron segmentation and ciliogenesis. In the zebrafish embryonic kidney, or pronephros, we found that deficiency of esrrγa resulted in segment patterning defects that included a decreased number of MCCs. Cilia projecting from MCCs and primary epithelial cells were also significantly shortened in both renal and non-renal populations within esrrγa deficient animals. These characteristics were strikingly reminiscent of insufficient prostaglandin signaling during development, and indeed we found that esrrγa ciliopathic phenotypes were rescued by supplementation of PGE2 or transcripts encoding the biosynthesis enzyme Ptgs1. Additionally, we discovered a synergistic genetic interaction between esrrγa and ppargc1a that is essential for renal cila formation. These findings provide fundamental new insights about the regulatory networks that direct ciliogenesis and renal development.
Results
esrrγa is expressed in renal progenitors
Prior research has demonstrated that Esrrγ is expressed in the mouse and human kidney, with particularly high expression profiles in the loop of Henle (RID: N-GK5G, 2-5CE6, 2-5CEA, 16- 5WSW) (Harding et al., 2011, Lindstrom et al., 2020, McMahon et al., 2008). Due to evolutionary whole genome duplication events, zebrafish have two homologs for Esrrγ—esrrγa, and esrrγb (Thome et al., 2014). Of these, only esrrγa is specifically expressed in a pattern consistent with its localization to renal progenitors and is later the distal nephron region, while esrrγb is not spatially restricted through early developmental stages (Bertrand et al., 2007, Thisse and Thisse, 2008).
To further assess the expression of esrrγa during pronephros ontogeny, we performed whole mount in situ hybridization (WISH) in wild-type (WT) embryos. Since renal progenitors are patterned into distinct segments by the 28 ss (Figure 1A), we assessed esrrγa expression between the 5 and 28 somite stage (ss). Transcripts were detected in the bilateral stripes of renal progenitors at the 8 ss, and continued to be expressed in nephron distal tubule segments at the 28 ss (Figure 1B, Supplement 1D). Fluorescent in situ hybridization at the 20 ss revealed that esrrγa transcripts colocalize with the essential kidney transcription factor pax2a, as well as nephron marker cdh17 at the 28 ss (Figure 1B). Given this expression pattern throughout nephron development, we hypothesized that esrrγa may have roles in segment patterning and/or cellular differentiation.
esrrγa is required for nephron segmentation
In the developing mouse kidney, Esrrγ knockout disrupts branching morphogenesis, renal papilla formation, and causes perinatal lethality; additionally, kidney specific Esrrγ deficiency results in renal cyst formation (Berry et al., 2011, Zhao et al., 2018). To interrogate the function of esrrγa during zebrafish pronephros development, we performed loss of function studies using two previously published morpholinos (MOs) (Tohme et al., 2014). Of these, one morpholino was designed to block protein translation (esrrγa ATG MO), and the other was designed to interfere with splicing by blocking the exon 1 splice donor site (esrrγa SB MO) (Tohme et al., 2014) (Supplement 1A). The esrrγa SB MO caused improper splicing between exon 1 and 2 whereby a portion of exon 1 was excised in the process and produced a transcript that encoded a premature stop codon (Supplement 1B-C). Compared to WT embryos, esrrγa morphants displayed hydrocephaly, pericardial edema, and otolith malformations at 96 hours post fertilization (hpf) (Figure 1C, Supplement 3A). This combination of morphological phenotypes suggested that nephron segment development and/or ciliary function were compromised. Therefore, we next assessed the effect of esrrγa deficiency on each of the nephron segments and distinct ciliated cell populations within the kidney.
We found that upon knockdown of esrrγa, the proximal straight tubule (PST, marked by trpm7) expanded, while the distal late segment (DL, marked by slc12a3) decreased in length at both the 20 ss and 28 ss (Figure 1D, 1E). The proximal convoluted tubule (PCT, marked by slc20a1a), the distal early segment (DE, marked by slc12a1), and the overall length of the nephron tubule (marked by cdh17) remained unchanged (Supplement 2A, 2C-E). The PCT also exhibited successful proximal migration towards the glomerulus and exhibit the correct convoluted morphology by 3 dpf (Supplement 2G). The observed composition changes were notable as early as the 20 ss and were not a result of changes in cell proliferation, cell death, or total cell number (Figure 1F, 1G, Supplement 2H-O). This supports the notion that esrrγa operates early specifically throughout nephron formation, as distinct segments are altered.
