New Results

A pleiotropic chemoreceptor facilitates the functional coupling of pheromone production and perception

Cassondra Vernier, Kathleen M. Zelle, Nicole Leitner, Xitong Liang, Sean Halloran, Jocelyn G. Millar, Yehuda Ben-Shahar
doi: https://doi.org/10.1101/2022.01.10.475668

SUMMARY

Optimal mating decisions depend on the robust coupling of signal production and perception because independent changes in either could carry a fitness cost. However, since the perception and production of mating signals are often mediated by different tissues and cell types, the mechanisms that drive and maintain their coupling remain unknown for most animal species. Here, we show that in Drosophila, sensory perception and production of an inhibitory mating pheromone are co-regulated by Gr8a, a member of the Gustatory receptor gene family. Specifically, we found that the pleiotropic action of Gr8a independently regulates the perception of pheromones by the chemosensory systems of males and females, as well as their production in the fat body and oenocytes of males. These findings provide a relatively simple molecular explanation for how pleiotropic receptors maintain robust mating signaling systems at the population and species levels.

INTRODUCTION

The majority of sexually-reproducing animals use intricate mating signaling systems, which rely on a robust physiological coupling between the production and perception of species-specific signals since any independent changes in either the signal or the capacity to sense it would carry a fitness cost (Boake, 1991; Brooks et al., 2005; Hoy et al., 1977; Shaw et al., 2011; Shaw and Lesnick, 2009; Steiger et al., 2011; Sweigart, 2010; Symonds and Elgar, 2008; Wyatt, 2014). Previously published theoretical models have postulated that the maintenance of robust coupling between the production and perception of mating signals is driven by strong genetic linkage between the cellular and physiological processes that regulate mating-signal production and its perception, or alternatively, via the action of pleiotropic genes that control both processes (Boake, 1991; Butlin and Ritchie, 1989; Butlin and Trickett, 1997; Shaw et al., 2011; Shaw and Lesnick, 2009). Consequently, both mechanisms provide plausible explanations for how mating-signaling systems could remain stable and reliable at the population level while still retaining their capacity for future diversification, as necessitated for speciation (Chebib and Guillaume, 2021; Hoy et al., 1977; Kirkpatrick and Hall, 2004; Lande, 1980; Shaw et al., 2011; Shaw and Lesnick, 2009; Wiley et al., 2012).

Empirical data in support of the contribution of gene-linkage or pleiotropy to the maintenance of coupling between mating signal production and perception at the population level are rare (Chebib and Guillaume, 2021; Hoy et al., 1977; Shaw et al., 2011; Shaw and Lesnick, 2009; Wiley et al., 2012). Additionally, the complex characteristics of mating behaviors, and the species-specific signals that drive them, present a major barrier for identifying the actual molecular mechanisms and candidate pleiotropic genes that support the coupling between the production and perception of specific mating signals (Chenoweth and Blows, 2006; Singh and Shaw, 2012). How the functional coupling of the physiological processes responsible for the production and perception of mating signals remains robust is particularly puzzling since their perception is mediated by the peripheral sensory nervous system, while their production is restricted to specialized, non-neuronal pheromone producing cells (Chung and Carroll, 2015; Chung et al., 2014; McKinney et al., 2015). Notwithstanding, a previous Drosophila study has implied that the gene desat1, which encodes a fatty acid desaturase, directly contributes to both the perception and production of pheromones (Bousquet et al., 2012). However, subsequent studies have shown that desat1 expression is enriched in central neurons, and that the effect of desat1 mutations on the behavioral response to pheromones is not likely to be directly mediated via the modulation of pheromone perception by sensory neurons (Billeter et al., 2009). Furthermore, the effects of desat1 mutations on the overall CHC profiles of both males and females are broad and lack specificity (Labeur et al., 2002). Together, these data suggest that desat1 is not likely to act as a pleiotropic factor that directly couples the production and perception of mating pheromones in Drosophila. Consequently, the molecular identities of genes that may mediate the genetic and functional linkage between the production of insect mating pheromones by the coenocytes, and their perception by the chemosensory system, remained unknown.

Here we show that some pheromone-driven mating behaviors in Drosophila depend on the pleiotropic action of Gr8a, a member of the Gustatory receptor gene family (Lee et al., 2012; Shim et al., 2015), which contributes to both the perception of inhibitory mating signals in pheromone-sensing neurons, and independently, to the production of inhibitory mating pheromones in non-neuronal abdominal pheromone-producing oenocytes. Together, these data provide a relatively simple molecular explanation for how genetic linkage could maintain functional coupling between the independent cellular and physiological processes that drive pheromone perception and production.

RESULTS

Some gustatory-like receptors exhibit enriched expression in abdominal tissues

Similar to other insect species, Drosophila cuticular hydrocarbons (CHCs), or long-chain fatty acids synthesized by the fat body and oenocytes (Billeter et al., 2009; Gutierrez et al., 2007), provide a hydrophobic desiccation barrier, as well as play an important role as pheromones in regulating diverse behaviors, including mating (Blomquist and Bagnères, 2010; Chung and Carroll, 2015; Ferveur, 2005; McKinney et al., 2015). Specifically, complex blends of CHCs are often utilized by insects to communicate sex identity and female mating status, as well as to define the behavioral reproductive boundaries between closely related species (Ben-Shahar, 2015; Billeter et al., 2009; Chung and Carroll, 2015; Chung et al., 2014; Dweck et al., 2015; Lu et al., 2012; Lu et al., 2014; Yew and Chung, 2015).

While some of the genes and pathways that contribute to CHC synthesis in Drosophila are known (Blomquist and Bagnères, 2010; Chung et al., 2014; Ferveur, 2005; Howard and Blomquist, 2005; McKinney et al., 2015), the molecular identities of most CHC receptors remain unknown. Current models stipulate that the perception of volatile CHCs is mediated by olfactory sensory neurons (ORNs) located in the antennae and maxillary palps, while less volatile CHCs are sensed by specialized gustatory-like receptor neurons (GRNs) in the appendages (legs and wings), female genitalia, and the proboscis (Benton et al., 2007; Clowney et al., 2015; Datta et al., 2008; Koh et al., 2014; Kurtovic et al., 2007; Lebreton et al., 2014; Lu et al., 2012; Lu et al., 2014; Pikielny, 2012; Thistle et al., 2012; Toda et al., 2012; van der Goes van Naters and Carlson, 2007; Vijayan et al., 2014).

Consequently, we chose to examine members of the Gustatory receptor (Gr) gene family as candidate pleiotropic genes that might contribute to both the perception and production of pheromonal mating signals in Drosophila. Because several family members have already been implicated in the detection of specific excitatory and inhibitory pheromones (Bray and Amrein, 2003; Miyamoto and Amrein, 2008; Moon et al., 2009; Watanabe et al., 2011), and the majority of genes that encode family members are already known to be enriched in GRNs (Clyne et al., 2000; Dunipace et al., 2001; Scott et al., 2001; Wang et al., 2004), we reasoned that any pleiotropic Gr genes should be also expressed in the abdominal oenocytes (Billeter et al., 2009). We tested this by using an RT-PCR screen, which revealed that 24 out of the 60 members of the Gr family are expressed in abdominal tissues of adult Drosophila (Table 1). This suggests that at least some Gr genes may contribute to both the perception and production of mating signals in Drosophila.

View this table:
Table 1.

Candidate Gr genes expressed in male and/or female abdomens. Plus and minus signs indicate whether RT-PCR products were detected. Only genes with positive PCR products in at least one sex are shown.

Gr8a is a chemosensory receptor with sexually dimorphic expression in abdominal cells

Although several members of the Gr gene family, including Gr68a, Gr32a, Gr66a, Gr39a, and Gr33a, were previously linked to the sensory perception of mating pheromones (Bray and Amrein, 2003; Lacaille et al., 2007; Miyamoto and Amrein, 2008; Moon et al., 2009; Watanabe et al., 2011), none of these candidate genes were identified in our initial RT-PCR screen for Gr genes expressed in abdominal tissues of either males or females (Table 1). However, Gr8a, which was indicated by our screen as being a male-specific abdomen-enriched receptor (Table 1) (Park and Kwon, 2011), was previously shown to play a role in the chemosensation of the non-proteinogenic amino acid L-Canavanine (Lee et al., 2012; Shim et al., 2015). Because our initial expression screen was based on whole-abdomen RNAs, we next used a GAL4 transgenic driver to determine which abdominal cells express Gr8a. We found that, as was previously reported (Lee et al., 2012), Gr8a is expressed in 14-16 GRNs in the proboscis (Figure 1A-B), as well as in two paired GRNs in the pretarsus of the prothoracic legs in males (Figure 1C) and females (Figure 1D). We also observed Gr8a expression in abdominal oenocyte-like cells in males (Figure 1E) but not females (Figure 1F). The male-biased expression in the abdomen was further supported by qRT-PCR analysis (Figure 1G). These data further indicate that in addition to its chemosensory functions, Gr8a may also contribute to oenocyte physiology.

Figure 1.
Figure 1. Gr8a is a sexually dimorphic chemosensory receptor.

