Abstract
Bacterial wilt (BW) is a soil-borne disease that severely impacts plant growth and productivity globally. Ubiquitination plays a crucial role in disease resistance. Our previous research indicated that NAC transcription factor SmNAC negatively regulates BW resistance in eggplant (Solanum melongena). However, whether the ubiquitin/26S proteasome system (UPS) participates in this regulation is unknown.
This study used SmNAC as a bait to screen eggplant cDNA library and obtained SmDDA1b, an E3 ubiquitin ligase. Subcellular location and bimolecular fluorescence complementation assays revealed that SmDDA1b could interact with SmNAC in the nucleus. The in vivo and in vitro ubiquitination experiments indicated that SmDDA1b can degrade SmNAC through UPS. However, the discovery of negative regulation of SmDDA1b expression by SmNAC showed that there was a negative feedback loop between SmNAC and SmDDA1b in eggplant.
The SmDDA1b-overexpressed lines showed a higher BW resistance associated with high expression levels of salicylic acid (SA)-related genes and SA content than the wild-type lines. However, SmDDA1b-silencing lines showed the opposite results, indicating that SmDDA1b is a positive regulatory gene for BW resistance.
This study provides a candidate gene that can enhance BW resistance in eggplants. In addition, it provides insight into a mechanism that promotes plant disease resistance via the SmDDA1b-SmNAC-SA pathway.
Introduction
Bacterial wilt (BW) is a soil-borne bacterial disease caused by Ralstonia solanacearum species complex (RSSC) (Safni et al., 2014), with diverse strains and a wide range of hosts. Hayward (1991) estimates that it can infect about 450 plant species in 54 families, including major cash crops and vegetables, especially Solanaceae crops. RSSC is one of the most common bacteria causing severe plant diseases globally (Mansfield et al., 2012; Kim et al., 2016). RSSC enters the plant xylem through the intercellular space for self-reproduction and secretes several extracellular polysaccharides and extracellular proteases. This blocks the vascular bundles and causing plants to die due to lack of water (McGarvey et al., 1999; Huang and Allen, 2000).
However, plants also resist BW in multiple ways, regulated at the DNA, transcription, translation, and post-translational levels. Studies have shown that heterologous overexpression of Arabidopsis thaliana gene AtEFR can reduce the effect of BW in tomato (Solanum lycopersicum) and potato (Solanum tuberosum) (Boschi et al., 2017; Kunwar et al., 2018). StNACb4 transcription factor positively regulates BW resistance in tomatoes at the transcriptional level (Chang et al., 2020). Moreover, transcription factor bHLH93 interacts with RSSC effector Ripl to induce plant immune response in tobacco (Nicotiana tabacum) (Tahir et al., 2017). RRS1-R can recognize RSSC Avr protein in Arabidopsis and act as dual resistance proteins with RPS4 for disease resistance (Tasset et al., 2010; Narusaka et al., 2014). Gong et al. (2021) showed that some histone deacetylase (HDAC)-mediated histone acetylation can reduce tomato resistance to BW at the post-translation level. Besides, Yu et al. (2020) found that phosphorylation of the SGT1 gene is beneficial to BW resistance.
Isochorismate synthase (ICS) and phenylalanine ammonia lyase (PAL) synthesize salicylic acid (SA). Besides, the ICS pathway synthesizes more than 90% of SA in disease resistance response (Wildermuth et al., 2001; Garcion et al., 2008). There are two ICS genes in Arabidopsis, ICS1/SID2 and ICS2 (Dempsey et al., 2011). MdWRKY15 increases SA accumulation via MdICS1 activation (Zhao et al., 2020). OsWRKY6 increases SA content via OsICS1 activation (Choi et al., 2015). Lowe-Power et al. (2016) showed that SA can inhibit the expression of type III effectors of RSSC. External application of SA can increase CaWRKY22 expression, thus enhancing BW resistance to pepper (Capsicum annuum) (Hussain et al., 2018). NtWRKY50 overexpression enhances BW resistance in tobacco while significantly increasing SA levels (Liu et al., 2017). SA pathway signal genes also positively regulate plant disease resistance. Previous studies have shown that SA signaling transduction through NPR, TGA, NPR1, TGA2.2, and TGA1a positively regulates tomato BW resistance (Chen et al., 2009; Li et al., 2019). EDS1, PAD4, NPR1 and SGT1 positively regulates eggplant BW resistance (Xi-ou et al., 2016). PR gene expression is induced when the plant is stressed and the SA content increases (Lu et al., 2018).
Furthermore, ubiquitination is as important as phosphorylation and acetylation in eukaryotes. Ubiquitin/26S proteasome system (UPS) is a conserved ubiquitination system (Pickart and Fushman, 2004). Ubiquitin (Ub) interacts with the target protein in UPS through E1 (ubiquitin-activating) enzyme, E2 (ubiquitin-conjugating) enzyme, and E3 ubiquitin ligase via ATP for single ubiquitination or repeated polyubiquitination. This degrades or modifies the protein composition to regulate the function of eukaryotes (Thrower et al., 2000; Rowland et al., 2005). E3 ligases are mainly divided into HECT E3s, RING E3s, and RBR E3s. The RING family is the largest, containing a zinc or U-box binding domain (Stone et al., 2005; Morreale and Walden, 2016). Cullin-RING-Ligases (CRLs) are multi-subunit complexes and the largest family in the RING E3s. It is composed of scaffold protein Cullin, RBX1 protein-containing RING domain, adaptor, and substrate receptor (Zimmerman et al., 2010).
