Abstract
Treating immunosuppressive tumors represents a major challenge in cancer therapies. Activation of STING signaling has shown remarkable potential to invigorate the immunologically ‘cold’ tumor microenvironment (TME). However, we and others have shown that STING is silenced in many cancers, including pancreatic ductal adenocarcinoma (PDAC) and Merkel cell carcinoma (MCC), both of which are associated with an immune-dampened TME. In this study, we applied mRNA lipid nanoparticles (LNP) to deliver a permanently active gain-of-function STINGR284S mutant into PDAC and MCC cells. Expression of STINGR284S induces cytokines and chemokines crucial for promoting intratumoral infiltration of CD8+ T cells and, importantly, also leads to robust cancer cell death while avoiding T cell entry and toxicity. Our studies demonstrated that mRNA-LNP delivery of STINGR284S could be explored as a novel therapeutic tool to reactivate antitumor response in an array of STING-deficient cancers while overcoming the toxicity and limitations of conventional STING agonists.
Introduction
Tumor immune suppression represents a major obstacle in achieving effective cancer immunotherapy. This is a clinical challenge present in many human malignancies, including pancreatic cancer. Pancreatic cancer causes the death of around 430,000 patients per year and persists as one of the deadliest malignancies in the world [1–4]. Few effective treatments are available for patients with advanced pancreatic cancer [5]. Nearly 98% of pancreatic cancer patients are also resistant to PD-1/PD-L1 immune checkpoint blockade therapies [6–9]. Thus, there is a significant unmet need for developing more effective therapies targeting this highly lethal cancer.
Pancreatic cancer often establishes a highly immunosuppressive tumor microenvironment (TME), which hinders retaliation by the host immune system and resists immunotherapies [2, 10]. Therefore, cases of this cancer are traditionally classified as non-immunogenic “cold” tumors [2,10,11]. Typically, tumor-infiltrating CD8+ cytotoxic T cells are strongly associated with patient survival. However, the majority of pancreatic cancers lack successful infiltration of effective CD8+ T cells in the TME [11–13]. Poor intratumoral T cell infiltration and activation present a major hurdle for developing effective immunotherapies, revealing the need for novel therapeutic strategies.
In our previous studies, we discovered that repression of Stimulator of interferon genes (STING) is a key factor underpinning the immunologically “cold” TME of Merkel cell carcinoma (MCC) [14], which is another highly aggressive cancer with over 30% of patients showing metastatic disease at first presentation [15, 16]. STING is a key regulator of innate immune signaling and antitumor responses [17–20]. The canonical role of the STING signaling pathway is to sense cytoplasmic double-stranded DNA (dsDNA) including host cytoplasmatic chromatin, mitochondrial DNA, and foreign dsDNA such as viral dsDNA. These DNA molecules are recognized by cyclic GMP-AMP synthase (cGAS), which in turn synthesizes 2′3′-cGAMP that can bind to and activate STING. After stimulation by pathogen- or damage-associated molecular patterns (PAMPs or DAMPs), STING activates the transcription of type I and III interferons (IFNs) and other pro-inflammatory cytokines to initiate the innate immune response [21–24]. Cancer cells often maintain abundant damaged DNA, which can also stimulate STING-dependent induction of IFNs and several other anti-tumor cytokines/chemokines including CXCL10 and CCL5 [17,20–23]. Among the molecules activated by STING signaling, IFNs can stimulate the generation of anti-tumor T cells, T-cell infiltration, and the direct killing of cancer cells [25–27], whereas CXCL10 and CCL5 are important for recruiting tumor-reactive effector T cells [17-20,28-30]. Therefore, activation of the STING signaling pathway has demonstrated great promise to trigger a switch in the TME of tumors from an immune suppressed ‘cold’ environment to an immune activated ‘hot’ environment [14,17–20,29–36].
We recently discovered that STING is silenced in MCC and that reactivating STING stimulates antitumor inflammatory cytokine/chemokine production, cytotoxic T cell infiltration and activation, and eradication of MCC cells [14]. Our studies in MCC provide proof-of-principle data to support the hypothesis that targeted reactivation of STING can bolster antitumor cytotoxicity and invigorate the immune-dampened TME in STING-silenced and immunologically ‘cold’ tumors. We also found that STING is silenced or downregulated in a number of other types of cancers, such as pancreatic ductal adenocarcinoma (PDAC) [14]. In this study, we set out to develop new strategies to reactivate STING signaling in order to bolster antitumor immunity and enforce tumor immunogenicity in STING-silenced PDAC cancer.