To further explore the mechanics of these segment changes, we studied another cell type present within the nephron, MCCs. Preceding work from our lab has found that increased monociliated transporter cell identity can be associated with a coordinated decrease in MCC identity (Chambers et al., 2020, Marra et al., 2019a, Marra et al., 2019b). Indeed, we found that esrrγa deficiency resulted in a decrease in MCC cell number (marked by odf3b), and co-injection of esrrγa RNA was sufficient to rescue the splice blocking morpholino (Figure 1H-I). Fluorescent in situ hybridization (FISH) analysis of the PST domain (marked by the boundaries of trpm7) also revealed a shift towards a transporter cell identity (Figure 1J). While the overall average cell number (calculated by number of DAPI) in this domain did not change, there was an increase in the number of trpm7 positive cells accompanied by a coordinated decrease of odf3b positive cells (Figure 1K). MCC precursors were also affected in esrrγa deficient animals, resulting in a significant decrease in the number of jag2b expressing cells (Supplement 2B, F). Next, we interrogated esrrγa loss of function using a genome editing approach. We designed an independent genetic model of esrrγa deficiency using CRISPR-Cas9 mutagenesis. Wild-type zebrafish embryos injected with a cocktail of two guide RNAs that targeted exon 1 of esrrγa also exhibited a decrease in MCCs (Supplement 1G). As the penetrance of the esrrγa crispant phenotypes in F0 mosaic embryos was less consistent than our morpholino models, we continued to use the esrrγa morphant models for subsequent analysis. These findings suggest that esrrγa contributes to cell fate decisions between the MCC and monociliated transporter cell identity.
esrrγa is required for ciliogenesis in the kidney and other tissues
Ciliogenesis is a complex process, requiring proper basal body production around the centrioles, amplification of the basal bodies (in the case of MCCs), proper basal body docking at the apical surface, and finally cilia outgrowth, mediated by anterograde and retrograde intraflagellar transport (Spassky & Meunier, 2017). Previous studies have found that decreased MCC number can be associated with aberrations in ciliogenesis (e.g. decreased cilia outgrowth) (Chambers et al., 2020).
Considering the observed decrease in MCC number in esrrγa deficient animals, we investigated whether cilia formation was likewise affected. The intermediate pronephros are comprised of MCCs interspersed amongst monociliated transporter cells (Figure 2A). We first analyzed cryosections of the intermediate nephron of esrrγa deficient animals to determine if cell polarity or ciliogenesis was disrupted. We found that morphants successfully established apical basal polarity at 28 hpf, as both apical (aPKC) and basolateral (N+K+ ATPase) proteins were correctly and separately localized (Figure 2B). Cryosections of 24 hpf morphants analyzed for cilia structures (cilia (α-tubulin), basal bodies (γ-tubulin)) revealed that while cilia appear to be decreased, basal bodies were successfully docked, as they localized to the putative apical surface (Figure 2B). Interestingly, some basal bodies observed in esrrγa deficient animals did not appear to be associated with a cilium projection (Figure 2B). These data suggest that esrrγa could be contributing to proper cilia formation, though this is likely to occur independently of polarity or basal body docking.
To further explore the role of esrrγa in cilia outgrowth, we used immunofluorescence to mark cilia (α-tubulin), basal bodies (γ-tubulin), and DAPI in whole mounts of esrrγa deficient animals and WT siblings. This was followed by confocal imaging of both the proximal and distal pronephros, to capture cilia protruding from MCCs as well as transporter cells, respectively. Cilia were disrupted in both the proximal and distal pronephros (Figure 2C, Supplement 3D), where cilia length was significantly shorter in esrrγa deficient animals compared to WT (Figure 2D, G, Supplement 3E-N). In addition, morphants did not show any significant changes in the number of basal bodies or cell number (Supplement 4A-D). However, esrrγa deficient animals had fewer ciliated basal bodies (Figure 2E, H), as well as decreased fluorescent intensity of cilia (α-tubulin) (Figure 2F, I) which is consistent with the aberrant cilia phenotypes we observed in cryosectioned animals. To test the specificity of our splice interfering morpholino, we co-injected animals with esrrγa cRNA. Supplementation of mature esrrγa transcript alongside the morpholino was sufficient to rescue cilia length, ciliated basal bodies, and the fluorescent intensity of α-tubulin (Figure 2C-I). From these data, we concluded that esrrγa deficiency interferes with cilia formation in both MCCs and renal epithelial cells with a single primary cilium.