CUL1, CUL3, CUL4, and APC are the major cullin types in plants. CRL4 (CUL4A or CUL4B) uses DDB1 as an adaptor and DDB1 and cullin 4-related factors (DCFA) as substrate receptors (Pang et al., 2019). DDB1 and DET1-associated protein1 (DDA1) is a basic conservative component in the CRL4 core complex that directly interacts with DDB1 to promote substrate recruitment or regulate the overall topology of the CRL4-substrate complex (Olma et al., 2009; Shabek et al., 2018). DDA1 was first identified as a subunit of the plant DDB1-DET1-DDA1 (DDD) complex (Yanagawa et al., 2004). DDA1 (Q9FFS4) forms a protein complex with Cul4, DDB1, COP10, and DET1 in Arabidopsis, which binds Ub on E2 to the abscisic acid (ABA) receptor protein PYL8 for complete ubiquitination (Irigoyen et al., 2014). Studies have also shown that E3 ligase plays a crucial role in plant resistance to disease, including BW (Lee et al., 2020; McLellan et al., 2020). For instance, both the E3 ligase NtRNF217 in tobacco (Liu et al., 2021) and the ATL family gene StACRE in potato (Park et al., 2012) can positively regulate plant resistance to BW.
Studies have found that many Solanaceae crops are not immune to BW (Patil et al., 2012). However, eggplant (Solanum melongena), as a representative Solanaceae crop, is an important vegetable with high BW resistance and sensitivity, making it ideal for BW analysis. Previous research found that eggplant SmPGH1 is a BW resistance gene (Wang et al., 2020). Besides, eggplant AG91-25 possesses resistance locus EBWR9, and the RSSC ripAX2 gene can induce AG91-25 specific resistance (Morel et al., 2018). Xi’ou et al. (2015) indicated that the eggplant RE-bw gene can interact with the effector Popp2 of RSSC. Qiu et al. (2019) also showed that spermidine (SPD) significantly improves eggplant resistance to BW, and SmMYB44 enhances SmSPDS expression. However, there is little research on plant resistance to BW at the post-translational level. Moreover, it is unclear whether UPS is involved in the regulation of BW.
Our previous research showed that eggplant NAC transcription factor SmNAC (KM435267) binds to the promoter of SA synthesis gene ICS1 to inhibit SA accumulation, thereby reducing eggplant BW resistance (Na et al., 2016). This study used SmNAC protein as a bait to screen an E3 ubiquitin ligase gene, SmDDA1b (GenBank accession number: MZ736671) that interact with SmNAC from the eggplant cDNA library. Besides, this study verified the function of SmDDA1b and the relationship between SmDDA1b and SmNAC. Therefore, this research provides new insights into the molecular mechanism by which the SmDDA1b-SmNAC-SA pathway enhances BW resistance.
Results
Isolation of eggplant E3 ligase gene SmDDA1b
Previous research showed that SmNAC can reduce eggplant BW resistance (Na et al., 2016). Herein, the N-terminal 417bp base of SmNAC containing the NAM domain without self-activation was used as the bait protein to screen the eggplant cDNA library. SmDDA1b, 1017bp nucleic acid fragment containing E3 ubiquitin ligase gene was identified. Y2H assay of SmDDA1b and SmNAC was then conducted. AD-SmDDA1b and BD-SmNAC1-417 co-transferred to Y2H Gold developed plaque on the four amino acids deficiency medium (SD/-Leu-His-Trp-Ade). The plaque turned blue after the addition of X-α-Gal (Fig. 1A). These results indicate that SmDDA1b can interact with SmNAC.
The ORF of SmDDA1b (504bp, 167 amino acids, and molecular weight of 18.27 kDa) had DDA1 and SAP domain, belonging to E3 ubiquitin ligase of CRL4 (Supplemental Fig. S1). Fifteen representative dicotyledonous plants with sequenced genomes, including eggplant, were selected for phylogenetic analysis. Each genome was screened to obtain the homologous protein of SmDDA1b (Fig. 1B). They all contained DDA1 and SAP domains except BrDDA1b and NtDDA1b1, indicating that these domains are relatively conserved in dicotyledonous plants and may play a crucial role in the survival and evolution of plants.
SmDDA1b interacts with SmNAC in the nucleus
Subcellular localization and BiFC experiments were used to determine the position of interaction between SmDDA1b and SmNAC at the subcellular level. The fluorescence microscope showed that the nucleus of tobacco emitted green fluorescence, indicating that SmDDA1b is expressed in the nucleus (Supplemental Fig. S4). In the BiFC assay, YNE-SmDDA1b and YCE-SmNAC produced a small amount of yellow fluorescence in the nucleus when the proteasome inhibitor MG132 was not injected. However, after MG132 injection, the amount of yellow fluorescence in the nucleus increased, indicating that SmDDA1b can interact with SmNAC in the nucleus (Fig. 2A). Therefore, SmNAC could be the ubiquitination substrate of SmDDA1b.