In light of the recent findings on the antitumor functions of the cGAS-STING pathway, several STING agonists have been developed to stimulate anti-tumor immune responses, including the activation of CD8+ T-cells and natural killer cells, and to induce tumor regression in multiple mouse tumor models [19,32,36–38]. However, clinical trials of these STING agonists did not show beneficial results [39, 40]. The contradicting outcomes between mouse tumor models and human clinical trials might be associated with the distinct levels of STING gene expression in these different tumors. While STING is highly expressed in many mouse tumor cell lines, such as CT26 [41] and B16-F10 [42], it is silenced in several human cancers as demonstrated in studies from our group and others [14,20,43]. It has also been shown that B16-F10 STING knockout cells were more resistant to immunotherapy [42]. Thus, although STING has been shown to be a promising target for cancer therapies, STING agonists might be of little benefit in STING-deficient tumors.
To overcome the limitations of traditional STING agonists, which do not work in STING-silenced cancers [36,44,45], we explored the idea of introducing naturally occurring constitutively active gain-of-function STING mutants [46, 47] into STING-silenced immunologically “cold” PDAC to reactivate antitumor immunity. STING gain-of-function mutations have emerged in multiple systemic autoinflammatory diseases, including STING-associated vasculopathy with onset in infancy, systemic lupus erythematosus-like syndromes, and familial chilblain lupus diseases [46–61]. These mutations support constitutively hyperactive STING activity, which induces an excessive IFN response that attracts and amasses proinflammatory cells to cause autoimmune disease symptoms [46-51,54,56-60]. We therefore hypothesized that these gain-of-function STING (‘hot’ STING) mutants could be leveraged to activate the STING signaling pathway for treating STING-deficient cancers. In this study, we explored the idea of harnessing these permanently active ‘hot’ STING mutants to ‘heat up’ STING-deficient immunologically ‘cold’ cancers.
We first discovered that the expression of the STINGR284S mutant in PDAC cells robustly activates the STING signaling pathway. To further develop a ‘hot’ STING cancer therapy, we generated lipid nanoparticles (LNP) to deliver STINGR284S mRNA into cells. We observed that the LNP-delivered STINGR284S mRNA could vigorously reactivate anti-tumor cytokine production and induce cancer cell death in STING-silenced PDAC and MCC cells. Moreover, because T cells are intrinsically resistant to exogenous mRNA delivery by LNP, STINGR284S mRNA-LNP do not introduce T cell cytotoxicity, which could normally be induced by traditional STING agonists. Our results suggest that STINGR284S mRNA-LNP can overcome the toxicity and limitations of conventional STING agonists and therefore could be exploited as a new therapeutic approach for treating an array of STING-deficient cancers that are refractory to current therapies.
Results
STING is downregulated in some PDAC lesions
We recently discovered that STING expression is absent in MCC and several other cancer cells, including a number of PDAC cell lines [14]. Following up on that study, we analyzed the STING protein levels in several PDAC cell lines and patient lesions (Fig. 1). From the cell line analysis, we found that STING protein is scarce in AsPC-1, PANC-1, and Capan-1 cells, and virtually undetectable in MIA PaCa-2, as compared with primary human dermal fibroblasts (HDFs). In contrast, the levels of cyclic GMP-AMP synthase (cGAS), the upstream activator of STING, are clearly detected in all the tested cell lines (Fig.1A). To confirm these observations, we co-stained STING protein and the PDAC marker CK19 [62] to examine the STING protein level in PDAC tumor lesions. STING was nearly untraceable in three out of the seven lesions, including those from patients #1780, #4476, and #4021. An interesting observation was made for the lesions isolated from patients #T5_1589 and #3917: while STING signal was detected in CK19- cells, it was found to be specifically silenced in CK19+ cells (Fig.1B). The rest of the PDAC lesions, from patient #3791 and patient #1832, indicate normal STING protein level (Fig.1B). These results demonstrate that STING expression could be silenced or repressed in certain PDACs and there appeared to be a pattern of tumor cell-specific repression in some PDAC lesions. Our finding suggests that STING downregulation may contribute to the immunologically ‘cold’ TME in some PDACs.