(A-F) Gr8a is expressed in the proboscis (A-B) and prothoracic legs (C-D) of both males (top) and females (bottom), but is only expressed in the abdomen of males (E-F). Cells labeled by Gr8a-GAL4. (G) Gr8a has sexually dimorphic mRNA expression in the bodies of flies. Relative mRNA levels were measured by real-time quantitative RT-PCR. **, p<0.01 Mann Whitney Rank Sum Test, n=3/group. (H-J) Gr8a-expressing GRNs represent a distinct subclass of pheromone sensing neurons. (H) Axonal projection patterns in the T1 VNC neuromere in a Gr8a-GAL4>UAS-CD8::GFP male (green). Arrowheads, individual axons; dashed line, midline of the VNC. Magenta, neuropil marker (nc82). (I) Confocal z-stack of a male fruP1-LexA>LexAop-myrGFP (green); Gr8a-GAL4>UAS-Red-Stinger (magenta) prothoracic leg. (J) Confocal z-stack of a male ppk23- LexA>LexAop-CD8::GFP (green); Gr8a-GAL4>UAS-Red-Stinger (magenta) prothoracic leg. (K-M) Gr8a is expressed in oenocytes and other abdominal cells. Confocal z-stack images of oenocytes in a Gr8a-GAL4>UAS-CD8::GFP; desat1>luciferase male: (K) desat1 (green); (L) Gr8a (magenta); (M) Merge. Blue, DAPI. White arrow, expression of Gr8a in oenocytes; yellow arrows, expression of Gr8a in other abdominal cells. (N) GR8A protein is enriched in abdominal cells. Confocal z-stack of a GFP-tagged Gr8a allele in male abdominal cells; green, anti-GFP; blue, DAPI. Scale bars = 50μm.

To further examine the spatial expression of Gr8a in males, we used a membrane bound GFP reporter to trace the axonal projection patterns of Gr8a-expressing GRNs in the prothoracic legs. We found that in contrast to the primary, sexually dimorphic ppk23- expressing pheromone-sensing GRNs (Lu et al., 2012; Lu et al., 2014; Thistle et al., 2012; Toda et al., 2012), the axons of tarsal Gr8a-expressing neurons ascend to the brain and do not cross the midline of the ventral nerve cord (VNC) in males (Figure 1H). Likewise, we found that Gr8a-expressing GRNs do not co-express the sex determination factor fru (Figure 1I) or the ion channel ppk23 (Figure 1J), which are were previously assumed to be expressed in all pheromone-sensing GRNs in the fly appendages. These data indicate that Gr8a-expressing GRNs in the prothoracic tarsal segments possibly represent a distinct subclass of pheromone-sensing GRNs.

In the male abdomen, we found that Gr8a is co-expressed with the oenocyte specific desat1 driver (Billeter et al., 2009), as well as possibly in desat1-negative fat-body-like cells (Figure 1K-M). To better understand how Gr8a might function in non-neuronal oenocytes, we next characterized the subcellular localization of the native Gr8a protein in abdominal tissues, by using CRISPR/Cas9 genome editing to generate an endogenous GFP-tagged allele of Gr8a. Subsequently, immunohistochemical staining of abdominal tissues from Gr8a-GFP males with an anti-GFP antibody revealed that the receptor protein is enriched in vacuolar membranes in some oenocyte clusters (Figure 1N). Together, these data indicate that in addition to its possible role in the perception of L-Canavanine, Gr8a also contributes to the perception, and possibly production, of mating pheromones in the male.

Gr8a activity contributes to mating decisions in females

We next hypothesized that if Gr8a is a pleiotropic gene that independently contributes to the production of a mating pheromone in males, and its chemosensory perception in females, then the knockdown of Gr8a in either males or females should have similar effects on female mating behavior. Therefore, we first investigated whether Gr8a, and the GRNs that express it, are required for sensory functions associated with female mate choice by using single-pair courtship assays (Lu et al., 2012; Lu et al., 2014). We found that blocking neuronal transmission in female Gr8a-expressing GRNs by the transgenic expression of tetanus toxin (TNT) shortens copulation latency relative to wild-type females, when courted by wild-type males (Figure 2A). Similarly, homozygous (Figure 2B) and hemizygous (Figure 2C) Gr8a-null females exhibited shorter copulation latencies when courted by wild type males, which can be rescued by driving the expression of the Gr8a cDNA by Gr8a-GAL4 (Figure 2D). In contrast, genetic manipulations of Gr8a did not affect male courtship behavior as measured by courtship latency and index towards wild-type females (Supplemental Figure 1). These data suggest that Gr8a is required for regulating female mating receptivity via the chemosensory detection of male-borne inhibitory mating pheromones.

Figure 2.
Figure 2. Gr8a activity contributes to the perception and production of an inhibitory signal associated with mating decisions in males and females.

(A) Blocking neural activity in female Gr8a-expressing sensory neurons (Gr8a>TNT) shortens copulation latency relative to wild-type controls (Gr8a>TNTinactive). (B-C) Homozygous (B) or hemizygous (C) Gr8a null females show shortened copulation latency relative to wild-type controls. Df(1)BSC663 is a deficiency that covers the Gr8a locus. Df(1)BSC754 was used as a control. (D) Expression of Gr8a cDNA with the Gr8a promoter (Gr8a-;Gr8atg) rescues the copulation latency phenotype in Gr8a mutant females. (E) Wild-type females exhibit shortened copulation latency when courted by Gr8a mutant males relative to wild-type males. (F) Gr8a mutant males do not recognize the mating status of females, and have a reduced transfer of inhibitory mating pheromones during copulations. Female, female genotype; Sperm donor, genotype of males mated first with focal females; Focal male, genotypes of experimental males presented with mated females. Different letters above bars indicate statistically significant Tukey’s HSD post hoc contrasts between groups. Panels C, D, and F: p<0.05 ANOVA, n>15/group. Panels A, B, E: *, p<0.05, Mann Whitney Rank Sum Test, n>15/group. All assays performed under red light conditions.

Because Gr8a expression is specifically enriched in male oenocytes (Figure 1K-M), we next tested the hypothesis that Gr8a also plays a role in the production and/or release of inhibitory mating signals by males. We found that wild-type virgin females exhibited shorter copulation latencies towards Gr8a mutant males relative to wild-type controls (Figure 2E). These data indicate that the Gr8a mutant males produce and/or release lower levels of inhibitory mating pheromones relative to wild type controls. Together, these behavioral studies suggest that Gr8a is a pleiotropic gene that regulates both the production of an inhibitory mating signal in the male oenocytes, and its perception by the chemosensory system in females.

Gr8a regulates the copulatory transfer, and the post-mating perception, of inhibitory pheromones by males

Mating decisions in D. melanogaster rely on a balance between excitatory and inhibitory drives (Billeter et al., 2009; Clowney et al., 2015; Kallman et al., 2015; Krupp et al., 2008; Laturney and Billeter, 2016). Therefore, male-borne inhibitory signals may help females optimize mate choices by delaying their decision to copulate with specific males. Additionally, previous studies showed that, in order to increase their fitness, Drosophila males transfer inhibitory mating pheromones to females during copulation, which subsequently lowers the overall attractiveness of mated females to other males (Averhoff and Richardson, 1974; Datta et al., 2008; Jin et al., 2008; Kurtovic et al., 2007; Miyamoto and Amrein, 2008; Yang et al., 2009). We found that Gr8a mutant males were more likely to court mated females than wild-type controls (Figure 2F), suggesting that Gr8a is also required in males for the sensory recognition of the inhibitory signals that label the post-mating status of females. We also found that wild-type males failed to recognize the mating status of wild-type females that were previously mated with Gr8a mutant males (Figure 2F). These data indicate that Gr8a is also important for the production of inhibitory pheromones that are transferred from males to females during copulation. Together, these findings suggest that Gr8a is responsible for the production and perception of transferrable inhibitory mating signals that advertise post-mating status in females. The simplest overall interpretation of these data is that Gr8a is a pleiotropic factor, which independently contributes to the production/ transfer of male inhibitory mating pheromones, as well as their sensory perception in both males and females.

Gr8a contributes to quantitative and qualitative attributes of the pheromone profiles of males and mated females

Because our data indicate that the Gr8a mutation has a dramatic effect on the copulation latency of mated females and the ability of males to detect the mating status of females, we hypothesized that Gr8a is contributing to the production and/or transfer of an inhibitory pheromone in males. Therefore, we next examined whether the Gr8a mutation has a direct effect on qualitative and quantitative aspects of male and mated-female CHC profiles. We found that the overall CHC profile of Gr8a mutant males is both qualitatively (Figure 3A) and quantitatively different from that of wild-type males (Figure 3B-C and Table 2). In particular, the Gr8a mutation affects the levels of several alkenes and methyl-branched alkanes, which have been implicated in mate choice behaviors in diverse Drosophila species (Billeter et al., 2009; Billeter and Levine, 2013; Chung and Carroll, 2015; Chung et al., 2014; Dyer et al., 2014; Shirangi et al., 2009).

Figure 3.
Figure 3. The Gr8a mutation affects the pheromone profiles of males and mated females.