SmDDA1b has E3 activity and interacts with SmNAC in vitro
A self-ubiquitination experiment was conducted to verify whether SmDDA1b can recognize and degrade SmNAC through the UPS. Polyubiquitination occurred when E1, E2, Ub and MBP-SmDDA1b were all present (Fig. 2B). In contrast, polyubiquitination did not occur in other groups without essential components, indicating that SmDDA1b has E3 ubiquitin ligase activity.
The ubiquitination experiment was then conducted to determine if SmNAC is the target protein of SmDDA1b in vitro. (Fig. 2C). A purified GST-SmNAC protein was added into the reaction system containing the above mixture. ZEN-BIOSCIENCE (Chengdu, China) anti-GST antibody was used for western blot (WB) analysis after the reaction was over to detect whether Ub, MBP-SmDDA1b protein, and GST-SmNAC protein were coupled. The ladder-like smear appeared only when all the necessary components were present, indicating that SmNAC polyubiquitination occurred. Therefore, SmDDA1b can ubiquitinate SmNAC in vitro.
SmDDA1b can degrade SmNAC after ubiquitination in vivo
Co-IP experiment was performed to further verify the actual ubiquitination of SmDDA1b and SmNAC protein in vivo. SmDDA1b-HA and SmNAC-GFP fusion proteins were detected in the protein complex immunoprecipitated with an anti-HA antibody. An indication that SmDDA1b-HA can immunoprecipitate SmNAC-GFP (Fig. 3A). Therefore, SmDDA1b and SmNAC can interact in vivo.
SmDDA1b-Myc and SmNAC-GFP Agrobacterium tumefaciens were subjected to tobacco transient expression experiments. Anti-GFP and anti-Ub were used for WB detection. The polyubiquitination band of SmNAC appeared when the two Agrobacterium tumefaciens were co-injected. However, anti-GFP showed SmNAC-GFP band, while anti-UB showed no band when only SmNAC-GFP was injected. Therefore, SmDDA1b can modify SmNAC via polyubiquitination in vivo (Fig. 3B).
The Agrobacterium tumefaciens containing Myc-SmNAC and SmDDA1b-GFP constructs were infiltrated into tobacco leaves for transient expression. The expression of SmNAC protein gradually decreased as the injection ratio of SmDDA1b-GFP protein increased (Fig. 3C). The results further indicate that SmDDA1b can ubiquitinate SmNAC in plants and degrade SmNAC via UPS.
Expression pattern analysis of SmDDA1b in eggplant
Analysis of SmDDA1b cDNA sequence was not significantly different between the resistant line E31 and susceptible line E32 (Supplemental Fig. S2). The qRT-PCR assay result showed the expression of SmDDA1b was expressed in the roots, stems, and leaves in both of E31 and E32. Notably, the expression level of SmDDA1b was higher in E31(R) than in E32(S) (Fig. 4A). After inoculated RSSC into E31 (R) and E32 (S), the qRT-PCR results showed that the expression level of SmDDA1b decreased within one hour in both lines. However, SmDDA1b expression rapidly increased in E31 (R) after 12 h of inoculation and was not altered in E32 (S) (Fig. 4B). Therefore, the expression level of SmDDA1b could be induced by RSSC in the resistant line E31.
At the same time, the expression of SmDDA1b in E31 also could be enhance from 0 h to 3 h and rapidly increased after 24 h by SA treatment. However, the expression of SmDDA1b in E32 decreased continuously after SA treatment (Fig. 4C). This result indicates that the expression of SmDDA1b in E31 could be induced by exogenous SA.
SmDDA1b-silenced eggplant has a decreased BW resistance
VIGS experiment was conducted to verify whether SmDDA1b is related to BW resistance. SmNAC expression was significantly increased in E31 when SmDDA1b expression was reduced (Fig. 5A). Moreover, after inoculation with RSSC, SmDDA1b-silenced lines showed clear wilt symptoms and the disease index and morbidity of the SmDDA1b-silenced lines were 70 and 100%, respectively, which were much higher than in control (Fig. 5, B-C). These results indicate that SmDDA1b positively regulates eggplant resistance to BW.
SmDDA1b overexpression enhances BW resistance and increases SA content
SmDDA1b in tomato cultivar Money Marker was over-expressed to further verify its function. The marker gene bar and qRT-PCR were used to obtain 12 T0 transgenic tomato seedlings from 60 tissue culture seedlings (Fig. 6A). Three individual plants (OET0-12, OET0-17, OET0-31-2) with good over-expression effects were selected for T1 generation propagation (Fig. 6B). Finally, 115 of the 150 individual plants containing bar gene were identified using the bar marker, and used for subsequent experiments (Supplemental Table S5). After inoculated with RSSC, the WT seedlings were wilted, while the over-expressed seedlings were partially wilted after 7 days and 14 days of inoculation, indicating that over-expressed seedlings are more resistant to BW than the WT plants (Fig. 6, C-D). Besides, the WT and over-expressed seedlings had the same onset time, and both began to show wilting symptoms on the sixth day. However, the morbidity and disease index of WT plants were significantly higher than those of the over-expressed plants after 14 days of inoculation (Fig. 6, E-F; Supplemental Table S6). Taken together, these results indicate that SmDDA1b over-expression can increase plant BW resistance.