Identification of a highly active STING gain-of-function mutant
We then set out to establish a new approach for reactivating the STING signaling pathway in STING-silenced cancers using STING gain-of-function genetic mutants. Several single amino acid STING gain-of-function mutants have been identified in autoinflammatory diseases. Among these, the STINGV147L, STINGN154S, STINGV155M, and STINGR284S mutants have demonstrated high activity in stimulating downstream innate immune signaling [46,47,60]. Thus, they offer an exciting opportunity to create a simple approach to reactivate the STING signaling pathway. We therefore tested whether these gain-of-function mutants could be used to reignite the anti-tumor activities of the STING signaling pathway in cancer cells. To screen the capability of these STING gain-of-function mutants to inhibit tumor proliferation, we constructed MIA PaCa-2 cells stably expressing either doxycycline (dox)-inducible wild type (WT) STING or one of the STING mutants. Expression of the STINGR284S mutant in MIA PaCa-2 cells significantly increased the expression of the early cell death marker cleaved caspase-3 (Fig. 2A) and also inhibited cell proliferation, likely by escalating the number of cells going through cell death (Fig. 2B). In contrast, expression of STINGWT and the other STING gain-of-function mutants did not induce such an effect. Notably, all the STING gain-of-function mutants showed lower signal than WT STING (Fig. 2A). This is consistent with previous studies showing that activated STING proteins are quickly degraded [63–65]. Based on the result of this experiment, we selected the STINGR284S mutant for our further studies.
Ectopic expression of dox-inducible STINGR284S induces key anti-tumor cytokine production and cell death in PDAC cells
Our previous study showed that reactivation of the STING signaling pathway not only induces cell death but also generates robust expression of anti-tumor cytokines, such as IFNs, CXCL10, CCL5, and IL6 [14]. To examine whether the STINGR284S mutant has the same downstream function, we constructed PDAC cell lines MIA PaCa-2 and BxPC-3 stably expressing dox-inducible STINGWT or STINGR284S. STING expression was efficiently induced by dox treatment in both stable cell lines (Fig. 3A-B, Fig. S1A-B). Compared to STINGWT, dox-induced STINGR284S stimulated the expression of STING downstream anti-tumor cytokines, such as CCL5, CXCL10, IL29, IL6, IFNβ and TNFα (Fig.3C, Fig. S1C). Moreover, compared to un-induced cells and cells expressing dox-induced STINGWT, expression of STINGR284S increased the level of cleaved caspase-3 (Fig. 3A, Fig.S1A) and drastically inhibited the proliferation of these cancer cells (Fig. 3D, Fig. S1D). These results demonstrate that the STINGR284S mutant can provoke key anti-tumor cytokine production and cause widespread PDAC cancer cell death. In the in vivo setting, tumor cells killed by STINGR284S expression could release significant quantities of tumor antigens as well as DNA to activate T cells and amplify both innate and adaptive antitumor responses [66]. Our findings therefore indicate that introducing STINGR284S into tumor cells may be a viable therapeutic strategy for treating STING-deficient cancers.
A novel approach to reactivate the STING signaling pathway
We faced a challenge when designing a strategy to deliver the STINGR284S mutant into tumor cells as an anticancer therapeutic agent. Viral vectors cannot be used to carry the ‘hot’ STINGR284 mutant because activation of the STING signaling pathway blocks packaging of many viral-derived vectors [64,67,68]. On the other hand, mRNA-LNP has emerged as a powerful tool for delivering gene expression in cancer cells [69] and also as strong T Helper 1 (Th1) biased adjuvants [70]. Importantly, nucleoside-modified mRNA-LNP can quickly produce abundant protein in target cells while avoiding the host innate immune response [70–81]. Moreover, LNP can be used to package the ‘hot’ STINGR284 mutant mRNA in vitro without activation of the host STING signaling pathway [71, 82]. As a first step to test this strategy, we generated mRNAs encoding STINGR284S and STINGWT and transfected them into PDAC cells. Compared to mock- transfected cells, robust STING expression was detected in STINGWT and STINGR284S mRNA-transfected PDAC cells (Fig. 4A-B, Fig. S2A-B). However, only STINGR284S mRNA, not STINGWT mRNA, stimulated the production of anti-tumor cytokines, such as CCL5, CXCL10, IL29, IL6, IFNβ, and TNFα (Fig. 4C, Fig. S2C). In addition, unlike STINGWT mRNA, transfection of STINGR284S mRNA significantly elevated the level of cleaved caspase-3 and reduced the cancer cell proliferation rate appreciably (Figs. 4A, 4D, S2A, S2D). These results show that transfection with STINGR284S mRNA can specifically stimulate the STING signaling pathway to produce essential anti-tumor cytokines and kill cancer cells.