In addition to the kidney, cilia are critical to several other tissues across vertebrates. In the zebrafish this includes, but is not limited to, the Kupffer’s vesicle (analogous to the mammalian node) and the otic vesicle (ear structure). To determine if esrrγa operates solely in the pronephros, we next investigated the effect of esrrγa deficiency on these other tissues. We used IF to mark the KV using aPKC (apical surface) and α-tubulin (cilia) in both esrrγa morphants and WT siblings at the 10 ss (Figure 2J). Like the pronephros, cilia length was significantly reduced in the KV of esrrγa deficient animals (Figure 2K). We also used IF to identify cilia and basal bodies in the ear at 4 dpf. Similarly, morphant animals exhibited decreased fluorescence of α-tubulin in the region of both macula and cristae structures, the latter of which was nearly absent altogether (Figure 2L). These data are consistent with the phenotypes observed in the pronephros, and suggest that esrrγa affects multiple tissues throughout development (e.g. 10 ss, 24 hpf, 28 hpf, and 4 dpf).
esrrγa promote ciliogenesis and MCC cell fate by regulating prostanoid biosynthesis
Previous studies from our lab and others have shown that prostaglandin signaling is required for ciliogenesis and MCC cell fate choice (Chambers et al., 2020, Jin et al., 2014, Marra et al., 2019a, Spassky & Meunier, 2017). Considering esrrγa deficient animals exhibit similar phenotypes as those with defective prostaglandin synthesis (e.g. decreased MCCs and aberrant cilia), we hypothesized that perhaps esrrγa operated in a similar manner. Prostaglandin E2 (PGE2) was of interest, considering an analog with an improved half-life, 16,16-dimethyl-PGE2 (dmPGE2), has been able to rescue other animals with aberrant cilia and decreased MCCs (Chambers et al., 2020, Jin et al., 2014, Marra et al., 2019a, Poureetezadi et al., 2016). Using a commercially available ELISA assay, we measured endogenous PGE2 levels in WT and esrrγa deficient embryos at the 28 hpf stage. Compared to WT, esrrγa knockdown resulted in a significant decrease of PGE2 (Figure 3A). This led us to hypothesize that the diminished PGE2 level was the basis for the ciliary and cell fate alterations in esrrγa deficient embryos.
To test this hypothesis, we examined the functional consequence of restoring prostanoid levels in in esrrγa deficient embryos. We treated WT and esrrγa deficient embryos with dmPGE2 and used WISH of odf3b to assess MCC cell fate (Figure 3B). esrrγa deficient embryos treated with 100 µM dmPGE2 from shield stage until fixation at 24 hpf had an increase in MCC number compared to their DMSO treated siblings, restoring the number similar to that of WT animals (Figure 3C). As observed by previous studies, we found that dmPGE2 was not sufficient to increase MCC number in WT animals (data not shown) (Chambers et al., 2020, Marra et al., 2019a).
Next, we investigated if dmPGE2 was able to restore proper cilia formation. We treated both WT and esrrγa morphant animals with 100µM dmPGE2 or vehicle control from shield stage until fixation at 28 hpf and assessed cilia structures using whole mount IF (Figure 3F). In both the proximal and distal tubule, dmPGE2 rescued cilia length (Figure 3G, J), ciliated basal bodies (Figure 3H, K), and corresponding cilia fluorescent intensity (Figure 3I, L) to WT levels. Together, these data suggest that esrrγa interacts with the PGE2 pathway to facilitate ciliogenesis and MCC cell fate.