(A) Wild-type (wt) and Gr8a mutant (Gr8a-) males differ in CHC profile. p<0.001, Permutation MANOVA. (B-C) The Gr8a mutation affects the levels of individual CHCs in males. (B) CHCs found at high proportions in males. (C) CHCs found at low proportions in males. Only affected CHCs are shown. See Table 2 for the complete list. *, p<0.05, **, p<0.001, Student’s t-test or Mann Whitney Rank Sum Test, n=6 (Gr8a-) or 7 (wt). (D) The Gr8a mutation affects the expression level of several desaturase genes. Only affected genes are shown. See Table 3 for the complete list. *, p<0.05, Student’s t-test, n=4/group. (E) Females mated with wild-type or Gr8a mutant males do not differ in CHC profile. p=0.570, Permutation MANOVA. (F) Nonacosane (C29) differs between females mated with wild-type and Gr8a mutant males. See Table 4 for complete list of mated-female CHCs. *, p<0.05, Student’s t-test, n=6/group. (G) Control (desat1 > GFP-RNAi) and oenocyte-specific Gr8a knockdown (desat1 > Gr8a- RNAi) males differ in CHC profile. p<0.001, Permutation MANOVA. (H) Control (r4 > GFP-RNAi) and fat body-specific Gr8a knockdown (r4 > Gr8a-RNAi) males do not differ in CHC profile. p = 0.298, Permutation MANOVA. Panels A, E, G, and H depicted as Nonmetric Multidimensional Scaling (NMDS) plots with Bray-Curtis dissimilarity.

View this table:
Table 2.

Male CHCs. Retention time (R.T.), compound, percent total (% total), and p-value (Student’s t-test or Mann Whitney Rank Sum Test) of each compound as part of the total pheromonal bouquet for wild-type (wt) and Gr8a mutant (Gr8a-) males.

View this table:
Table 3.

Desaturase gene expression. Relative mRNA expression of each desaturase gene for wild-type (wt) and Gr8a mutant (Gr8a-) males. Statistics via Student’s t-test.

View this table:
Table 4.

Mated-female CHCs. Retention time (R.T.), compound, percent total (% total), and p-value (Student’s t-test or Mann Whitney Rank Sum Test) of each compound as part of the total pheromonal bouquet for females mated with wild-type (wt) or Gr8a mutant (Gr8a-) males.

Although the exact mechanism by which Gr8a might be regulating the levels of specific CHCs remains unknown, we found that the expression levels of the desaturases desat1 and CG8630, which play a role in the biosynthesis of alkenes (Chung and Carroll, 2015), are affected by the Gr8a mutation in the male abdomen (Figure 3D). We also found that the overall qualitative aspects of the CHC profiles of wild-type females were not affected by mating with either Gr8a mutant or wild-type males (Figure 3E). However, quantitative analyses of individual CHCs revealed that nonacosane (C29) is higher in females that mated with Gr8a mutant males relative to those that mated with wild-type males (Figure 3F). Together, these data suggest that Gr8a action in oenocytes contributes to the production of some cuticular alkenes and methyl-branched alkanes in males, which possibly function as inhibitory mating pheromones.

Since the Gr8a mutation is not spatially restricted in Gr8a mutant males, it is possible that at least some of the effects of the Gr8a mutation on the pheromone profiles of males are indirectly mediated via its action in pheromone-sensing GRNs, instead of directly mediated via its action in oenocytes. Therefore, we next examined the effect of oenocyte-specific Gr8a knockdown on the production of male CHCs. We found that oenocyte-specific Gr8a RNAi knockdown in males leads to significant changes in their overall CHC profile relative to control males (Figure 3G). In contrast, fat-body-specific knockdown of Gr8a has no effect on the CHC profiles of males (Figure 3H). These data suggest that Gr8a is likely to play an oenocyte-specific role in the production of male CHCs. Together, our behavioral and pheromonal data indicate that Gr8a action contributes to mating decisions in females by co-regulating the perception of an inhibitory mating pheromone by females and males, as well as its production by males. This is consistent with a pleiotropic function for Gr8a.

Gr8a-associated CHCs inhibit normal courtship behaviors

To further characterize whether any of the individual CHCs regulated by Gr8a actually function as inhibitory mating pheromones, we tested the effect of perfuming naïve males with individual candidate CHCs on the copulation latency of wild-type females (Ben-Shahar et al., 2010; Ben-Shahar et al., 2007; Leitner and Ben-Shahar, 2020; Lu et al., 2012; Lu et al., 2014). We found that wild-type females did not copulate with Gr8a mutant males that were perfumed with the alkenes 9-C25, 7-C25, and 7-C27 (Figure 4A). Similarly, we found that wild-type males exhibited a longer courtship latency and lower courtship index towards wild-type females perfumed with 9-C25 (Figure 4B-D), and exhibited longer copulation latency towards wild-type females perfumed with 7-C25 (Figure 4E-G). In contrast, perfuming wild-type females with 7-C27 had no effect on male courtship or female mating latency (Figure 4H-J). These data suggest that at least some of the CHCs regulated by Gr8a activity in the male oenocytes are inhibitory mating pheromones.

Figure 4.
Figure 4. Gr8a-associated alkenes inhibit normal courtship behaviors.

(A) Perfuming males with exaggerated amounts of several alkenes increases copulation latency compared to control males. (B-D) Perfuming females with 9-C25 increases courtship latency (B), decreases courtship index (C), but does not affect copulation latency (D) compared to control females. (E-G) Perfuming females with 7-C25 does not affect courtship latency (E) or index (F), but increases copulation latency (G) compared to control females. (H-J) Perfuming females with 7-C27 does not affect courtship latency (H), courtship index (I), or copulation latency (J) compared to control females. Asterisks above bars indicate statistically significant contrasts compared to control flies, p<0.05, Kruskal-Wallis Test followed by Dunn’s Test (A) or Mann Whitney Rank Sum Test (B-J), n=15/group.

Variations in Gr8a contribute to species-specific male pheromonal profiles across the Drosophila genus

As populations diversify, pheromonal signals and their receptors often have to co-evolve to maintain behavioral species boundaries (Boake, 1991; Khallaf et al., 2021; Symonds and Elgar, 2008; Symonds and Wertheim, 2005). One possible mechanism for maintaining the functional coupling of coevolving signal-receptor pairs during speciation is pleiotropy (Boake, 1991; Shaw et al., 2011; Singh and Shaw, 2012). Because our data suggest that Gr8a is a pleiotropic pheromone receptor, we tested the hypothesis that cross-species variations in the Gr8a coding sequence may have contributed to the rapid evolution of mating pheromones in the Drosophila species group (Khallaf et al., 2021; Shahandeh et al., 2018; Shirangi et al., 2009). To test this hypothesis, we first performed a phylogenetic analysis of Gr8a orthologs across Drosophila species, which indicated that Gr8a is a conserved, sexually dimorphic receptor across the Drosophila genus (Figure 5A-B). Furthermore, alignment of Gr8a proteins across all the major Drosophila clades revealed that, in spite of its high overall sequence conservation, the Gr8a receptor has at least one phylogenetically variable domain (magenta frame, Figure 5C), which includes the second intracellular and extracellular domains (Figure 5D).

Figure 5.
Figure 5. Sexually dimorphic Gr8a expression across the Drosophila genus may contribute to species-specific differences in male CHC profiles.

(A) Phylogenetic tree of Drosophila Gr8a proteins. Substitution rate = 0.2. (B) Gr8a mRNA expression is enriched in males relative to females across Drosophila. Black, males; white, females. *, p<0.05; **,p<0.01; Mann Whitney Rank Sum Test, n=4/group. Live D. grimshawi was not analyzed because live specimens were not available at the Drosophila Species Stock Center (DSSC). (C) Multiple aligned amino acid sequences of Gr8a protein sequences from 12 species across Drosophila. The magenta dashed box highlights a putative hypervariable protein domain. Numbers on top of alignment indicate amino acid number. Black, 100% identical; Dark Gray, 80-100% similar; Light Gray, 60-80% similar; White, less than 60% similar (Blosum62 score matrix, threshold=1). Bars below consensus represent overall level of amino acid conservation. (D) Gr8a protein topology. Boxes, transmembrane domains; Red lines, intracellular domain; Blue lines, extracellular domains. (E) In female choice assays, D. melanogaster males court females from most other Drosophila species first at an equal proportion as D. melanogaster females, but court D. mojavensis females first at a lower proportion than D. melanogaster females. Assays performed under red light. *, p < 0.05, Pearson’s Chi-squared test. (F) Gr8a mutant D. melanogaster males with oenocyte-specific D. melanogaster Gr8a rescue differ in CHC profile from Gr8a mutant D. melanogaster males with oenocyte-specific D. mojavensis Gr8a rescue. Depicted as NMDS plot with Bray-Curtis dissimilarity; Gr8a-; desat1 > Gr8amelanogaster, D. melanogaster Gr8a oenocyte rescue; Gr8a-; desat1 > Gr8amojavensis. D. mojavensis Gr8a oenocyte rescue. Bold letters in legend denote statistical significance, p < 0.05, permutation MANOVA.

Although the ligand-binding domains of the insect Gr gene family have not been identified yet, these data suggest that this phylogenetically variable protein domain in Gr8a may contribute to species-specific shifts in ligand-binding specificity and/ or sensitivity across the Drosophila genus. Therefore, we next tested whether the transgenic rescue of the Gr8a null allele via ectopic expression of Gr8a cDNAs from different Drosophila species is sufficient to drive changes in the CHC profile of D. melanogaster males. By using a cross-species male mate-choice assay, we found that while D. melanogaster males are generally promiscuous, they do court D. mojavensis females at a significantly lower proportion than conspecific females. Because these assays are performed under red light, which eliminates visual mating cues, these data suggested that the lower sex drive towards D. mojavensis females is pheromonedependent (Figure 5E). Subsequently, we generated transgenic D. melanogaster lines which express either the D. mojavensis or the D. melanogaster Gr8a cDNAs driven by an oenocyte-specific GAL4 in the background of the Gr8a null allele. Comparison of male CHC profiles across the two genotypes revealed that rescuing the Gr8a mutation by Gr8a cDNAs from these two distantly related species resulted in significantly different male CHC profiles (Figure 5F). These data indicate that species-specific Gr8a coding variations are sufficient to drive differential CHC production by the male oenocytes, and suggest that pleiotropic pheromone receptors may have played a role in driving the rapidly evolving behavioral mating boundaries in Drosophila.