STINGR284S expression delivered by mRNA-LNP activates vital anti-tumor cytokines and induces PDAC cell death
To further develop a therapeutic approach, we tested whether LNP can be used to deliver the STINGR284S mRNA into cancer cells. The LNP we exploited in this study have been shown to efficiently deliver genes in vivo [83]. However, we did not observe significant expression of STINGWT and STINGR284S in MIA PaCa-2 and BxPC-3 cells treated with the respective mRNA-LNP (Figs. 5A and S3A, rows 2, 5). We reasoned that this could be due to a lack of Human Apolipoprotein E (APOE) in our in vitro cultures. In the in vivo setting, APOE plays an important role in the cellular uptake of physiological lipoproteins through binding to low-density lipoprotein (LDL) receptors [84, 85]. When mixed with mRNA-LNP before transduction, human APOE4 has been shown to radically increase mRNA-LNP transduction efficiency in vitro [84, 85]. We therefore tested whether mixing STINGWT or STINGR284S mRNA-LNP with APOE4 could facilitate the delivery of mRNA into PDAC cells. We found that APOE4 robustly stimulates the delivery of mRNA-LNP into PDAC cells in a dose-dependent manner (Fig. 5A, Fig. S3A). Compared to untreated cells, higher levels of STINGWT and STINGR284S mRNA were detected by RT-PCR in cells treated with a combination of mRNA-LNP and APOE4 (Fig. 5B, Fig. S3B). The combined treatment of STINGR284S mRNA-LNP and APOE4 also significantly augmented the expression of key anti-tumor cytokines, such as CCL5, CXCL10, IL29, IL6, and TNFα, as compared with treatment using only STINGWT mRNA (Fig.5C, Fig. S3C). Moreover, LNP-delivered STINGR284S mRNA not only induced the production of cleaved caspase-3 in PDAC cells, but also significantly inhibited the proliferation of these cells (Figs. 5A, 5D, S3A, S3D). Importantly, the same treatment did not repress the proliferation of CD8+ T cells (Fig. S3E) (see discussion). These results demonstrate that human APOE4 can efficiently promote the delivery of mRNA-LNP into target cells, allowing the robust expression of ‘hot’ STINGR284S to induce essential anti-tumor cytokines and eradicate cancer cells.
STINGR284S mRNA-LNP also trigger vital anti-tumor cytokine production and cell death in MCC cells
We recently found that STING is also silenced in some MCC tumors [14]. 80% of MCCs have integrated Merkel cell polyomavirus (MCPyV) genomes [86]. Our previous studies showed that STING is specifically repressed in MCPyV+ MCC cell lines [14]. By analyzing published RNA-seq data [87], we discovered that while STING is amply expressed in the MCPyV- MCC cell line UISO, STING RNA expression levels are nearly undetectable in all six classic MCPyV+ MCC cell lines: MKL-1, MKL-2, MS-1, WaGa, PeTa, and BroLi (Fig.S4A). The RNA-seq data also indicated that when compared with other MCPyV+ MCC cell lines, STING RNA expression is slightly higher in PeTa cells (Fig.S4A) [87]. However, Western-blot analysis reveals that, similar to MKL-1 cells, STING protein expression in PeTa cells is completely imperceptible (Fig. S4B). This study therefore confirmed that STING expression is suppressed in all of the classic MCPyV+ MCC cell lines we have examined.
Encouraged by the observed antitumor activity of the STINGR284S mRNA-LNP in PDAC cells, we tested whether our LNP approach could be applied to stimulate the same positive response in MCC cells. We first optimized the mRNA-LNP delivery conditions for MCC cells using firefly luciferase mRNA-LNP. We ascertained that 10 ug/ml of human APOE4 was also the ideal concentration for delivering mRNA-LNP into MCC cells (Fig. S5). When compared with the untreated MKL-1 and MS-1 MCC cells, robust STING expression was detected in both STINGWT and STINGR284S mRNA-LNP- treated cells (Figs. 6A-B, S6A-B). However, only delivery of STINGR284S mRNA-LNP, and not STINGWT mRNA-LNP, stimulated expression of the key anti-tumor cytokines CCL5, CXCL10, IL29, IL6, IFNβ, and TNFα (Figs. 6C, S6C). Compared to STINGWT mRNA-LNP, treating MCC cells with STINGR284S mRNA-LNP also elevated the level of cleaved caspase-3 and greatly inhibited cell proliferation (Figs. 6A, 6D, S6A, S6D). These results demonstrated that the STINGR284S mRNA-LNP could also induce anti-tumor cytokine expression and cell death in tested MCC cell lines.