Prostaglandins are formed by the metabolism of arachidonic acid by cyclooxygenase enzymes to form PGH2, which can then be further metabolized by prostaglandin synthase enzymes to form prostanoids. Zebrafish embryos contain four prostaglandin signaling molecules (PGE2, PGF2α, PGI2, and TXA2) (Cha et al., 2005). Previous research has shown that cyclooxygenase enzymes (Cox1 or Cox2, encoded by ptgs1, ptgs2a/b in zebrafish, respectively) are critical for proper ciliogenesis and MCC cell fate (Chambers et al., 2020, Marra et al., 2019a). With this in mind, we hypothesized that esrrγa may be contributing to cilia formation through ptgs1. We first examined the 2kb promoter region of ptgs1 for potential binding sites for esrrγa. We found one ERR consensus binding motif (AAGGTCA) approximately 1.8kb upstream of the ptgs1 open reading frame (Figure 3D). It is also worth noting that unlike estrogen receptors, ERRs can bind DNA and affect transcription as monomers; thus, one consensus sequence can be sufficient to affect expression (Huppunen et al., 2004). To confirm that esrrγa deficiency does affect ptgs1 transcription, we conducted WISH analysis and qRT-PCR of ptgs1 in esrrγa deficient animals at 24hpf. The length of the ptgs1 domain in the pronephros was significantly decreased (Supplement 5A-B), as well as expression in whole animal lysates, as determined by qRT-PCR (Figure 3E). The observed decreased expression of ptgs1 further supports our hypothesis esrrγa may be contributing to cilia formation through regulation of cyclooxygenase enzyme 1. Next, we sought to determine if ptgs1 overexpression alone was sufficient to rescue esrrγa deficiency. We first examined the effect of co-injection of ptgs1 RNA with esrrγa MO on MCC number (Figure 3B). Like dmPGE2 treatment, ptgs1 RNA restored MCC number to WT levels (Figure 3C). We then observed the effect of ptgs1 overexpression on cilia in both MCCs and mono-ciliated cells using IF (Figure 3F). In both proximal and distal segments, we found that ptgs1 cRNA was sufficient to rescue cilia length (Figure 3G, J), ciliated basal bodies (Figure 3H, K), and the corresponding fluorescent intensity of α-tubulin (Figure 3I, L). Again, these phenotypes were not due to changes in basal body or cell number (Supplement 4A-D). From these data, we concluded that esrrγa promotes PGE2 synthesis via ptgs1 to promote MCC specification and cilia outgrowth in both MCC and transporter cell populations.
esrrγa cooperates with ppargc1a to control MCC specification and cilia formation
Recent studies have found that ppargc1a is essential for prostaglandin signaling, nephron formation, and ciliogenesis (Chambers et al., 2018, Chambers et al., 2020). Interestingly, deficiency of this factor results in similar phenotypes that we observed in the case of esrrγa deficiency, including decreased DL and skewed MCC cell fate choice (Chambers et al., 2018, Chambers et al., 2020). Considering these similarities, we sought to determine if esrrγa and ppargc1a are expressed in the same cell population. FISH analysis revealed that esrrγa and ppargc1a colocalize in the same pan-distal region of the nephron (Figure 4A).
Considering these factors are co-expressed, we designed genetic interaction studies to explore the relationship between esrrγa and ppargc1a. One strategy to test if multiple genes operate synergistically in a pathway is the use of suboptimal morpholinos (Chambers et al., 2020, Choi et al., 2015, DiBella et al., 2009, Kallakuri et al., 2015, Wagle et al., 2011). Therefore, we injected suboptimal morpholino (SOMO) doses of both esrrγa and ppargc1a, based on previously published doses (Chambers et al., 2018, Chambers et al., 2020). We then conducted WISH to determine changes in MCC number (Figure 4B). We found that esrrγa and ppargc1a SOMO alone resulted in no change or a slight yet significant decrease in MCC number when compared to WT, respectively (Figure 4C). However, the combination of both esrrγa and ppargc1a SOMO together resulted in a significant decrease in MCC number (Figure 4C).
We then interrogated the synergistic effect of esrrγa and ppargc1a on cilia formation. Similar to MCC number, esrrγa and ppargc1a SOMO did not appear to have a significant effect on the appearance of cilia, while the combination injection showed aberrant cilia structures (Figure 4D). Further, esrrγa and ppargc1a SOMO injections independently did not significantly change ciliated basal bodies nor cilia length in MCC and transporter cell populations. However, combination of the esrrγa and ppargc1a SOMO significantly decreased the percentage of ciliated basal bodies as well as cilia length in both pronephric regions of interest (Figure 4E-F, H-I). The corresponding fluorescent intensity of the combination SOMO was also significantly decreased when compared to all other treatment groups (Figure 4G, 4J). These changes were not due to alterations in basal body or cell number (Supplement 4I-L). Overall, this evidence is indicative of a cooperative effect between esrrγa and ppargc1a in the context of ciliogenesis and MCC specification.