Besides, SA content of WT and SmDDA1b over-expressing seedlings inoculated (or not) with RSSC was determined. SA content was significantly lower in WT than in over-expressed seedlings before and after inoculation, indicating that over-expression of SmDDA1b in tomato can increase SA content. The SA content of both WT and over-expressed lines was significantly increased after inoculation (Fig. 6G). Therefore, SmDDA1b can regulate plant resistance to BW by altering SA content. Moreover, the expression of SmNAC was significantly decreased in SmDDA1b over-expressed lines compared with the WT (Fig. 6H), which was consistent with the study that SmDDA1b could degrade SmNAC through UPS.
SmDDA1b indirectly and positively regulates ICS1 and SA pathway gene expression
ICS1 can synthesize SA, in order to detect whether SmDDA1b affects ICS1, the expression of ICS1 (NM_001247865.1) in SmDDA1b over-expressed and VIGS plants was analyzed. In the over-expressed plants, the expression of ICS1 was increased, and in the VIGS plants, the ICS1 expression was decreased, indicating that SmDDA1b can positively regulates the expression of ICS1 (Fig. 7A). Besides, Y2H and BiFC results of SmDDA1b and ICS1 show that SmDDA1b can not directly target ICS1 (Supplemental Fig. S5). The results deduced that SmDDA1b degrade SmNAC to positively increase activity of ICS1.
This study also analyzed the expression of hormone signal pathway-related genes in SmDDA1b over-expressed and VIGS plants. EDS1 (AY679160.1), GluA (M80604), NPR1 (NM_001247633.1), TGA (GQ386946.1), SGT1 (NM_001247758.1), PAD4 (AY753546.1) and PR-1a (M69247) were selected to assess if SA pathway signal-related genes can regulate BW resistance. The expression of SA pathway signal-related genes was significantly increased in the over-expressed plants except for PR-1a (compared with the control) (Fig. 7B). In contrast, the expression of SA pathway signal-related genes was significantly decreased in VIGS plants except for TGA (compared with the control) (Fig. 7C), indicating that SmDDA1b positively regulates the expression of SA pathway signal-related genes.
SmNAC binds to SmDDA1b promoter and significantly represses the promoter activity
In previous studies, SmNAC over-expression lines have shown decreased expression of SmDDA1b (Fig. 8A). This suggests that the activity of SmDDA1b promotor might be directly down-regulated by SmNAC. In order to verify this hypothesis, the SmDDA1b promoter sequence was obtained from eggplant genome (Barchi et al., 2021), and the elements of the promoter were predicted by PlantPAN 3.0 (Supplemental Fig. S6). It was predicted that the SmDDA1b promoter contained 24 NAC element binding sites and these sites are mostly distributed in the region of - 500 to - 1500, indicating that SmNAC may bind to SmDDA1b promoter, then the promoter was isolated and cloned (Fig. 8B; Supplemental Table S7).
Due to the self-activation of SmDDA1b promoter, the promoter was divided into three segments for yeast one-hybrid (Y1H) assay, named SmDDA1bpro-1, SmDDA1bpro-2 and SmDDA1bpro-3, respectively, and divided SmDDA1bpro-2 into pro2-1, pro2-2, pro2-3 (Fig. 8B), among them, SmDDA1b pro2-3 has self-activation (Supplemental Fig. S7). The results of Y1H showed that there was no significant difference between pAbAi-SmDDA1bpro-3 and AD-SmNAC co-transformed to Y1H Gold and the control, no yeast plaque grew on the Leucine deficiency medium (SD/-L) added with 200ng/ml Aureobasidin A (AbA). However, the pAbAi-SmDDA1bpro-1/ pro2-1/pro2-2 and AD-SmNAC co-transformed to Y1H had significant yeast plaque growth on SD/-L added with 200ng/ml ABA compared with the control, and the results remained unchanged after dilution (Fig. 8C). The results showed that SmNAC could bind to SmDDA1bpro-1, pro-2-1 and pro-2-2 regions.
In order to further verify the regulatory effect of SmNAC on the activity of SmDDA1b promoter, we carried out dual-luciferase assay. We found that the ratio of LUC / REN in the treatment group was significantly lower than that in the control group, indicating that SmNAC represses the transcription of SmDDA1b (Fig. 8, D-E). In addition, after Agrobacterium tumefaciens 35S: SmDDA1b, 35S: SmNAC and SmDDA1bpro: LUC were co-injected into tobacco, the ratio of LUC / REN increased and the inhibitory effect of SmNAC on the promoter was eliminated. After MG132 injection, the ratio of LUC/ REN decreased and the inhibitory effect of SmNAC on promoter was restored (Fig. 8E). The results showed that SmDDA1b could degrade SmNAC through UPS, and the increase of SmDDA1b content could weaken or even remove the inhibitory effect of SmNAC on SmDDA1b promoter.