In summary, we demonstrated that STINGR284S mRNA-LNP robustly activate the STING signaling pathway in cancer cells, leading to the production of key anti-tumor cytokines as well as cancer cell death. Therefore, STINGR284S mRNA-LNP could be exploited as a promising anticancer drug for treating STING-deficient cancers.
Discussion
Currently, several therapeutic approaches such as PD-1/PD-L1 and CTLA-4 inhibitors have been appraised in attempts to combat aggressive cancers such as PDACs and MCCs, but have failed to produce durable responses in PDACs [88] and led to treatment resistance in some MCCs [89]. Therefore, alternative therapeutics are still needed for treating these lethal cancers.
The complex tumor microenvironment presents a major barrier to developing broadly effective therapies. The TME of PDAC is known to be immunosuppressive. Although tumor infiltration of T lymphocytes was positively correlated with overall patient survival [90], the PDAC TME has very few tumor-infiltrating CD8+ cytotoxic T cells and CD4+ T helper cells, and instead exhibits an increased presence of regulatory T cells, tumor-associated macrophages, and myeloid-derived suppressor cells [91, 92]. We and others have reported that the STING signaling pathway is dysfunctional in several cancers [14,20,43]. Thus, we examined the expression of key components of this pathway, cGAS and STING, in PDAC cell lines. We found that all tested pancreatic cancer cell lines maintain highly expressed cGAS, but STING is significantly downregulated in many of the PDAC cell lines and tissues (Fig. 1). In light of the STING function in stimulating antitumor response, we speculated that STING repression might contribute to the immunosuppressive TME of PDACs and that reactivating STING might represent a viable strategy for heating up the immunologically ‘cold’ TME in PDAC.
To stimulate STING activity in PDAC cells, we first screened several ‘hot’ STING mutants. We discovered that only the STINGR284S mutant, but not STINGWT nor the other STING gain-of-function mutants such as STINGV147L, STINGN154S, and STINGV155M, could specifically inhibit the growth of STING-silenced MIA PaCa-2 cells (Fig. 2). The result correlates appropriately with the clinical impact of these gain-of-function mutations. For example, the STINGV147L, STINGN154S and STINGV155M mutants were identified in patients who died at an age of at least 9 years [49], but the STINGR284S mutant was derived from a patient who died at approximately 9 months of age [47]. Together, our finding suggests that, among all of the mutants tested, STINGR284S has the highest activity in stimulating the STING signaling pathway. This discovery provides the molecular basis for using the STINGR284S mutant to develop STING-targeted immunotherapies.
Our further studies demonstrated that STINGR284S mRNA-LNP could be efficiently delivered into PDAC cells to induce cytokines/chemokines crucial for promoting intratumoral infiltration of CD8+ T cells. More importantly, STINGR284S expression also induces robust cell death in STING-silenced cancers (Figs. 5 and S3). MCCs also have an immunologically ‘cold’ TME and STING is invariably repressed in the MCPyV+ MCC tumors we have examined. We further demonstrated that STINGR284S mRNA-LNP could also be utilized to activate STING downstream antitumor activity in MCC tumor cells. In summary, by harnessing the hyperactive immune-stimulatory activity of the STINGR284S mutant and the delivery capability of mRNA-LNP, we have provided evidence for using the naturally occurring STINGR284S mutant as a novel therapeutic tool to reactivate the antitumor response in the immunologically ‘cold’ pancreatic cancer and in other STING-silenced tumors.