Discussion
Estrogen related receptors, and specifically Esrrγ, have been previously linked to disease states of tissues with high energy demand. Global Esrrγ knockout mice and cardiac specific overexpression mice exhibit early lethality due to heart failure (Alaynick et al. 2007, Alaynick et al. 2010, Lasheras et al., 2021). Similar dysfunction is seen in the kidney, as Esrrγ knockout results in deficient ureteric branching, kidney cysts, and decreased mitochondrial function and solute transportation (Berry et al., 2011, Zhao et al., 2018). In humans, mutations in or decreased expression of ESRRγ has been linked to incidence of congenital anomalies of the kidney and urinary tract and chronic kidney disease (Berry et al., 2011, Eichner et al., 2011, Hock et al., 2009, Misra et al., 2017, Zhao et al., 2018). Yet, until our current work, the mechanism by which Esrrγ contributes to the development of the high energy and ciliated tissues remains poorly understood.
Our work suggests that esrrγa works with ppargc1a upstream of prostaglandin signaling to facilitate nephron cell development and ciliogenesis. Specifically, esrrγa acts as a “switch” to favor MCC fate, as we see decreased MCC number with a coordinated increase of PST transporter cells and decrease of the DL segment in esrrγa deficiency. Additionally, esrrγa knockdown resulted in decreased ciliated basal bodies and decreased cilia length in both mono and multiciliated cell populations in the nephron and other tissues. The observed decreased MCC number and aberrant cilia could be rescued by co-injection of ptgs1 or treatment with dmPGE2, showing for the first time that esrrγa works upstream of prostanoid production. Furthermore, suboptimal morpholino injection of esrrγa and ppargc1a, genetically mimicking compound heterozygous animals, resulted in phenotypes reminiscent of full dosage animals with decreased MCC number and atypical cilia. Together, these data deepen our understanding of the possible mechanisms contributing to ciliopathic and kidney disease conditions.
Prior to this work, prostaglandins have been established as key bioactive molecule in various tissues, and implicated in disease states relating to inflammation, vascular development, cardiac injury, and kidney disease (Lannoy et al., 2020, FitzSimons et al., 2020, Marra et al., 2019a, Sparks and Coffman, 2010, Ugwuagbo et al., 2019,). In some models, blockade of a prostaglandin receptor (EP4) can improve cystic disease states, yet PGE2 has also been implicated as an essential factor of cilia outgrowth and proper nephron patterning, which together point to the importance of proper spatiotemporal control of prostaglandin dosage. (Chambers et al., 2020, Jin et al., 2017, Lannoy et al., 2020, Marra et al., 2019a, Poureetezadi et al., 2016). Here, we have added to that growing body of knowledge, as dmPGE2 and ptgs1 were able to rescue both cell type (MCC deficiency) and ciliopathic (ciliated basal bodies, and cilia length) phenotypes. The dmPGE2 treatment was unable to rescue the distal late segment length (data not shown). However, a restoration of the DL was not anticipated as exogenous dmPGE2 and prostaglandin inhibition have been shown to result in the same DL domain decrease (Poureetezadi et al., 2016). These somewhat contradictory findings speak to the importance of precise PGE2 dosage, and also suggests that esrrγa may control segmentation of the distal segment through a mechanism independent of prostaglandin signaling. Further research is required to interrogate the mechanism by which the distal segment is regulated. Candidate transcription factors like tbx2b may be of interest, as it operates downstream of ppargc1a in distal cell fate identity (Chambers et al., 2018, Drummond et al., 2017).
esrrγa and ppargc1a act similarly upstream of nephron and cilia development in zebrafish, and we found a synergistic relationship these factors. Ciliogenesis is not the first context in which these factors have been linked, and some have even suggested that PGC1a acts as a “protein ligand” of ESRRγ (Audet-Walsh and Giguere, 2014). Both esrrγa and ppargc1a have been independently implicated in mitochondrial function and various disorders, including diabetes and kidney disease (Audet-Walsh and Giguere, 2014, Guo et al., 2015, Ishimoto et al., 2017, Knutti and Kralli, 2001, Long et al., 2016, Misra et al., 2017, Poidatz et al., 2012, Sharma et al., 2013, Zhao et al., 2018). Further, Esrrγ and Ppargc1a have been shown to bind the same multiple hormone response element in the context of kidney specific and other cell lines (Liu et al., 2005, Wang et al., 2008). While the present studies have shown a strong and consistent interaction between esrrγa and ppargc1a, cilia structure and specific nephron cell types were not evaluated. While we have begun filling this gap in knowledge through our suboptimal morpholino combination experiments, future studies are needed to elucidate the molecular nature of this relationship. In particular, it is not yet known if Esrrγa and Ppargc1a directly bind to one another in the promoter or enhancer region of ptgs1 or regulate ciliogenesis through some other mechanism. Since both Esrrγ and Ppargc1a have been shown to interact with Hnf1b in the context of kidney tissue, especially in ciliopathic conditions, it is possible that this factor may act as the link in this synergistic relationship (Casemayou et al., 2017, Verhave et al., 2016, Zhao et al., 2018). Furthermore, neither esrrγa or ppargc1a deficiency alone is sufficient to eradicate all pronephric MCCs and cilia. This may be due to redundant function of esrrγb, as esrrγa/b function redundantly in the development of the otic vesicle (Tohme et al., 2014). Alternatively, maternal deposition of either of these factors could explain the basal level of cilia production or perhaps the presence of other ciliogenic factors is sufficient to compensate for esrrγa and ppargc1a loss to drive low levels of ciliogenesis. Future studies may be interested in the interaction with esrrγa/ppargc1a and other known components of the ciliogenesis network (e.g. foxj1, gmnc, and mulitcillin) (Choksi et al., 2014, Spassky and Meunier, 2017). It is possible that complete absence of MCCs and cilia is only possible when animals are deficient in multiple factors within the cilia regulatory program.