DISCUSSION

The data presented here demonstrate that Gr8a is a pleiotropic chemoreceptor that coregulates the perception and production of an inhibitory pheromonal signal that plays an important role in mating behaviors of both D. melanogaster sexes. How Gr8a, a member of a canonical chemoreceptor family, might also contribute to the production of pheromonal signals is not obvious. In some better understood secretory cell types, autoreceptors are essential for the regulation of synthesis and secretion rates. For example, dopaminergic and serotonergic cells regulate rates of synthesis and release of their respective neuromodulators by the action of autoreceptors, which act via signaling feedback in response to changes in the extracellular concentrations of the secreted molecule (Ford, 2014; Stagkourakis et al., 2016). Therefore, one possible explanation for how Gr8a might regulate the synthesis and/or secretion of specific CHCs is by acting as an oenocyte-intrinsic autoreceptor, which regulates the synthesis of specific CHCs by providing feedback information about their levels in internal stores and/ or extracellularly (Figure 6).

Figure 6.
Figure 6. Model for the pleiotropic action of Gr8a in the perception and production of pheromones.

(A) Drosophila male. The location of CHC-producing oenocytes is shown in magenta. (B) Gr8a-expressing GRNs are located at the last tarsal segment of the prothoracic legs. (C) Gr8a functions as an inhibitory pheromone receptor in a specific subset of leg GRNs. (D) Oenocytes are the primary CHC-producing cells in the male abdomen. (E) Gr8a functions as an autoreceptor in oenocytes, which regulates CHC synthesis [I-II] and/or CHC secretion [III] via signaling feedback loops.

Recent studies have indicated that Drosophila bitter receptor neurons typically express multiple Gr genes, and that bitter receptor ligand specificity is determined via combinatorial heteromeric receptor complexes (Dweck and Carlson, 2020; Shim et al., 2015; Sung et al., 2017). Gr8a is specifically required for the sensory perception of the feeding deterrent L-canavanine (Lee et al., 2012; Shim et al., 2015), but not for the detection of other bitter feeding deterrents such as caffeine, strychnine, and umbelliferone (Lee et al., 2009; Poudel et al., 2015). Our data indicate that similar to other Drosophila “bitter” taste receptors (Lacaille et al., 2007; Moon et al., 2009), Gr8a contributes to inhibitory sensory inputs in the contexts of both feeding and mating decisions. In the context of feeding, Gr8a-dependent perception of L-canavanine is mediated via its heterotrimeric interaction with Gr66a and Gr98b in bitter sensing neurons in the proboscis (Shim et al., 2015). However, although both Gr66a and Gr98b were also identified in our initial screen for receptors enriched in the adult abdomen, we found that Gr66a is expressed in both sexes and Gr98b is specifically enriched in females (Table 1). Therefore, we conclude that Gr8a-dependent contributions to sensory functions associated with mating decisions are independently driven via its heteromerization with different Gr genes than those that drive feeding-specific decisions.

Although we do not yet know the specific chemical identity of the ligand of Gr8a, previous studies indicated that at least two inhibitory mating pheromones, 11-cis-vaccenyl acetate (cVA) and CH503, are transferred from males to females during copulation. While our data suggest that the Gr8a mutation affects the level of cVA expressed by males, it is unlikely that either cVA or CH503 are the putative Gr8a ligands because the volatile cVA acts primarily via the olfactory receptor Or67d (Benton et al., 2007; Datta et al., 2008; Kurtovic et al., 2007), and CH503 has been reported to signal via Gr68a-expressing neurons, which are anatomically distinct from the Gr8a GRNs we describe here (Figure 1A-B) (Shankar et al., 2015; Yew et al., 2009). Instead, our analyses of the effect of the Gr8a mutation on the CHC profile (Figure 3), and our results of the perfuming behavioral studies (Figure 4), suggest that the alkenes 5-C25, 7C25, and 7-C27, which seem to act as inhibitory mating signals as well, are potentially the ligands of Gr8a.

Overall, our studies indicate that pleiotropic receptors, such as Gr8a, contribute to the physiological coupling between the production and perception of some mating pheromones by acting as both a sensory receptor in pheromone-sensing neurons, and possibly as an autorecepor for the same chemical in the pheromone-producing oenocytes. Our finding that Gr8a is also a sexually dimorphic receptor that is conserved across the Drosophila genus, with at least one phylogenetically variable domain (Figure 5A-C), suggests that it might also drive the divergence of mating signaling systems in association with rapid speciation. This is supported by our finding that rescuing the Gr8a mutation in D. melanogaster with a Gr8a cDNA from a distant species, D. mojavensis, leads to the development of a male CHC profile that is different from the profile of mutant males rescued with the D. melanogaster Gr8a cDNA (Figure 5F).

Studies in other animal species suggest that receptor pleiotropy likely plays a role in mating signaling via other sensory modalities including auditory communication in crickets (Heinen-Kay et al., 2020; Hoy et al., 1977; Wiley et al., 2012) and visual communication in fish (Fukamachi et al., 2009). While the specific genes and signaling pathways that mediate the coupling of the mating signals and their receptors in these mating systems remain mostly unknown, these data suggest that genetic linkage in signal-receptor pairs important for mating communication is likely to be more common than previously thought. Therefore, the genetic tractability of D. melanogaster, in combination with the diversity of mating communication systems in this species-rich phylogenetic group, provide a unique opportunity for understanding the evolution and mechanisms that drive and maintain the robustness of mating systems at the genetic, molecular, and cellular levels.

AUTHOR CONTRIBUTIONS

K.M.Z., C.V., J.G.M. and Y.B-S designed experiments. K.M.Z., C.V., N.L., X.L., S.H., J.G.M. and Y.B-S collected and analyzed data. K.M.Z., C.V., N.L. and Y.B-S wrote the manuscript.

DECLARATION OF INTERESTS

The authors declare no competing interests.

METHODS

Animals

Flies were maintained on a standard cornmeal medium under a 12:12 lightdark cycle at 25 Celsius. Unless specifically stated, the D. melanogaster Canton-S (CS) strain served as wild-type control animals. UAS-TNT-E, UAS-TNT-IMP-V1-A, UAS-mCD8::GFP, UAS-myr::GFP, UAS-Red Stinger, Df(1)BSC663, Df(1)BSC754, Gr8a-GAL4, Gr8a1, desat1 -Gal4, r4-Gal4 and fruP1-LexA fly lines were from the Bloomington Stock center. Originally in the w1118 background, the Gr8a1 null allele was outcrossed for six generations into the CS wild-type background, which was used as a control. Likewise, the desat1-Gal4 allele was outcrossed for six generations into this Gr8a null background. PromE(800)-GAL4 and PromE(800)>Luciferase were from Joel Levine (The University of Toronto, Canada). The following Drosophila species were obtained from the San Diego Stock Center: D. simulans 14011-0251.192, D. sechellia 14021-0248.03, D. yakuba 14021-0261.01, D. erecta 14021-0224.00, D. ananassae 14024-0371.16, D. pseudoobscura 14011-0121.104, D. persimilis 14011-0111.50, D. willistoni 14030-0811.35, D. mojavensis 15081-1352.23, and D. virilis 15010-1051.118. The UAS-Gr8a transgenic lines were generated by cloning the D. melanogaster and D. mojavensis Gr8a cDNAs into pUAST-attB vector by using 5’ EcoRI and 3’ NotI restriction sites, followed by ΦC31 integrase-dependent transgenesis at a Chromosome 2 attP landing site (2L:1476459), as previously described (Zheng et al., 2014). Subsequently, both UAS-Gr8aCDNA lines were transgressed into the Gr8a1 background, resulting in complete substitution of the endogenous Gr8a with expression of a Gr8a ortholog. The ppk23-LexA line was generated by integrating our previously described ppk23 promotor DNA fragment (Lu et al., 2012) into the pBPnlsLexA::p65Uw plasmid (Pfeiffer et al., 2010), followed by ΦC31 integrase-dependent transgenesis as above.

The GFP-tagged allele of Gr8a was generated via CRISPR/Cas9-dependent editing using a modified “scarless” strategy by using the sgRNA CGAGCAAGGCGGGAACGATT and a 3XP3>dsRed in the donor plasmid as a reporter for edited animals as previously described (Hill et al., 2017; Hill et al., 2019). Control lines with matching genetic backgrounds were established by selecting DsRed-negative injected animals. The final tagged Gr8a allele was generated by removing the DsRed cassette via the introduction of the piggyBac transposase (Hill et al., 2019).