Several observations suggest that STINGR284S mRNA-LNP hold great promise for developing a cancer immunotherapy. First, when compared with wild type STING, ‘hot’ STING mutants such as STINGR284S are more responsive to cGAMP [46,47,49,51]. When delivered into tumor cells by mRNA-LNP, STINGR284S can be further activated by the large amount of damaged DNA present in these cells, spurring robust antitumoral activity. Therefore, no additional STING agonist is needed to stimulate ‘hot’ STING mutants, increasing the feasibility for clinical application. Secondly, pancreatic cancers possess few tumor-specific new epitopes (neoantigens) [12]. STINGR284S mRNA-LNP-induced cell death will play a crucial role in exposing neoantigens of tumors to the host immune system. The large amount of tumor antigens released by the dead cells can be engulfed by antigen-presenting cells (APCs) and presented to T cells to generate systemic antitumor immunity and amplify the tumoricidal effect. This process could also induce adaptive antitumor immunity for rejecting distant metastases and providing long-living immunologic memory. Thirdly, STINGR284S-mediated cell death can also directly reduce cancer burden, which is also clearly beneficial to cancer immunotherapy [93, 94]. Finally, mRNA-LNP has an intrinsic adjuvant effect that can stimulate T follicular helper cells (Tfh) responses and promote the production of effective CD8+ T cells [70,78,95]. An additional advantage is that multiple mRNAs can be combined together or with other drugs to be encapsidated into LNP [78-81,96].
The STINGR284S mRNA-LNP approach can be used to restore STING expression and function in STING-deficient tumors in order to stimulate anti-tumor immune responses and directly kill the tumor cells (Figs 4C, 5C, S3C, and S5C). Anti-tumor cytokines have safety concerns when systemically administered; however, gene expression driven by intratumorally-injected mRNA-LNP has been detected mainly in the tumor sites but not in major vital organs [96, 97]. Therefore, local delivery using STINGR284S mRNA formulated in LNP could overcome the specificity issue and reveal a safe approach to leverage the cytokine effects [98, 99]. Additionally, overstimulation of STING in T cells could introduce cell death and cytotoxicity, which counteracts the desired antitumor immune response [17,55,100–103]. Interestingly, we found that while STINGR284S mRNA-LNP can effectively repress cancer cell proliferation, it does not inhibit the growth of CD8+ T cells (Figs. 4D, 5D, S3D, S5D and S3E). This is consistent with previous studies confirming that T cells are not susceptible to transfection by exogenous mRNA delivered in LNP [104]. Therefore, mRNA-LNP-mediated intratumoral delivery of STINGR284S will allow specific activation of STING signaling in tumor tissues without introducing antiproliferative effects in lymphocytic immune cells. Because mRNA-LNP delivery is transient, it also allows for greater control of the treatment process. So far, all STINGR284S mRNA-LNP studies were performed in vitro. Plans are underway to establish STING-negative tumor models in mice, which will be used to examine the efficacy of the STINGR284S mRNA-LNP in stimulating T cell intratumoral infiltration and killing of tumor cells in vivo. Furthermore, we are also developing specific targeting strategies in order to apply the STINGR284S mRNA-LNP for treating metastatic disease.
STING agonists are being actively pursued as new cancer immunotherapies [36,44,45,105], but few have generated positive clinical outcome [39, 40]. As shown by our group and others, STING is silenced in many cancers [14,20,43]. Our findings could explain why traditional STING agonists will not work in STING-silenced cancers, as the antitumor efficacy of these agonists obligatorily depends on STING expression to begin with [44]. When delivered into noncancerous cells, the classic STING agonists can also induce inflammatory diseases and cancers [17, 103]. Our STINGR284S mRNA-LNP approach therefore represents a novel therapeutic strategy that can overcome the limitations and toxicity of conventional STING agonist-based therapies. It also possesses broader potential for overcoming the immunosuppressive microenvironment in other STING-deficient ‘cold’ tumors.
Materials and methods
Cell culture and cancer lesions
Primary foreskin dermal fibroblasts [106], human embryonic kidney 293T (HEK293T), MIA PaCa-2, and PANC-1 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum. BxPC-3 and AsPC-1 cells were grown in RPMI 1640 medium supplemented with 10% fetal calf serum. Capan-1 and Capan-2 cells were grown in McCoy’s 5A Medium supplemented with 10% fetal calf serum. MKL-1 and MS-1 cells were grown in RPMI 1640 medium supplemented with 20% fetal calf serum. All the cells were incubated at 37°C in humidified air containing 5% CO2. Primary CD8+ T cells from healthy donors were provided by the Human Immunology Core at the University of Pennsylvania. These cells were grown in RPMI 1640 medium supplemented with 10% heat-inactivated FBS, L-glutamine, IL-2 and Penicillin-Streptomycin. PDAC tissues were obtained from the Tumor Tissue and Biospecimen Bank at the University of Pennsylvania.