The link between ciliopathies and aberrant kidney structure and function has long been established (Wang et al., 2013, Winyard et al., 2011), yet the relationship between nephrogenesis and ciliogenesis remains poorly understood. Our work has identified a novel role for esrrγa at the nexus of kidney and cilia formation through prostaglandin signaling and cooperation with ppargc1a. This discovery suggests that Esrrγ is an important component in maintaining kidney health and implicates Esrrγ as a key regulator of ciliogenesis in other tissues. Other studies have already recognized the potential of ERRs as targets for aging kidney treatment. Specifically, treating with pan-ERR agonists results in remarkable improvements in mitochondrial function and albuminaria (Wang et al., 2020). Our findings support this trend, as Esrrγ may serve as a future therapeutic target, and considering the worldwide prevalence of kidney failure and ciliopathies, novel targets are of the upmost importance.
Methods
EXPERIMENTAL MODEL AND SUBJECT DETAILS
The Center for Zebrafish Research at the University of Notre Dame maintained the zebrafish used in these studies and experiments were performed with approval of the University of Notre Dame Institutional Animal Care and Use Committee (IACUC), under protocol number 19-06-5412.
Animal models
Tübingen strain WT zebrafish were used for all studies. Zebrafish were raised and staged as described (Kimmel et al., 1995). For all studies, embryos were incubated in E3 medium at 28°C until the desired developmental stage, anesthetized with 0.02% tricaine, and then fixed using 4% paraformaldehyde/1x PBS (PFA), or Dent’s solution (80% methanol, 20% DMSO) (Westerfield, 1993, Gerlach et al., 2014). Embryos were analyzed before sex determination, so we cannot report the effect of sex and gender in the context of this study.
METHOD DETAILS
Whole mount and fluorescent whole mount in situ hybridization (WISH, FISH)
WISH was performed as previously described (Cheng et al., 2014; Galloway et al., 2008; Lengerke et al., 2011; Marra et al., 2019a, Chambers et al 2020) with antisense RNA probes either digoxigenin-labeled (esrrγa, cdh17, odf3b, slc20a1a, trpm7, slc12a1, slc12a3, jag2b, ptgs1) or fluorescein-labeled (deltaC, smyhc, pax2a, odf3b, esrrγa, cdh17, pgc1a, slc12a3) using in vitro transcription using IMAGE clone templates as previously described (Wingert et al., 2007; O’Brien et al., 2011; Gerlach and Wingert, 2014). FISH was performed as described (Brend and Holley 2009; Marra et al., 2017) using TSA Plus Fluorescein or Cyanine Kits (Akoya Biosciences). For all gene expression studies, every analysis was done in triplicate for each genetic model with sample sizes of n > 20 per replicate.
Sectioning
Fixed zebrafish samples exposed to 5% and 30% sucrose solution and then subjected to a 1:1 solution of 30% sucrose and tissue freezing medium (TFM). Infiltrated samples were embedded in 100% TFM and oriented in Tissue-Tekcryo-molds and frozen at -80°C. Sections (14 µm) were taken on a Microm HM 550 Cryostat (Thermo).