Immunohistochemistry

To visualize the expression pattern of Gr8a in males and females, Gr8a-GAL4 flies (Lee et al., 2012) were crossed to UAS-CD8::EGFP and live-imaged at 5 days old using a Nikon-A1 confocal microscope. To demonstrate Gr8a expression in oenocytes, abdomens from Gr8a-GAL4/UAS-myr::GFP; PromE(800)>Luciferase flies were dissected and immunostained as previously described (Lu et al., 2012; Zheng et al., 2014) by using a Rabbit anti-GFP (1:1000; A-11122, Thermo Fisher Scientific) and a mouse anti-luciferase (1:100; 35-6700, Thermo Fisher Scientific) antibodies followed by AlexaFluor 488 anti-rabbit and AlexaFluor 568 anti-mouse secondary antibodies (Both at 1:1000; Thermo Fisher Scientific). To visualize the GR8A protein, abdomens of control flies and flies with CRISPR/Cas9 generated GFP-tagged GR8A were dissected and immunostained as previously described (Lu et al., 2012; Zheng et al., 2014) using a Rabbit anti-GFP antibody (1:1000; A-11122, Thermo Fisher Scientific) followed by AlexaFluor 488 anti-rabbit secondary antibody (1:1000; Thermo Fisher Scientific).

mRNA expression

Newly eclosed flies were separated by sex under CO2 and aged for 5 days on standard cornmeal medium. On day 6, flies were placed in a −80°C freezer until RNA extraction. To separate body parts, frozen flies were placed in 1.5ml microcentrifuge tubes, dipped in liquid nitrogen, and then vortexed repeatedly until heads, appendages, and bodies were clearly separated. Total RNA was extracted using the Trizol Reagent (Thermo Fisher Scientific) separately from heads, bodies, and appendages for Gr8a expression and from bodies for desaturase enzyme genes. cDNAs were synthesized using SuperScript II reverse transcriptase (Thermo Fisher Scientific) with 500 ng total RNA in a 20 uL reaction. Real-time quantitative RT-PCR was carried out as previously described with Rp49 as the loading control gene (Hill et al., 2017; Hill et al., 2019; Lu et al., 2012; Lu et al., 2014; Zheng et al., 2014). Primer sequences are described in Supplemental Tables 1–3.

Courtship Behavior Assays

Single-pair assays were performed as we have previously published (Lu et al., 2012, 2014). In short, newly eclosed males were kept individually on standard fly food in plastic vials (12 x 75mm). Newly eclosed virgin females were kept in groups of 10 flies. All behaviors were done with 4-7 day-old animals, which were housed under constant conditions of 25° C and a 12h:12h lightdark cycle. Courtship was video recorded for 10 min for male courtship and 15 min for female mating receptivity. Male courtship latency and index were measured as previously described (Lu et al., 2012; Lu et al., 2014). Female receptivity index was defined as the time from the initiation of male courtship until copulation was observed. Unless otherwise indicated, assays were performed under normal light conditions.

Male mate-choice assays were performed in round courtship arenas. Briefly, one D. melanogaster virgin female and one interspecific virgin female was decapitated under CO2 and placed in the arena. One virgin male D. melanogaster was then aspirated into the arena and behavior was video recorded for 10 minutes. The first female courted (by male wing extension) was noted. Male mate-choice assays were performed under red light conditions.

Perfuming studies

Synthetic compounds were synthesized by J.G.M. Perfuming studies were performed using a modified protocol from (Billeter et al., 2009). In short, 3 mg of each compound was dissolved in 6 mL hexane (Sigma-Aldrich #139386-500ML) and 0.5 mL was pipetted into individual 2 mL glass vials fitted with 9mm PTFE lined caps (Agilent Crosslab, Santa Clara, CA, USA). The hexane was evaporated under a nitrogen gas flow, such that a residue of the compound was left around the bottom one-third of the vial. Control vials were prepared using hexane without a spiked compound. Vials were kept at −20°C until use. Flies used in these trials were collected as described above, kept in single sex groups and aged for 4 days on standard cornmeal medium at 25°C. 24 hours before perfuming, 20 flies of one or the other sex were placed in glass vials containing standard cornmeal medium (12 x 75mm). To perfume the flies, these groups of 20 flies were dumped without anesthesia into each 2 mL vial containing the compound of interest, and were vortexed at medium-low speed for 3 pulses of 20 seconds punctuated by 20 second rest periods. Flies were transferred to new food vials and were allowed to recover for one hour. Perfumed flies were then used in courtship behavior assays as described above and the remaining flies were used in pheromone analyses to verify compound transfer. The genotype of flies that were perfumed differed based upon the genotype with the lower amount of each compound as determined in Figure 3 (B, C, F). In all cases, compound transfer was verified by CHC extraction and GC/MS (Supplemental Table 4).

Phylogenetic analysis

Protein sequences of GR8A orthologs from the 12 sequenced Drosophila reference genomes were aligned by using the ClustalW algorithm in the Omega package (Sievers et al., 2011), followed by ProtTest (v2.4) to determine the best model of protein evolution (Abascal et al., 2005). Subsequently, Akaike and Bayesian information criterion scores were used to select the appropriate substitution matrix. We then used a maximum likelihood approach and rapid bootstrapping within RAxML v 7.2.8 Black Box on the Cipres web portal to make a phylogenetic tree (Miller et al., 2010). Visualizations of the bipartition files were made using FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).

Pheromone Analysis

Virgin flies were collected upon eclosion under a light CO2 anesthesia and kept in single-sex vials in groups of 10 with 6 biological replications for each genotype and sex. Virgin flies were aged for 5 days on standard cornmeal medium at 25°C. To collect mated flies, both females and males were aged for 3 days before single mating pairs were placed in a standard fly vial with standard cornmeal food for 24 hours. The pair was then separated for 24 hours before collection. Copulation was confirmed by the presence of larvae in the vials of mated females several days later. On the morning of day 5, flies were anesthetized under light CO2 and groups of five flies were placed in individual scintillation vials (VWR 74504-20). To extract CHCs, each group of flies was covered by 100 uL hexane (Sigma-Aldrich #139386-500ML) containing 50μg/mL hexacosane (Sigma-Aldrich #241687-5G) and was washed for ten minutes. Subsequently, hexane washes were transferred into a new 2 ml glass vial containing a 350 uL insert (Thermo Scientific C4000-LV-1W) and were stored at −20°C until shipment to the Millar laboratory.

Analyses of CHC profiles were done by gas chromatography and mass spectroscopy (GC-MS) in the Millar laboratory at UC Riverside as previously described (Chung et al., 2014). Peak areas were measured, and data was normalized to known quantity of internal standard hexacosane (Sigma-Aldrich #241687-5G). The relative proportion of each compound in each sample was calculated and used in further statistical analysis.

Statistical Analysis

All statistical analyses were performed in R (v 3.6.2). The following functions were used in the base statistics package: t.test() (t-test), wilcox.test() (Mann-Whitney Rank Sum Test), aov() (ANOVA), TukeyHSD() (Tukey’s HSD post hoc test), Kruskal.test() (Kruskal-Wallis test), chisq.test() (Pearson’s Chi-squared test). Kruskal-Wallis post hoc was performed using the dunn.test.control function in the PMCMR package (Pohlert, 2014). Qualitative CHC data were analyzed through a permutation MANOVA using the adonis function in the vegan package of R with Bray-Curtis dissimilarity measures (Oksanen, 2011). CHC profile data were visualized using non-metric multidimensional scaling (metaMDS) function in the vegan package of R (Oksanen, 2015) using Bray-Curtis dissimilarity, and either 2 or 3 dimensions in order to minimize stress to <0.1.

SUPPLEMENTAL INFORMATION

Supplemental Figure 1.
Supplemental Figure 1.

Gr8a has no effect on male courtship latency or index toward wild-type females. (A) Courtship latency (s) and index of control Gr8a-gal4/UAS-IMP-TNT-V1A (Gr8a>TNTinactive) and Gr8a-gal4/UAS-TNT-E (Gr8a>TNT) mutant males towards wild-type females. (B) Courtship latency (s) and index of wild-type (CS) and Gr8a null (Gr8a-) males toward wild-type decapitated females. Mann Whitney Rank Sum Test, not significant (p>0.05), n=15/group.

View this table:
Supplemental Table 1. Nucleotide sequences for qRT-PCR primers for D. melanogaster Gr genes.
View this table:
Supplemental Table 2. Nucleotide sequences for qRT-PCR primers for D. melanogaster Gr8a, Rp49 and orthologs.
View this table:
Supplemental Table 3. Nucleotide sequences for qRT-PCR primers for D. melanogaster desaturase enzyme genes.
View this table:
Supplemental Table 4. Amount (ng) of each perfumed compound measured in each sample of perfumed flies (5 flies per sample).

Supplemental Data Legends

Figure 1 Data: Average qRT-PCR Ct scores across 3 technical replicates for each fly sample for Gr8a and rp49 (control).

Figure 2 Data: Copulation latency (s) or courtship index of single-pair courtship trials corresponding to Figure 2.

Figure 3 Data: Amount (ng) of each compound extracted from each sample (5 flies/sample) in Figure 3. Average qRT-PCR Ct scores across 3 technical replicates for each fly sample for every desaturase gene measured and rp49 (control). Genes were run on separate qPCR plates, indicated by plate number in parentheses.

Figure 4 Data: Copulation latency (s) of single-pair courtship trials with perfumed males. Courtship latency (s), courtship index, and copulation latency (s) of single-pair courtship trials with perfumed females.

Figure 5 Data: Average qRT-PCR Ct scores across 3 technical replicates for each fly sample for Gr8a and rp49 (control) across Drosophila species. Number of flies courted first by D. melanogaster males in choice assays. Amount (ng) of each compound extracted from each sample (5 flies/sample) in Figure 5.

Figure S1 Data: Courtship latency (s) and index of single-pair courtship trials corresponding to Supplemental Figure 1.