Discussion
E3 ubiquitin ligase and NAC (NAM-ATAF-CUC1/2) transcription factors are crucial in plant disease resistance. The E3 ligase has a complex plant disease resistance regulation, including positive and negative regulation. Besides, some interact with pathogens or post-translational modifications of other proteins to directly or indirectly regulate plant disease resistance (Miao et al., 2016; Wang et al., 2020; Karki et al., 2021). For instance, MIEL1 is a RING-type E3 ligase, negatively regulating defense response in Arabidopsis (Marino et al., 2013). The E3 ligase NbUbE3R1 positively regulates the immune response in tobacco. Furthermore, the replicase of Bamboo mosaic virus (BaMV) could be a substrate of NbUbE3R1 (Chen et al., 2019). RING-type E3 ligase, VIM5, can target and degrade DNA methyltransferases MET1 and CMT3 through the 26S proteasome. Beet severe curly top virus can induce VIM5 expression and activate the C2 and C3 genes of the geminivirus to make the plant susceptible (Chen et al., 2020).
NAC, as a unique family of transcription factors in plants, is essential at multiple levels of transcription, post-transcriptional and post-translational modification (Zhu et al., 2016; Zhang et al., 2018; Li et al., 2019; Liu et al., 2020). Studies have shown that E3 ligase can interact with NAC transcription factors (Yoshii et al., 2010). SINA protein also has E3 ubiquitin ligase activity (Wang et al., 2018). The RING-type E3 ligase SINAT5 can ubiquitinate the NAC transcription factor AtNAC in Arabidopsis (Xie et al., 2002). Miao et al. (2016) indicated that SINA can recognize and degrade NAC1 in tomato through the UPS, negatively regulating the role of plant defense signals.
Herein, SmDDA1b ubiquitinated SmNAC in vivo and in vitro, promoting its degradation through UPS. However, E3 ubiquitin ligase and NAC transcription factor are only one aspect of this mechanism. Besides targeting SmNAC, SmDDA1b may also target other factors that can negatively regulate eggplant BW resistance via ubiquitination and degradation. Therefore, future research should focus on the regulation network of resistance to BW.
Plants balance their gene expression and control the role of E3 ligase and NAC transcription factors when there is no biological stress. Previous studies have shown that transcription factor, the target protein of E3 ligase, can also bind to the promoter element of E3 ligase to control the expression activity of E3. Tong et al. (2021) found that Populus U-box E3 ligase PalPUB79 degraded PalWRKY77 through ubiquitination, at the same time, PalWRKY77 can bind to the PalPUB79 promoter to represses the expression of PalPUB79 under normal conditions. In tartary buckwheat (Fagopyrum tataricum, TB), the E3 ligase FtBPM3 target protein FtMYB11 can also bind to the FtBPM3 promoter and directly represses the expression of FtBPM3 gene (Ding et al., 2021). Herein, SmNAC bind to the promoter element of SmDDA1b and negatively regulate SmDDA1b. This regulation effect can inhibit the degradation of SmNAC and thus maintaining the stability of SmNAC protein and E3 ligase.
SA and SA signaling pathway genes regulate each other. EDS1 can cause the initial accumulation of SA and interact with PAD4 to cause further accumulation of SA, which is located upstream of the signaling pathway (Feys et al., 2001; Wildermuth et al., 2001; Cui et al., 2017). NPR1 acts downstream of the SA signaling pathway and directly affects the SA content (Ding et al., 2018). SA also promotes the expression of SA signal pathway genes through positive feedback, thereby rapidly amplify SA signals (Wiermer et al., 2005; Wu et al., 2012; Oh et al., 2014). Herein, SmDDA1b overexpressed caused the increase of SA content and the relative expression level of signal genes in SA pathway, while SmDDA1b was silenced, the expression of signal genes was decreased, indicating that our research results are consistent with previous research results.
Different signaling pathways interact to form complex signal networks. Plants regulate different defense signal transduction pathways through this signal network to obtain higher stress tolerance (Derksen et al., 2013; Checker et al., 2018). Recent studies have also shown that E3 ligase CUL3BPM can target MYC2, MYC3, and MYC4, reduce the abundance of MYC protein, and regulate the JA pathway (Chico et al., 2020). Moreover, RING-type E3 ligase KEG can positively regulate the expression of the JA pathway signal-related gene JAZ12 (Pauwels et al., 2015). SA and JA signals are mutually antagonistic (Adams and Spoel, 2018; Nakano and Mukaihara, 2018). Other hormones may also regulate SmDDA1b and should be further verified.
Herein, SmDDA1b was first decreased, then increased in the resistant plants after inoculation with RSSC. SmDDA1b first decreased, then leveled off in the susceptible plants after inoculation with RSSC. The inhibition may be related to the immune response of plants and pathogenic effectors. The innate immune system of plants (the immune response stimulated by pathogen-related molecular patterns, pattern-triggered immunity (PTI), and effector proteins, effector-triggered immunity (Hernández and Sanan-Mishra)) respond during pathogen invasion. PTI is a nonspecific basic defense response, while ETI is a specific response induced by the plant resistance protein to recognize pathogens (Nakano et al., 2017). During pathogen invasion, plants first induce PTI, after which the pathogen releases effectors to inhibit PTI, decreasing SmDDA1b expression in both resistant and susceptible plants. Plants then exert an ETI response to inhibit effectors, increasing the SmDDA1b expression in disease-resistant plants.