Western blot analysis
To prepare whole cell lysates, cells were lysed in lysis buffer (10 mM HEPES, pH 7.9, 500 mM NaCl, 3 mM MgCl2, 1 mM DTT, 1 mM PMSF, 0.5% Triton X-100 supplemented with protease inhibitors). After 30 minutes of incubation on ice, whole cell lysates were centrifuged at 15,000g for 10 min at 4°C to remove the debris. Protein concentrations were determined using the Bradford assay. The protein samples were resolved on SDS-PAGE gels, transferred onto PVDF membranes, and immunoblotted with specific primary antibodies as indicated in the figure legends. The primary antibodies used in this study include anti-STING (1:2000, 13647S, Cell Signaling Technology), anti-cGAS (1:1000, 15102, Cell Signaling Technology), and anti-GAPDH (1:2000, 5174S, Cell Signaling Technology). The secondary antibody used was HRP- linked anti-rabbit IgG (1:3000, 7074S, Cell Signaling Technology). Western blots were developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific) and images were captured using a GE imaging system.
Cell proliferation assay
Cell viability was measured with CellTiter-Glo 3D (Promega) following the manufacturer’s instructions [107].
Reverse transcription and quantitative real-time PCR
Total RNA was isolated using NucleoSpin RNA II Kit (Macherey-Nagel) in pursuance of the manufacturer’s protocol. Reverse transcription (RT) was performed using a 20 µl reaction mixture containing 350 ng of total RNA, random hexamer primers (Invitrogen), dNTPs (Invitrogen), and M-MLV reverse transcriptase (Invitrogen). Quantitative real-time PCR (qPCR) was performed using a CFX96 real-time PCR detection system (Bio-Rad) with IQ SYBR Green supermix (Bio-Rad). Primer sequences are the same as listed in [14]. The mRNA level of each gene was normalized to the GAPDH mRNA level.
Immunofluorescent staining
Cells were fixed with 3% paraformaldehyde in PBS for 20 minutes. Immunofluorescent (IF) staining was performed as previously described [108]. The following primary antibodies were used: anti-CK19 (1:200, 4558, Cell Signaling Technology), anti-STING (1:500 for cell staining, 1:20 for tissue staining, 19851-1-AP, Proteintech), and anti-Cleaved Caspase-3 (Asp175) (1:500, 9661, Cell Signaling Technology). The secondary antibodies used were Alexa Fluor 594 goat anti-mouse IgG (1:500, A-11032, ThermoFisher Scientific) and Alexa Fluor 488 goat anti-rabbit IgG (1:500, A-11008, ThermoFisher Scientific). All IF images were collected using an inverted fluorescence microscope (IX81; Olympus) connected to a high-resolution charge-coupled-device camera (FAST1394; QImaging). Images were analyzed and presented using SlideBook (version 5.0) software (Intelligent Imaging Innovations, Inc.). The scale bars were added using ImageJ software.
Recombinant plasmid construction
pTEV-STINGWT-A101 plasmid containing codon-optimized STINGWT gene was synthesized by Genewiz. pTEV-STINGR284S-A101 plasmid containing the STINGR284S gene was generated from codon-optimized human STINGWT by PCR-based site-directed mutagenesis.
mRNA production
Using linearized plasmid pTEV-STINGWT-A101 and pTEV-STINGR284S-A101, the STING mRNA was produced with T7 RNA polymerase. During mRNA synthesis, 1-methylpseudouridine-5′-triphosphate (TriLink) was used instead of UTP to generate modified nucleoside-containing mRNA. The STING mRNA was co-transcriptionally capped using CleanCap (TriLink) and purified as described previously [70]. The STING mRNA was analyzed by agarose gel electrophoresis and stored frozen at −80 °C.
mRNA transfection
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions. Specifically, mRNA (1 µg) was combined with TransIT-mRNA reagent (3 µl) and boost reagent (3 µl) in 100 µl of serum-free medium, and the complex was added to 10e5 cells in 500 µl complete medium. Cells were harvested at 15-16 h after transfection.
LNP encapsulation of the mRNA
Purified STING mRNAs were encapsulated in LNP using a self-assembly process in which an aqueous solution of mRNA at pH 4.0 is rapidly mixed with a solution of lipids dissolved in ethanol. LNP used in this study were similar in composition to those described previously [71], which contain an ionizable cationic lipid (proprietary to Acuitas), phosphatidylcholine, cholesterol and PEG-lipid. The ionizable cationic lipid and LNP composition are described in the patent application WO 2017/004143. The diameter and polydispersity index of LNP was measured by dynamic light scattering using a Zetasizer Nano ZS instrument (Malvern Instruments Ltd) and an encapsulation efficiency of ∼95% as determined using a Ribogreen assay. RNA-LNP formulations were stored at - 80 °C at an RNA concentration of ∼1 µg/µl.