ACKNOWLEDGMENTS

We thank members of the Ben-Shahar lab for comments on earlier versions of the manuscript. We thank Joshua Krupp (University of Toronto) for assistance with perfuming studies, Nabeel Chowdhury and Deanna Simon for assistance with qRT-PCR analysis, and Paula Kiefel for technical help with generating transgenic flies. This work was supported by NSF grants 1322783, 1754264, and 1707221, and NIH grant NS089834 awarded to Y. B-S. Stocks obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537) were used in this study. Wild-type Drosophila species were obtained from the National Drosophila Species Stock Center at Cornell University.

Footnotes

  • ↵5 Lead Contact

REFERENCES

  1. ↵
    Abascal, F., Zardoya, R., and Posada, D. (2005). ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104–2105. bti263 [pii] doi:10.1093/bioinformatics/bti263.
    OpenUrlCrossRefPubMedWeb of Science
  2. ↵
    Averhoff, W.W., and Richardson, R.H. (1974). Pheromonal control of mating patterns in Drosophila melanogaster. Behav Genet 4, 207–225.
    OpenUrlCrossRefPubMedWeb of Science
  3. ↵
    Ben-Shahar, Y. (2015). Editorial overview: Neuroscience: How nervous systems generate behavior: lessons from insects. Current Opinion in Insect Science 12, v–vii. doi:10.1016/j.cois.2015.10.005.
    OpenUrlCrossRef
  4. ↵
    Ben-Shahar, Y., Lu, B., Collier, D.M., Snyder, P.M., Schnizler, M., and Welsh, M.J. (2010). The Drosophila gene CheB42a is a novel modifier of Deg/ENaC channel function. PLoS One 5, e9395. doi:10.1371/journal.pone.0009395.
    OpenUrlCrossRefPubMed
  5. ↵
    Ben-Shahar, Y., Nannapaneni, K., Casavant, T.L., Scheetz, T.E., and Welsh, M.J. (2007). Eukaryotic operon-like transcription of functionally related genes in Drosophila. Proc Natl Acad Sci U S A 104, 222–227. doi:10.1073/pnas.0609683104.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Benton, R., Vannice, K.S., and Vosshall, L.B. (2007). An essential role for a CD36-related receptor in pheromone detection in Drosophila. Nature 450, 289–293. doi:10.1038/nature06328.
    OpenUrlCrossRefPubMedWeb of Science
  7. ↵
    Billeter, J.C., Atallah, J., Krupp, J.J., Millar, J.G., and Levine, J.D. (2009). Specialized cells tag sexual and species identity in Drosophila melanogaster. Nature 461, 987–991. doi:10.1038/nature08495.
    OpenUrlCrossRefPubMedWeb of Science
  8. ↵
    Billeter, J.C., and Levine, J.D. (2013). Who is he and what is he to you? Recognition in Drosophila melanogaster. Curr Opin Neurobiol 23, 17–23. doi:10.1016/j.conb.2012.08.009.
    OpenUrlCrossRefPubMed
  9. ↵
    Blomquist, G.J., and Bagnères, A.-G. (2010). Insect hydrocarbons: biology, biochemistry, and chemical ecology (Cambridge University Press).
  10. ↵
    Boake, C.R. (1991). Coevolution of senders and receivers of sexual signals: Genetic coupling and genetic correlations. Trends Ecol Evol 6, 225–227. doi:10.1016/0169-5347(91)90027-U.
    OpenUrlCrossRefPubMedWeb of Science
  11. ↵
    Bousquet, F., Nojima, T., Houot, B., Chauvel, I., Chaudy, S., Dupas, S., Yamamoto, D., and Ferveur, J.F. (2012). Expression of a desaturase gene, desat1, in neural and nonneural tissues separately affects perception and emission of sex pheromones in Drosophila. Proc Natl Acad Sci U S A 109, 249–254. doi:10.1073/pnas.1109166108.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Bray, S., and Amrein, H. (2003). A putative Drosophila pheromone receptor expressed in male-specific taste neurons is required for efficient courtship. Neuron 39, 1019–1029.
    OpenUrlCrossRefPubMedWeb of Science
  13. ↵
    Brooks, R., Hunt, J., Blows, M.W., Smith, M.J., Bussiere, L.F., and Jennions, M.D. (2005). Experimental evidence for multivariate stabilizing sexual selection. Evolution 59, 871–880. Doi 10.1111/J.0014-3820.2005.Tb01760.X.
    OpenUrlCrossRefPubMedWeb of Science
  14. ↵
    Butlin, R.K., and Ritchie, M.G. (1989). Genetic coupling in mate recognition systems: what is the evidence? Biological Journal of the Linnean Society 37, 237–246. doi:10.1111/j.1095-8312.1989.tb01902.x.
    OpenUrlCrossRefWeb of Science
  15. ↵
    1. R.T. Cardé, and
    2. A.K. Minks
    Butlin, R.K., and Trickett, A.J. (1997). Can Population Genetic Simulations Help to Interpret Pheromone Evolution? In Insect Pheromone Research, R.T. Cardé, and A.K. Minks, eds. (Springer US), pp. 548–562. doi:10.1007/978-1-4615-6371-6_47.
    OpenUrlCrossRef
  16. ↵
    Chebib, J., and Guillaume, F. (2021). Pleiotropy or linkage? Their relative contributions to the genetic correlation of quantitative traits and detection by multitrait GWA studies. Genetics 219. doi:10.1093/genetics/iyab159.
    OpenUrlCrossRef
  17. ↵
    Chenoweth, S.F., and Blows, M.W. (2006). Dissecting the complex genetic basis of mate choice. Nat Rev Genet 7, 681–692. doi:10.1038/nrg1924.
    OpenUrlCrossRefPubMedWeb of Science
  18. ↵
    Chung, H., and Carroll, S.B. (2015). Wax, sex and the origin of species: Dual roles of insect cuticular hydrocarbons in adaptation and mating. Bioessays 37, 822–830. doi:10.1002/bies.201500014.
    OpenUrlCrossRefPubMed
  19. ↵
    Chung, H., Loehlin, D.W., Dufour, H.D., Vaccarro, K., Millar, J.G., and Carroll, S.B. (2014). A single gene affects both ecological divergence and mate choice in Drosophila. Science 343, 1148–1151. doi:10.1126/science.1249998.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Clowney, E.J., Iguchi, S., Bussell, J.J., Scheer, E., and Ruta, V. (2015). Multimodal Chemosensory Circuits Controlling Male Courtship in Drosophila. Neuron 87, 1036–1049. doi:10.1016/j.neuron.2015.07.025.
    OpenUrlCrossRefPubMed
  21. ↵
    Clyne, P.J., Warr, C.G., and Carlson, J.R. (2000). Candidate Taste Receptors in Drosophila. Science 287, 1830–1834. doi:10.1126/science.287.5459.1830.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Datta, S.R., Vasconcelos, M.L., Ruta, V., Luo, S., Wong, A., Demir, E., Flores, J., Balonze, K., Dickson, B.J., and Axel, R. (2008). The Drosophila pheromone cVA activates a sexually dimorphic neural circuit. Nature 452, 473–477. nature06808 [pii] doi:10.1038/nature06808.
    OpenUrlCrossRefPubMedWeb of Science
  23. ↵
    Dunipace, L., Meister, S., McNealy, C., and Amrein, H. (2001). Spatially restricted expression of candidate taste receptors in the Drosophila gustatory system. Curr Biol 11, 822–835. S0960-9822(01)00258-5 [pii].
    OpenUrlCrossRefPubMedWeb of Science
  24. ↵
    Dweck, H.K., Ebrahim, S.A., Thoma, M., Mohamed, A.A., Keesey, I.W., Trona, F., Lavista-Llanos, S., Svatos, A., Sachse, S., Knaden, M., and Hansson, B.S. (2015). Pheromones mediating copulation and attraction in Drosophila. Proc Natl Acad Sci U S A 112, E2829–2835. doi:10.1073/pnas.1504527112.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Dweck, H.K.M., and Carlson, J.R. (2020). Molecular Logic and Evolution of Bitter Taste in Drosophila. Curr Biol 30, 17–30 e13. doi:10.1016/j.cub.2019.11.005.
    OpenUrlCrossRefPubMed
  26. ↵
    Dyer, K.A., White, B.E., Sztepanacz, J.L., Bewick, E.R., and Rundle, H.D. (2014). Reproductive character displacement of epicuticular compounds and their contribution to mate choice in Drosophila subquinaria and Drosophila recens. Evolution 68, 1163–1175. doi:10.1111/evo.12335.
    OpenUrlCrossRefPubMed
  27. ↵
    Ferveur, J.F. (2005). Cuticular hydrocarbons: their evolution and roles in Drosophila pheromonal communication. Behav Genet 35, 279–295. doi:10.1007/s10519-005-3220-5.
    OpenUrlCrossRefPubMedWeb of Science
  28. ↵
    Ford, C.P. (2014). The role of D2-autoreceptors in regulating dopamine neuron activity and transmission. Neuroscience 282, 13–22. doi:10.1016/j.neuroscience.2014.01.025.