E3 ubiquitin ligase may target the pathogenic effector. Studies have shown that UPS can specifically recognize pathogenic effectors in plants and play a role in plant-pathogen interactions (Zhang et al., 2011; Li et al., 2014; Zhang et al., 2020). Drugeon and Jupin (2002) showed that UPS can target the motor protein 69k of turnip yellow mosaic virus (TYMV) and regulate its activity in vitro. The RING-type E3 ligase NtRFP1 can mediate the degradation of geminivirus-encoded βC1 in tobacco (Shen et al., 2016). RSSC contains various secretion systems but mainly exerts its effects through the type III secretion system (T3SS). T3SS can influence the host to cause plant diseases or hypersensitivity response (HR) (Lindgren, 1997; Poueymiro and Genin, 2009). Therefore, E3 can target the virulence genes and effectors of RSSC and degrade them via ubiquitination to improve eggplant resistance, based on the specificity of SmDDA1b for the defense response of RSSC. However, further studies are needed to verify the above phenomenon.
Conclusions
In summary, this study constructed a SmDDA1b-SmNAC-SA pathway regulatory module and showed that SmDDA1b can degrade SmNAC through UPS to enhance BW resistance. Under normal conditions, SmNAC represses the transcription of both SmDDA1b and ICS1 to maintain the immune balance of plants, endogenous SA levels are low in eggplant (Fig. 9A). However, SmDDA1b gene was up-regulated after inoculating disease-resistant plants with RSSC, thus decreasing SmNAC expression and the inhibitory effect on SmDDA1b decreased, and then increasing ICS1 expression, SA content and BW resistance (Fig. 9B). Besides, SmDDA1b could not target ICS1 directly.
Plant defense against pathogens involves complex mechanisms and many aspects. At the same time, the importance of SA for plant disease resistance is self-evident. Therefore, future researches should explore: screening of E3 ubiquitin ligase genes that can interact with SmNAC except SmDDA1b; whether SmDDA1b can interact with pathogenic effector proteins to degrade it via ubiquitination; SmDDA1b can ultimately regulate the content of SA, whether SmDDA1b has the function of resisting other diseases, or regulating plant resistance and growth and development.
Materials and Methods
Experimental materials
This study used two eggplant inbred lines, E31 (resistant to BW, R) and E32 (susceptible to BW, S) (Supplemental Fig. S3; Supplemental Table S4). Tomato, tobacco, and RSSC strain used included Money Maker, Nicotiana benthamiana, and GMI1000, respectively.
Data analysis
Total RNA isolation, complementary DNA (cDNA) synthesis, and real-time reverse transcription-PCR (qRT-PCR) were performed using previously described methods (Qiu et al., 2019). The relative expression amount was calculated using the 2-Δct and 2-ΔΔct methods (Livak and Schmittgen, 2001). 18SrRNA was used as the reference gene. qRT-PCR primers are listed in Table S2.
Phylogenetic analysis and sequence alignment
DDA1 containing sequences of 15 dicotyledonous plants (including eggplant) were obtained by scanning whole-genome protein sequences (Supplemental Table S3) from the NCBI RefSeq database (O’Leary et al., 2016) using Hmmserch v3.3 (Eddy, 1998). Mafft v7.455 was used to align sequences (Katoh and Standley, 2013). Iqtree v1.6.12 (Nguyen et al., 2015) was then used to construct a phylogenetic tree. Sequence alignment was performed in DNAMAN (version 7.0; Lynnon Biosoft, Quebec, Canada).
Subcellular localization analysis
The full-length coding sequence of SmDDA1b without the stop codon was cloned into the Age I site of the pEAQ-EGFP vector (Sun et al., 2020). The recombinant vector was introduced into Agrobacterium tumefaciens (strain GV3101(pSoup)) and mixed with Agrobacterium tumefaciens with DsRed protein (v: v, 1: 1) (Sun et al., 2020). The nuclear-localized signal (NLS) was fused to DsRed as a nuclear marker. The mixture was injected into Nicotiana benthamiana, then incubated at 22 °C for three days in the dark. A confocal fluorescence microscope (Carl Zeiss, Germany) was used to visualize green fluorescent protein (GFP) fluorescence. The experiment was repeated at least thrice. The primers are listed in Table S1.
Pathogen inoculation
Inoculation with RSSC was performed as described in our previous study with some modifications (Qiu et al., 2019). Briefly, RSSC was grown in a TTC medium (Lemessa and Zeller, 2007) at 30 °C for two days. The concentration of the inoculum was then determined using a spectrophotometer, and OD600 was adjusted to 0.6. Four- to five-day-old seedlings were inoculated by wounding the roots, then incubated in the bacterial suspension for 20 min before transplanting. The entire experiment was conducted under control conditions (30 °C, 16 h of light, and 24 °C, 8 h of dark). The control group was treated with water. Samples (three biological replicates each) were taken at 0 h, 1 h, 3 h, 6 h, 12 h and 24 h.
Hormone treatment
The four- or five- euphyllas- old eggplant seedlings were treated with 1mM SA and sprayed every 12 hours (Jia et al., 2013; Hussain et al., 2018; Mahesh and Sharada, 2018). The control group was treated with water, then planted at 26 °C, 16 h light, and 22 °C, 8 h dark. Samples (three biological replicates each) were obtained at 0 h, 2 h, 6 h, 12 h, 24h and 48 h.