Mutagenesis Primers
The sequences for the primers used in STING mutagenesis are:
STINGV155MF: AACATGGCCCATGGGCTGGCATGG
STINGN154SF: AGCGTGGCCCATGGGCTGGCATGG
STINGN154SR: GAAATTCCCTTTTTCACACACTGCAGAG
STINGV147LF: CTGTGTGAAAAAGGGAATTTCAACGTGG
STINGV147LR: TGCAGAGATCTCAGCTGGGG
Statistical analyses
Statistical analysis was performed using the unpaired t-test of GraphPad Prism software (Version 7.0) to compare the data from the control and experimental groups. A two-tailed P value of <0.05 was considered statistically significant.
Funding
This work has been supported by NIH Grants R01CA187718, R21AR074073, R21AI149761, T32CA009140, National Cancer Institute Cancer Center Support Grant NCI P30 CA016520, and Penn Center for AIDS Research Pilot Award P30 AI 045008.
Author Contributions
Wei Liu: conceptualization, formal analysis, investigation, methodology, visualization, writing - original draft, writing- review & editing; Mohamad- Gabriel Alameh: resources, writing- review & editing; June F. Yang: methodology, writing - original draft, writing- review & editing; Jonathan R. Xu: literature research, conceptualization, writing- review & editing; Paulo JC Lin: resources, writing- review & editing; Ying K Tam: resources, writing- review & editing; Drew Weissman: supervision, resources, writing- review & editing; Jianxin You: conceptualization, funding acquisition, project administration, supervision, writing- original draft, writing- review & editing.
Conflicts of Interest
The authors declare no conflict of interest
Acknowledgments
We thank the Human Immunology Core (University of Pennsylvania) through Grants P30-CA016520 and P30AI045008 for providing purified human CD8+ T cells; Dr. Erle S. Robertson (University of Pennsylvania) for pancreatic cancer cell lines MIA PaCa-2, BxPC-3, PANC-1, AsPC-1, Capan-1, and Capan-2; the Tumor Tissue and Biospecimen Bank (University of Pennsylvania) for providing PDAC tissues; Dr. Dominic De Nardo (Monash University) for pTRIPZ-STINGWT and pTRIPZ-STINGR284S plasmids; and Drs. Ben Stanger and Ranran Wang for helpful discussion.
Footnotes
This new version includes new Funding and Acknowledgments section.
References
- 1.↵
- 2.↵
- 3.
- 4.↵
- 5.↵
- 6.↵
- 7.
- 8.
- 9.↵
- 10.↵
- 11.↵
- 12.↵
- 13.↵
- 14.↵
- 15.↵
- 16.↵
- 17.↵
- 18.
- 19.↵
- 20.↵
- 21.↵
- 22.
- 23.↵
- 24.↵
- 25.↵
- 26.
- 27.↵
- 28.↵
- 29.↵
- 30.↵
- 31.
- 32.↵
- 33.
- 34.
- 35.
- 36.↵
- 37.
- 38.↵
- 39.↵
- 40.↵
- 41.↵
- 42.↵
- 43.↵
- 44.↵
- 45.↵
- 46.↵
- 47.↵
- 48.
- 49.↵
- 50.
- 51.↵
- 52.
- 53.
- 54.↵
- 55.↵
- 56.↵
- 57.
- 58.
- 59.
- 60.↵
- 61.↵
- 62.↵
- 63.↵
- 64.↵
- 65.↵
- 66.↵
- 67.↵
- 68.↵
- 69.↵
- 70.↵
- 71.↵
- 72.
- 73.
- 74.
- 75.
- 76.
- 77.
- 78.↵
- 79.
- 80.
- 81.↵
- 82.↵
- 83.↵
- 84.↵
- 85.↵
- 86.↵
- 87.↵
- 88.↵
- 89.↵
- 90.↵
- 91.↵
- 92.↵
- 93.↵
- 94.↵
- 95.↵
- 96.↵
- 97.↵
- 98.↵
- 99.↵
- 100.↵
- 101.
- 102.
- 103.↵
- 104.↵
- 105.↵
- 106.↵
- 107.↵
- 108.↵