    OpenUrlCrossRefPubMedWeb of Science
  29. ↵
    Fukamachi, S., Kinoshita, M., Aizawa, K., Oda, S., Meyer, A., and Mitani, H. (2009). Dual control by a single gene of secondary sexual characters and mating preferences in medaka. BMC Biol 7, 64. doi:10.1186/1741-7007-7-64.
    OpenUrlCrossRefPubMed
  30. ↵
    Gutierrez, E., Wiggins, D., Fielding, B., and Gould, A.P. (2007). Specialized hepatocytelike cells regulate Drosophila lipid metabolism. Nature 445, 275–280. doi:10.1038/nature05382.
    OpenUrlCrossRefPubMedWeb of Science
  31. ↵
    Heinen-Kay, J.L., Nichols, R.E., and Zuk, M. (2020). Sexual signal loss, pleiotropy, and maintenance of a male reproductive polymorphism in crickets. Evolution 74, 1002–1009. doi:10.1111/evo.13952.
    OpenUrlCrossRef
  32. ↵
    Hill, A., Zheng, X., Li, X., McKinney, R., Dickman, D., and Ben-Shahar, Y. (2017). The Drosophila Postsynaptic DEG/ENaC Channel ppk29 Contributes to Excitatory Neurotransmission. J Neurosci 37, 3171–3180. doi:10.1523/JNEUROSCI.3850-16.2017.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Hill, A.S., Jain, P., Folan, N.E., and Ben-Shahar, Y. (2019). The Drosophila ERG channel seizure plays a role in the neuronal homeostatic stress response. PLoS Genet 15, e1008288. doi:10.1371/journal.pgen.1008288.
    OpenUrlCrossRefPubMed
  34. ↵
    Howard, R.W., and Blomquist, G.J. (2005). ECOLOGICAL, BEHAVIORAL, AND BIOCHEMICAL ASPECTS OF INSECT HYDROCARBONS. Annual Review of Entomology 50, 371–393. doi:10.1146/annurev.ento.50.071803.130359.
    OpenUrlCrossRefPubMedWeb of Science
  35. ↵
    Hoy, R.R., Hahn, J., and Paul, R.C. (1977). Hybrid cricket auditory behavior: evidence for genetic coupling in animal communication. Science 195, 82–84. doi:10.1126/science.831260.
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Jin, X., Ha, T.S., and Smith, D.P. (2008). SNMP is a signaling component required for pheromone sensitivity in Drosophila. Proc Natl Acad Sci U S A 105, 10996–11001. 0803309105 [pii] doi:10.1073/pnas.0803309105.
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Kallman, B.R., Kim, H., and Scott, K. (2015). Excitation and inhibition onto central courtship neurons biases Drosophila mate choice. eLife 4. doi:10.7554/elife.11188.
    OpenUrlCrossRef
  38. ↵
    Khallaf, M.A., Cui, R., Weissflog, J., Erdogmus, M., Svatos, A., Dweck, H.K.M., Valenzano, D.R., Hansson, B.S., and Knaden, M. (2021). Large-scale characterization of sex pheromone communication systems in Drosophila. Nat Commun 12, 4165. doi:10.1038/s41467-021-24395-z.
    OpenUrlCrossRef
  39. ↵
    Kirkpatrick, M., and Hall, D.W. (2004). Sexual selection and sex linkage. Evolution 58, 683–691. doi:10.1111/j.0014-3820.2004.tb00401.x.
    OpenUrlCrossRefPubMedWeb of Science
  40. ↵
    Koh, T.W., He, Z., Gorur-Shandilya, S., Menuz, K., Larter, N.K., Stewart, S., and Carlson, J.R. (2014). The Drosophila IR20a clade of ionotropic receptors are candidate taste and pheromone receptors. Neuron 83, 850–865. doi:10.1016/j.neuron.2014.07.012.
    OpenUrlCrossRefPubMedWeb of Science
  41. ↵
    Krupp, J.J., Kent, C., Billeter, J.C., Azanchi, R., So, A.K., Schonfeld, J.A., Smith, B.P., Lucas, C., and Levine, J.D. (2008). Social experience modifies pheromone expression and mating behavior in male Drosophila melanogaster. Curr Biol 18, 1373–1383. S0960-9822(08)01034-8 [pii] doi:10.1016/j.cub.2008.07.089.
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Kurtovic, A., Widmer, A., and Dickson, B.J. (2007). A single class of olfactory neurons mediates behavioural responses to a Drosophila sex pheromone. Nature 446, 542–546. nature05672 [pii] doi:10.1038/nature05672.
    OpenUrlCrossRefPubMedWeb of Science
  43. ↵
    Labeur, C., Dallerac, R., and Wicker-Thomas, C. (2002). Involvement of desat1 gene in the control of Drosophila melanogaster pheromone biosynthesis. Genetica 114, 269–274. doi:10.1023/a:1016223000650.
    OpenUrlCrossRefPubMedWeb of Science
  44. ↵
    Lacaille, F., Hiroi, M., Twele, R., Inoshita, T., Umemoto, D., Manière, G., Marion-Poll, F., Ozaki, M., Francke, W., Cobb, M., et al. (2007). An Inhibitory Sex Pheromone Tastes Bitter for Drosophila Males. PLoS ONE 2, e661. doi:10.1371/journal.pone.0000661.
    OpenUrlCrossRefPubMed
  45. ↵
    Lande, R. (1980). The Genetic Covariance between Characters Maintained by Pleiotropic Mutations. Genetics 94, 203–215. doi:10.1093/genetics/94.1.203.
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Laturney, M., and Billeter, J.C. (2016). Drosophila melanogaster females restore their attractiveness after mating by removing male anti-aphrodisiac pheromones. Nat Commun 7, 12322. doi:10.1038/ncomms12322.
    OpenUrlCrossRef
  47. ↵
    Lebreton, S., Grabe, V., Omondi, A.B., Ignell, R., Becher, P.G., Hansson, B.S., Sachse, S., and Witzgall, P. (2014). Love makes smell blind: mating suppresses pheromone attraction in Drosophila females via Or65a olfactory neurons. Scientific reports 4, 7119. doi:10.1038/srep07119.
    OpenUrlCrossRefPubMed
  48. ↵
    Lee, Y., Kang, M.J., Shim, J., Cheong, C.U., Moon, S.J., and Montell, C. (2012). Gustatory receptors required for avoiding the insecticide L-canavanine. J Neurosci 32, 1429–1435. doi:10.1523/JNEUROSCI.4630-11.2012.
    OpenUrlAbstract/FREE Full Text
  49. ↵
    Lee, Y., Moon, S.J., and Montell, C. (2009). Multiple gustatory receptors required for the caffeine response in Drosophila. Proc Natl Acad Sci U S A 106, 4495–4500. 0811744106 [pii] doi:10.1073/pnas.0811744106.
    OpenUrlAbstract/FREE Full Text
  50. ↵
    Leitner, N., and Ben-Shahar, Y. (2020). The neurogenetics of sexually dimorphic behaviors from a postdevelopmental perspective. Genes Brain Behav 19, e12623. doi:10.1111/gbb.12623.
    OpenUrlCrossRef
  51. ↵
    Lu, B., LaMora, A., Sun, Y., Welsh, M.J., and Ben-Shahar, Y. (2012). ppk23-Dependent chemosensory functions contribute to courtship behavior in Drosophila melanogaster. PLoS Genet 8, e1002587. doi:10.1371/journal.pgen.1002587.
    OpenUrlCrossRefPubMed
  52. ↵
    Lu, B., Zelle, K.M., Seltzer, R., Hefetz, A., and Ben-Shahar, Y. (2014). Feminization of pheromone-sensing neurons affects mating decisions in Drosophila males. Biology open 3, 152–160. doi:10.1242/bio.20147369.
    OpenUrlAbstract/FREE Full Text
  53. ↵
    McKinney, R.M., Vernier, C., and Ben-Shahar, Y. (2015). The neural basis for insect pheromonal communication. Curr Opin Insect Sci 12, 86–92. doi:10.1016/j.cois.2015.09.010.
    OpenUrlCrossRef
  54. ↵
    Miller, M.A., Pfeiffer, W., and Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 14–14 Nov. 2010. pp. 1–8.
  55. ↵
    Miyamoto, T., and Amrein, H. (2008). Suppression of male courtship by a Drosophila pheromone receptor. Nat Neurosci 11, 874–876. nn.2161 [pii] doi:10.1038/nn.2161.
    OpenUrlCrossRefPubMed
  56. ↵
    Moon, S.J., Lee, Y., Jiao, Y., and Montell, C. (2009). A Drosophila gustatory receptor essential for aversive taste and inhibiting male-to-male courtship. Curr Biol 19, 1623–1627. S0960-9822(09)01487-0 [pii] doi:10.1016/j.cub.2009.07.061.
    OpenUrlCrossRefPubMedWeb of Science
  57. ↵
    Oksanen, J. (2011). Multivariate analysis of ecological communities in R: vegan tutorial. R package version 1, 1–43.
    OpenUrl
  58. ↵
    Oksanen, J. (2015). Vegan: an introduction to ordination. URL http://cran.r-project.org/web/packages/vegan/vignettes/introvegan.pdf 8, 19.
  59. ↵
    Pfeiffer, B.D., Ngo, T.T., Hibbard, K.L., Murphy, C., Jenett, A., Truman, J.W., and Rubin, G.M. (2010). Refinement of tools for targeted gene expression in Drosophila. Genetics 186, 735–755. doi:10.1534/genetics.110.119917.