Virus-induced gene silencing (VIGS) assays
The specific fragments of about 300 bp from SmDDA1b were cloned into EcoR I and Sma I sites of the pTRV2 vector. pTRV2-SmDDA1b, pTRV2, and pTRV1 vectors were then transferred into the Agrobacterium tumefaciens strain GV3101. pTRV1 mixed with pTRV2 or pTRV2-SmDDA1b (v: v, 1: 1) were infiltrated into four- or five-day-old seedlings using a 1 mL needleless syringe. After injection, the samples were treated at 16 °C in the dark for one day and then planted normally for 1-2 weeks (26 °C, 16 h light, 22 °C, 8 h darkness). Each treatment had at least 10 biological replicates. Primers are shown in Table S1.
Construction of the SmDDA1b overexpression vector and transformation procedures
The forward primer 5’-gagaacacgggggactctagaATGGAGGATACCTCATCATCCATT-3’ and the reverse primer 5’-gtggctagcgttaacactagtTCATGTGTCCCCCCTTAACCG-3’ were used to amplify the full-length SmDDA1b and cloned into Xba I and Spe I of the pCAMBIA-1380 vector, then transfected into the Agrobacterium strain GV3101. The resulting overexpression vector, pCAMBIA-1380-SmDDA1b, containing the CaMV35S promoter, Nos terminator, and the bar marker gene (5’-end primer ATGAGCCCAGAACGACGCCCG, 3’-end primer TTAGATCTCGGTGACGGGCAGGACC) were then transformed into tomato Money Marker. The transgenic plants were generated as described by Qiu et al. (2016).
Salicylic acid (SA) extraction and quantification
The leaves from SlDDA1b-overexpressed lines and non-transgenic lines (wild type) before and after inoculation with RSSC were used for SA extraction and determination. SA extraction and quantification were performed as previously described by Ma et al. (2018).
Yeast two-hybrid (Y2H) assay
The full-length SmDDA1b was cloned into EcoR I and BamH I sites of the pGADT7 vector. The other genes or fragments, including the N-terminal 417 bases of SmNAC, which did not exhibit autoactivation, and the full-length ICS1 without the stop codon, were ligated into the pGBKT7 vector to generate baits. The specific primers and corresponding construction vectors are shown in Table S1. The experiment was conducted following the manufacturer’s instructions (Cat. No. 630489; Clontech, Mountain View, CA, USA).
Bimolecular fluorescence complementation (BiFC) analysis
The full-length SmDDA1b without the stop codon was cloned into Sal I and BamH I sites of the pSPYNE-35s / pUC-SPYNE (YNE) vector containing the N-terminal of yellow fluorescence protein (YFP). The other genes without the termination codon were ligated into the pSPYCE-35s / pUC-SPYCE (YCE) vector containing the C-terminal of YPF. The construct was introduced into Agrobacterium tumefaciens GV3101(pSoup). The samples were mixed with Agrobacterium tumefaciens harboring DsRed protein (v: v: v, 1: 1: 1) injected into Nicotiana benthamiana, then planted at 22 °C for three days in the dark. Proteasome inhibitor MG132 (50 μM) was injected (Marques et al., 2009). A confocal fluorescence microscope (Carl Zeiss, Germany) was used to visualize GFP fluorescence. The experiment was repeated at least thrice. The primers are listed in Table S1.
In vitro ubiquitination
The full-length SmNAC and SmDDA1b were cloned into pGEX-4T and pMAL-c2X vector at Sal I and Xho I sites, respectively. The constructs were then transferred to BM Rosetta (DE3). The ubiquitination reaction mixture (30 μL) contained 600 ng GST-SmNAC protein, 600 ng MBP-SmDDA1b protein, 20× prepared reaction buffer (1 mM ZnCl2, 200 mM MgCl2, 1 M Tris-HCl, 20 mM ATP, 4 mM DTT, 200 mM creatine phosphate), 0.1 unit creatine kinase (Sigma, USA), 50 ng E1 (Boston Biochem, USA), 250 ng E2 (Boston Biochem, USA). Sterile water was added to make up the solution to 30 μL. The reaction was conducted at 37 °C for 60-90 min. A 7 μL of 5×Loading buffer was added to a 95 °C water bath for 5 min. The sample was then centrifuged at 10000 rpm for 1 min to obtain supernatant for SDS-PAGE electrophoresis. Western blot was conducted as described by Na et al. (2016). anti-GST (ZEN-BIOSCIENCE, China) antibody was used. Primers are listed in Table S1.
In vivo ubiquitination
The full-length SmNAC and SmDDA1b were constructed into Hind III and Sal I sites of pC1307-35S-Myc and pC2300-35S-GFP vectors, respectively. The extracted plasmids were transferred into GV3101. The supernatant of Agrobacterium tumefaciens (OD600= 0.6) was resuspended in infection buffer (10 mM MgCl2, 10 mM MES (pH 5.6), 100 μM AS) solution and allowed to stand for 2-5 h. Myc-SmNAC was then injected into Nicotiana benthamiana. SmNAC expression was unchanged (OD600=0.4), while the injection ratio of SmDDA1b was gradually increased (OD600=0-0.4). The samples were incubated at 22 °C for 2 d, and then western blot analysis was conducted.