Immunofluorescence (IF)
Whole mount IF experiments were completed as previously described (Gerlach and Wingert, 2014; Kroeger et al., 2017; Marra et al.,2017, 2019c, Chambers et al., 2020). For cilia and basal bodies, anti-tubulin acetylated diluted 1:400 (Sigma T6793) and anti γ-tubulin diluted 1:400 (Sigma T5192) were used, respectively. Cryosectioned samples were completed as previously described (Gerlach and Wingert, 2014). For cilia and basal bodies, anti-tubulin acetylated diluted 1:1000 (Sigma T6793) and anti γ-tubulin diluted 1:400 (Sigma T5192). For cell polarity, animals were fixed in Dent’s solution, and used anti-aPKC diluted 1:500 (Santa Cruz 2300359) to mark apical surface and anti-Na+K+ ATPase diluted 1:35 (DSHB 528092) for a basolateral marker.
Rescue Experiments with dmPGE2
Chemical treatments were completed as previously described (Marra et al., 2019a; Poureetezadi et al., 2014; Poureetezadi et al., 2016, Chambers et al., 2020). 16,16-dmPGE2 (Santa Cruz Biotechnology, Inc, SC-201240) was dissolved in 100% dimethyl sulfoxide (DMSO) to make 1M stocks then diluted to the 100 µM treatment dose. Treatments were completed in triplicate with n > 20 embryos per replicate. PGE2 metabolite quantification PGE2 metabolite quantifications were completed according to the manufacturer’s protocol (Cayman Chemical #500141). In brief, groups of 25 WT or esrrγa MO injected zebrafish were pooled, anesthetized, and flash frozen in 100% ethanol. Lysates were homogenized and supernatant was isolated after centrifugation at 4°C (12,000 RPM for 20 minutes). The kit reagents and manufacturer supplied protocol was followed for assay completion using a plate reader (SpectraMax ABSPlus) at 420 nm.
Quantitative real-time PCR
Groups of 30 zebrafish (WT, esrrγa morphants) were pooled at 24 hpf. Trizol (Ambion) was used to extract RNA, qScript cDNA SuperMix (QuantaBio) was used to make cDNA. PerfeCTa SYBR Green SuperMix with ROX (QuantaBio) was used to complete qRT-PCR with 100 ng for ptgs1 and 1 ng for 18S controls being optimal cDNA concentrations. The AB StepOnePlus qRT-PCR machine was used with the following program: 2 minute 50°C hold, 10 minute 95°C hold, then 35 cycles of 15 s at 95°C and 1 minute at 60°C for denaturing and primer annealing and product extension steps respectively. Each target and source were completed in biological replicates and technical replicates each with the median Ct value normalized to the control. Data analysis was completed by using delta delta Ct values comparing WT uninjected siblings to the respective morphant groups with 18S as a reference. Primers used include: To target 18S: forward 5’–TCGGCTACCACATCCAAGGAAGGCAGC–3’ reverse 5’–TTGCTGGAATTACCGCGGCTGCTGGCA–3’.
To target ptgs1: forward 5’- CATGCACAGGTCAAAATGAGTT- 3’ reverse 5’-TGTGAGGATCGATGTGTTGAAT-3’ cRNA synthesis, and microinjections, rescue studies The zebrafish esrrγa ORF was cloned in to a pUC57 vector flanked by a 5’ KOZAK sequence, single BamH1, SalI and EcoRV restriction sites, and a SP6 promoter region. On the 3’ side, the ORF was followed by a series of STOP codons, a SV40 poly A tail, single NDeI, EcoRI, and NotI restriction sites, and a T7 promoter region. esrrγa RNA was generated by linearizing with Not1 and SP6 run off with the mMESSAGE mMACHINE SP6 Transcription kit (Ambion). esrrγa RNA was injected into WT with or without a co-injection of esrrγa splice blocking morpholino at the 1- cell stage at a concentration of 500 pg. The ptgs1 ORF was cloned in to a pUC57 vector flanked by a 5’ KOZAK sequence, Cla1 restriction site, and a SP6 promoter region. On the 3’ side, the ORF was followed by a series of STOP codons, a SV40 poly A tail, a NotI restriction site, and a T7 promoter region. ptgs1 RNA was generated as with esrrγa and injected at 900 pg.