    OpenUrlAbstract/FREE Full Text
  60. ↵
    Pikielny, C.W. (2012). Sexy DEG/ENaC channels involved in gustatory detection of fruit fly pheromones. Sci Signal 5, pe48. doi:10.1126/scisignal.2003555.
    OpenUrlAbstract/FREE Full Text
  61. ↵
    Pohlert, T. (2014). The pairwise multiple comparison of mean ranks package (PMCMR).
  62. ↵
    Poudel, S., Kim, Y., Kim, Y.T., and Lee, Y. (2015). Gustatory receptors required for sensing umbelliferone in Drosophila melanogaster. Insect Biochem Mol Biol 66, 110–118. doi:10.1016/j.ibmb.2015.10.010.
    OpenUrlCrossRef
  63. ↵
    Scott, K., Brady, R., Jr.., Cravchik, A., Morozov, P., Rzhetsky, A., Zuker, C., and Axel, R. (2001). A chemosensory gene family encoding candidate gustatory and olfactory receptors in Drosophila. Cell 104, 661–673. S0092-8674(01)00263-X [pii].
    OpenUrlCrossRefPubMedWeb of Science
  64. ↵
    Shahandeh, M.P., Pischedda, A., and Turner, T.L. (2018). Male mate choice via cuticular hydrocarbon pheromones drives reproductive isolation between Drosophila species. Evolution 72, 123–135. doi:10.1111/evo.13389.
    OpenUrlCrossRef
  65. ↵
    Shankar, S., Chua, J.Y., Tan, K.J., Calvert, M.E.K., Weng, R., Ng, W.C., Mori, K., and Yew, J.Y. (2015). The neuropeptide tachykinin is essential for pheromone detection in a gustatory neural circuit. eLife 4. doi:10.7554/elife.06914.
    OpenUrlCrossRef
  66. ↵
    Shaw, K.L., Ellison, C.K., Oh, K.P., and Wiley, C. (2011). Pleiotropy, “sexy” traits, and speciation. Behavioral Ecology 22, 1154–1155.
    OpenUrlCrossRef
  67. ↵
    Shaw, K.L., and Lesnick, S.C. (2009). Genomic linkage of male song and female acoustic preference QTL underlying a rapid species radiation. Proc Natl Acad Sci U S A 106, 9737–9742. doi:10.1073/pnas.0900229106.
    OpenUrlAbstract/FREE Full Text
  68. ↵
    Shim, J., Lee, Y., Jeong, Y.T., Kim, Y., Lee, M.G., Montell, C., and Moon, S.J. (2015). The full repertoire of Drosophila gustatory receptors for detecting an aversive compound. Nat Commun 6, 8867. doi:10.1038/ncomms9867.
    OpenUrlCrossRefPubMed
  69. ↵
    Shirangi, T.R., Dufour, H.D., Williams, T.M., and Carroll, S.B. (2009). Rapid evolution of sex pheromone-producing enzyme expression in Drosophila. PLoS Biol 7, e1000168. doi:10.1371/journal.pbio.1000168.
    OpenUrlCrossRefPubMed
  70. ↵
    Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J., et al. (2011). Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology 7.
  71. ↵
    Singh, N.D., and Shaw, K.L. (2012). On the scent of pleiotropy. Proc Natl Acad Sci U S A 109, 5–6. doi:10.1073/pnas.1118531109.
    OpenUrlFREE Full Text
  72. ↵
    Stagkourakis, S., Kim, H., Lyons, D.J., and Broberger, C. (2016). Dopamine Autoreceptor Regulation of a Hypothalamic Dopaminergic Network. Cell reports. doi:10.1016/j.celrep.2016.03.062.
    OpenUrlCrossRefPubMed
  73. ↵
    Steiger, S., Schmitt, T., and Schaefer, H.M. (2011). The origin and dynamic evolution of chemical information transfer. Proc Biol Sci 278, 970–979. doi:10.1098/rspb.2010.2285.
    OpenUrlCrossRefPubMed
  74. ↵
    Sung, H.Y., Jeong, Y.T., Lim, J.Y., Kim, H., Oh, S.M., Hwang, S.W., Kwon, J.Y., and Moon, S.J. (2017). Heterogeneity in the Drosophila gustatory receptor complexes that detect aversive compounds. Nat Commun 8, 1484. doi:10.1038/s41467-017-01639-5.
    OpenUrlCrossRefPubMed
  75. ↵
    Sweigart, A.L. (2010). The genetics of postmating, prezygotic reproductive isolation between Drosophila virilis and D. americana. Genetics 184, 401–410. doi:10.1534/genetics.109.111245.
    OpenUrlAbstract/FREE Full Text
  76. ↵
    Symonds, M.R., and Elgar, M.A. (2008). The evolution of pheromone diversity. Trends Ecol Evol 23, 220–228. doi:10.1016/j.tree.2007.11.009.
    OpenUrlCrossRefPubMedWeb of Science
  77. ↵
    Symonds, M.R., and Wertheim, B. (2005). The mode of evolution of aggregation pheromones in Drosophila species. J Evol Biol 18, 1253–1263. doi:10.1111/j.1420-9101.2005.00971.x.
    OpenUrlCrossRefPubMedWeb of Science
  78. ↵
    Thistle, R., Cameron, P., Ghorayshi, A., Dennison, L., and Scott, K. (2012). Contact Chemoreceptors Mediate Male-Male Repulsion and Male-Female Attraction during Drosophila Courtship. Cell 149, 1140–1151. S0092-8674(12)00523-5 [pii] doi:10.1016/j.cell.2012.03.045.
    OpenUrlCrossRefPubMedWeb of Science
  79. ↵
    Toda, H., Zhao, X., and Dickson, B.J. (2012). The Drosophila Female Aphrodisiac Pheromone Activates ppk23+ Sensory Neurons to Elicit Male Courtship Behavior. Cell reports doi:10.1016/j.celrep.2012.05.007, 599–607. 10.1016/j.celrep.2012.05.007.
    OpenUrlCrossRefPubMedWeb of Science
  80. ↵
    van der Goes van Naters, W., and Carlson, J.R. (2007). Receptors and neurons for fly odors in Drosophila. Curr Biol 17, 606–612. S0960-9822(07)01020-2 [pii] doi:10.1016/j.cub.2007.02.043.
    OpenUrlCrossRefPubMedWeb of Science
  81. ↵
    Vijayan, V., Thistle, R., Liu, T., Starostina, E., and Pikielny, C.W. (2014). Drosophila pheromone-sensing neurons expressing the ppk25 ion channel subunit stimulate male courtship and female receptivity. PLoS Genet 10, e1004238. doi:10.1371/journal.pgen.1004238.
    OpenUrlCrossRefPubMed
  82. ↵
    Wang, Z., Singhvi, A., Kong, P., and Scott, K. (2004). Taste representations in the Drosophila brain. Cell 117, 981–991. doi:10.1016/j.cell.2004.06.011 S009286740400577X [pii].
    OpenUrlCrossRefPubMedWeb of Science
  83. ↵
    Watanabe, K., Toba, G., Koganezawa, M., and Yamamoto, D. (2011). Gr39a, a highly diversified gustatory receptor in Drosophila, has a role in sexual behavior. Behav Genet 41, 746–753. doi:10.1007/s10519-011-9461-6.
    OpenUrlCrossRefPubMed
  84. ↵
    Wiley, C., Ellison, C.K., and Shaw, K.L. (2012). Widespread genetic linkage of mating signals and preferences in the Hawaiian cricket Laupala. Proc Biol Sci 279, 1203–1209. doi:10.1098/rspb.2011.1740.
    OpenUrlCrossRefPubMed
  85. ↵
    Wyatt, T.D. (2014). Pheromones and animal behavior: chemical signals and signatures, Second edition. Edition (Cambridge University Press).
  86. ↵
    Yang, C.-h., Rumpf, S., Xiang, Y., Gordon, M.D., Song, W., Jan, L.Y., and Jan, Y.-N. (2009). Control of the Postmating Behavioral Switch in Drosophila Females by Internal Sensory Neurons. Neuron 61, 519–526.
    OpenUrlCrossRefPubMedWeb of Science
  87. ↵
    Yew, J.Y., and Chung, H. (2015). Insect pheromones: An overview of function, form, and discovery. Prog Lipid Res 59, 88–105. doi:10.1016/j.plipres.2015.06.001.
    OpenUrlCrossRef
  88. ↵
    Yew, J.Y., Dreisewerd, K., Luftmann, H., Muthing, J., Pohlentz, G., and Kravitz, E.A. (2009). A new male sex pheromone and novel cuticular cues for chemical communication in Drosophila. Curr Biol 19, 1245–1254. S0960-9822(09)01313-X [pii] doi:10.1016/j.cub.2009.06.037.
    OpenUrlCrossRefPubMed
  89. ↵
    Zheng, X., Valakh, V., DiAntonio, A., and Ben-Shahar, Y. (2014). Natural antisense transcripts regulate the neuronal stress response and excitability. eLife 3, e01849. doi:10.7554/eLife.01849.
    OpenUrlCrossRefPubMed
Back to top
Posted January 10, 2022.
Download PDF

Supplementary Material

Email
A pleiotropic chemoreceptor facilitates the functional coupling of pheromone production and perception
Cassondra Vernier, Kathleen M. Zelle, Nicole Leitner, Xitong Liang, Sean Halloran, Jocelyn G. Millar, Yehuda Ben-Shahar
bioRxiv 2022.01.10.475668; doi: https://doi.org/10.1101/2022.01.10.475668
Digg logo Reddit logo Twitter logo Facebook logo Google logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area