The SmNAC-GFP and SmDDA1b-Myc vectors were constructed and transformed into GV3101. The Agrobacterium tumefaciens (OD600= 0.6) was resuspended in infection buffer and allowed to stand for 2-4 h. The injection of tobacco with Agrobacterium tumefaciens liquid of SmDDA1b-Myc and SmNAC-GFP was set as control. Only SmNAC-GFP was injected in the treatment group. Western blot analysis was conducted after incubation at 22 °C for two days. The antibodies used were anti-GFP and anti-Ub. Primers are shown in Table S1.
Co-immunoprecipitation (Co-IP) assay
The full-length SmDDA1b was cloned into pAC004-HA vector to produce SmDDA1b-HA antibody, and SmNAC was cloned into pAC402-GFP vector. The Agrobacterium tumefaciens with GFP-tagged empty plasmid, SmNAC recombinant plasmid, and HA-tagged SmDDA1b recombinant vector was diluted in infection buffer to OD600=1.2. pAC402-X (Vec or SmNAC) and pAC004-SmDDA1b (v:v, 1: 1) was then added to the sample to co-infect tobacco. The samples were obtained after 48 h of infection, then lysed to obtain input. Western blot was used to detect the expression. GFP-Trap agarose magnetic beads with immobilized GFP antibody were used to incubate the protein at 4 °C for 1 h. The beads were put on a magnetic stand for 1 min and washed twice with the wash buffer (50 mM Tris-HCl, 5 mM EDTA, 250 mM NaCl, 1 mM PMSF, 10% glycerol, pH 7.5). A loading buffer was added, then boiled and centrifuged to obtain supernatant (IP sample). Western blot was used to check. Primers are listed in Table S1.
Promoter isolation and element prediction
Download the eggplant genome data from Sol Genomics NetWork (https://solgenomics.net) (Barchi et al., 2021). TBtools v1.09852 (Chen et al., 2020) was used to blast the genome to find out the SmDDA1b gene, the 1474bp fragment before the SmDDA1b gene was taken as the promoter sequence, and Primerstar (Takara, Beijing) was used to clone the promoter. PlantPAN 3.0 (http://plantpan.itps.ncku.edu.tw) (Chow et al., 2019) was used to predict the position of the NAC element on the promoter. Primers are shown in Table S1.
Yeast two-hybrid (Y1H) assay
The full-length coding sequence SmNAC was cloned into pGADT7. The promoter fragment of SmDDA1b was ligated into the pAbAi vector to generate baits. The Y1H experiment was carried out according to the manufacturer’s protocol for the Matchmaker Gold Y1H library screening system (Clontech, USA). The primers are listed in Table S1.
Dual-luciferase assay
The 1474 bp promoters of SmDDA1b was inserted into the pGreen II 0800-LUC vector as reporters, while pGreenII 62-SK-SmNAC, pGreenII 62-SK-SmDDA1b and empty pGreenII 62-SK served as effectors. The Agrobacterium tumefaciens strain GV3101 containing the corresponding effectors and reporters (v: v, 20: 1) were infiltrated into healthy N. benthamiana leaves. After incubation for 24-36 h, MG132 (50 μM) was injected into leaves. After incubation for three to four days, the firefly LUC and Renilla LUC activities were measured by Dual Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai) and Cytation 5 Cell Imaging Multi-Mode Reader (BioTek, USA). Activity is expressed as the ratio of firefly LUC activity to Renilla LUC activity. The primers are listed in Table S1.
Accession numbers
The GenBank accession number of SmDDA1b: MZ736671.
Supporting Information
Fig. S1. SmDDA1b gene and amino acid sequence.
Fig. S2. SmDDA1b gene cDNA sequence in E31 and E32.
Fig. S3. Detection of disease resistance of E31 and E32 to Ralstonia solanacearum species complex (RSSC).
Fig. S4. The subcellular localization results of SmDDA1b.
Fig. S5. There is no interaction between SmDDA1b and ICS1.
Fig. S6. SmDDA1b promotor sequence.
Fig. S7. SmDDA1bpro-2-3 has self-activation.
Table S1 List of primers.
Table S2 List of primers used for qPCR.
Table S3 A statistical table of 14 species and their genome accession numbers used in the SmDDA1b phylogenetic tree except for eggplant.
Table S4 List of plant incidence rate and disease index for testing the resistance of E31 and E32 to Ralstonia solanacearum species complex.
Table S5 List of bar gene test results of T1 generation.
Table S6 List of plant incidence rate and disease index in overexpression experiment.
Table S7 List of NAC transcription factor binding sites.
Acknowledgements
We thank Lianhui Zhang (South China Agricultural University) for providing GMI1000 strain.
Footnotes
E3 ubiquitin ligase degrades the negative regulator of SA synthesis and enhances plant disease resistance.
↵1 Y.W., S.Y. and B.Y. performed the research; B.C., Z.Q. and J.L. designed the research; C.C., Y.G. and Z.Z. provided new reagents; Y.W. and B.Y. analyzed the data; and Y.W., Z.Q. and B.C. wrote the manuscript.
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (https://academic.oup.com/plphys/pages/general-instructions) is: Zhengkun Qiu (qiuzhengkun{at}scau.edu.cn) and Bihao Cao (caobh01{at}163.com).
This research was funded by the Key Project of Guangzhou (202103000085), Fruit and Vegetable Industry System Innovation Team Project of Guangdong (2021KJ110), and the National Natural Science Foundation of China (31672156).