CRISPR-Cas9 mutagenesis
Methods were adapted from Hoshijima et al., (2019). In short, target sequences were selected using the IDT predesign tool, and cross referenced using online program CHOP-CHOP (http://chopchop.cbu.uib.no/index.php). Selected crRNA and tracrRNA tools were obtained (IDT), and dissolved into a 100µM stock with duplex buffer (IDT). To form the crRNA:tracrRNA duplex, equal amounts of crRNA were combined with tracrRNA, and exposed to a rapid heat-slow cool program in a thermocycler. The 50µM duplexed crRNA:tracrRNA was diluted to 25µM with duplex buffer (IDT). Cas9 protein (IDT) was prepared and aliquoted according to the protocol described by Hoshijima et al., (2019). Injection mixes were prepared as follows: 1µl 25µM crRNA:tracrRNA (crRNA 1) + 1µl 25µM crRNA:tracrRNA (crRNA 2) + 1µl 25µM Cas9 protein + 2µl RNase-free water. This mixture was incubated at 37°C for 10 minutes, and then stored at room temperature. Zebrafish embryos were injected at the one cell stage with 2-3nl of the 5µM crRNA:tracrRNA:Cas9 mixture.
Genetic models
Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC (Philomath, OR). MOs were solubilized in DNase/RNase free water to generate 4 mM stock solutions which were stored at 20C. Zebrafish embryos were injected at the 1-cell stage with 1-2 nL of diluted MO. esrrγa was targeted with two morpholinos. A start site (ATG) morpholino: 5’– CAATGTGGCGGTCCTTGTTGGACAT –3’ (667 µM optimal), and a splice blocking morpholino 5’– AGGGTAAAAGCCAACCTTGAATGGT –3’(400 µM optimal, 200 µM suboptimal). The latter of which was validated using RT-PCR using the following primers: esrrγa RT-PCR forward 5’– CTGGTGCCAAGCGTTATGAGGACTGTTCCAG –3’ and esrrγa RT-PCR reverse 5’– GAGGCAGAGCCAGTTGAGGGTTCAAATAGG–3’. ppargc1a was targeted with the following validated MO: 5’–CCTGATTACACCTGTCCCACGCCAT–3’ (400 µM optimal, 200 µM suboptimal) (Hanai et al., 2007; Bertrand et al., 2007, Chambers et al., 2018, Chambers et al., 2020).
Image acquisition and phenotype quantification
A Nikon Eclipse Ni with a DS-Fi2 camera was used to image WISH samples and live zebrafish. Live zebrafish were mounted in methylcellulose with trace amounts of tricaine present. IF and FISH images were acquired using a Nikon C2 confocal microscope
QUANTIFICATION AND STATISTICAL ANALYSIS
Cilia phenotypes were quantified using ImageJ/Fiji (https://imagej.nih.gov) software tools. All measurements were completed on representative samples imaged at 60X magnification. The multi- point tool was used for counting. The segmented line tool was used for length measurements. Fluorescent intensity plots were generated with the plot profile function. Each experiment was completed in a minimum of triplicate. From these measurements an average and standard deviation (SD) were calculated, and unpaired t tests or one-way ANOVA tests were completed to compare control and experimental measurements using GraphPad Prism 9 software. Statistical details for each experiment are located in the corresponding figure legend.
ACKNOWLEDGEMENTS
We would like to thank the generous funders of this work: startup funds from the University of Notre Dame (to R.A.W), Graduate Women in Science National Fellowship (to H.M.W), Warren Center Drug Development Welter Family Fellowship (to H.M.W), and the Notre Dame Center for Stem Cells and Regenerative Medicine Fellowship (to H.M.W). This work would not have been possible without the staffs of the Department of Biological Sciences and the Center for Zebrafish Research at the University of Notre Dame. Imaging seen in this manuscript was carried out in part in the Notre Dame Integrated Imaging Facility (AR1, C2 confocal microscopes), and we especially thank S.C. for her knowledge and expertise. Finally, we express our deep gratitude to the Wingert lab and Wingert lab alumni, J.C and B.C., for their guidance and insight on this project.
Footnotes
Abbreviations: days post fertilization (dpf); distal early (DE); distal late (DL); immunofluorescence (IF); estrogen-related receptor gamma a (esrrγa); fluorescent in situ hybridization (FISH); intraflagellar transport (IFT); hours post fertilization (hpf); Kupffer’s vesicle (KV); morpholino oligonucleotide (MO); multiciliated cell (MCC); peroxisome proliferator- activated receptor gamma 1 alpha (pgc1a); polycystic kidney disease (PKD); prostaglandin E2 (PGE2); prostaglandin-endoperoxide synthase 1 (ptgs1); proximal convoluted tubule (PCT); proximal straight tubule (PST); somite stage (ss); whole mount in situ hybridization (WISH); wild- type (WT)