Abstract
Sperm flagellum is essential for male fertility, defects in flagellum biogenesis are associated with male infertility. Deficiency of CCDC42 is associated with malformation of the mouse sperm flagella. Here, we find that the testis-specific expressed protein CCDC38 (coiled-coil domain containing 38) interacts with CCDC42 and localizes on manchette and sperm tail during spermiogenesis. Inactivation of CCDC38 in male mice results in distorted manchette, multiple morphological abnormalities of the flagella (MMAF) of spermatozoa, and eventually male sterility. Furthermore, we find that CCDC38 interacts with intra-flagellar transport protein 88 (IFT88) as well as the outer dense fibrous 2 (ODF2), and its depletion reduces the transportation of ODF2 to flagellum. Altogether, our results uncover the essential role of CCDC38 during sperm flagellum biogenesis, and suggesting the defects of these genes might be associated with male infertility in human being.
Summary statement We demonstrated that CCDC38, localizes on manchette and sperm tail, is crucial for male fertility.
Introduction
Sperm flagellum is essential for sperm motility (Freitas et al., 2017, Pereira et al., 2017), which is a fundamental requirement for male fertility. The flagellum contains four parts: connecting piece, midpiece, principal piece and end piece. The core of sperm flagellum is the central axoneme, which consists of a central microtubule pair (CP) connected to 9 peripheral outer microtubule doublets (MD) to form ‘9+2’ structure (Sironen et al., 2020). The axoneme possesses radial spokes that connect the central and peripheral microtubules and are related to the mechanical movement of the flagellum (Inaba, 2011). Besides the axoneme, sperm flagellum contains unique structures, outer dense fiber (ODF) and fibrous sheath (FS) that are not present in cilia or unicellular flagella (Fawcett, 1975). The outer dense fibers (ODFs) are the main component cytoskeletal elements of sperm flagellum, which is required for the sperm motility (Inaba, 2011). ODFs contain 9 fibers in the midpiece, each of which is associated with a microtubule doublet. In the principal piece, ODFs 3 and 8 are replaced by two longitudinal columns of fibrous sheath (FS), in human, the diminished 3 and 8 fibers are finished at the annulus (Azizi and Ghafouri-Fard, 2017, Kim et al., 1999). There are at least 14 polypeptides of ODFs such as ODF1, ODF2 (Lehti and Sironen, 2017). Any defects in the axoneme structure can cause abnormalities in the sperm flagellum, change its morphology, causing severe sperm motility disorders (Sha et al., 2014). Thus, axoneme structures are very important to sperm morphology and the function of flagellum.
Multiple morphological abnormalities of the flagella (MMAF) is a kind of severe teratozoospermia (Coutton et al., 2015), which is characterized by various spermatozoa phenotype with absent, short, coiled, irregular flagellum and others. There are many flagellar axoneme defects in MMAF patients, including disorganization of microtubule doublets (MD), outer dense fibrous (ODF), fibrous sheath (FS), outer or inner dynein arms (ODA, IDA) and others (Jiao et al., 2021). Over the past several years, many mutations have been found to be associated with MMAF patients, and a lot of mouse models display MMAF-like phenotype, Dnah2 (Li et al., 2019), Dnah8 (Liu et al., 2020), Cfap44, Cfap65 (Tang et al., 2017, Li et al., 2020), Qrich2 (Shen et al., 2019), Cep135 (Sha et al., 2017) and Ttc21a (Liu et al., 2019) are reported to MMAF related genes. Despite rapid progress in understanding the mechanism of MMAF, the pathogenesis of many idiopathic MMAF patients is still unknown.
The coiled-coil domain-containing (CCDC) proteins are involved in a variety of physiological and pathological processes. Increasing number of CCDC proteins have been suggested to be involved in ciliogenesis (Priyanka and Yenugu, 2021). But only some of those genes are involved in spermatogenesis, such as Ccdc9, Ccdc11, Ccdc33, Ccdc42, Ccdc63, Ccdc172, which are associated with sperm flagellum biogenesis and manchette formation, their defects lead to male infertility (Sha et al., 2019, Wu et al., 2021, Tapia Contreras and Hoyer-Fender, 2019, Young et al., 2015, Yamaguchi et al., 2014). Ccdc42 is highly expressed in mouse testis, it localizes on manchette, HTCA and sperm tail during spermatogenesis, and it is necessary for HTCA assembly and sperm flagellum biogenesis (Tapia Contreras and Hoyer-Fender, 2019). However, the functional role of CCDC42 in spermatogenesis is still poorly understood.
Here, we found that CCDC38 was directly interacted with CCDC42, and it was expressed in the testis, and associated with the manchette in elongating spermatid. Importantly, Ccdc38 knockout in mice resulted in abnormally elongated manchette and MMAF-like phenotype. Furthermore, we found that CCDC38 could interact with IFT88 and ODF2 to facilitate ODF2 transportation in flagella. Our results suggested that CCDC42 incorporating with CCDC38 mediates ODF2 transportation during flagellum biogenesis, and both are essential for flagellum biogenesis and male fertility in mice, suggesting some mutations of these two genes might be associated with male infertility in human being.
Results
CCDC38 interacts with CCDC42
Many CCDC proteins participate in flagellum biogenesis during spermiogenesis (Priyanka and Yenugu, 2021). CCDC42 localized to the centrosome, HTCA, manchette and sperm tail in male germ cells, and it is involved in the biogenesis of motile cilia and flagellum in mice (Perles et al., 2012, Tapia Contreras and Hoyer-Fender, 2019, Pasek et al., 2016, Silva et al., 2016). To understand the underlying mechanism of CCDC42 in flagellum biogenesis during spermiogenesis, we used STRING database to search for CCDC42-binding candidates (Fig. 1A). CCDC38, reported as a testis-specific protein (Lin et al., 2016), was chosen first. Epitope-tagged CCDC42 and CCDC38 expressed in HEK293T cells followed by immunoprecipitation experiments demonstrated that CCDC38 was detected in anti-MYC immunoprecipitates from CCDC42 co-transfectants, but not from cells co-transfected with the control plasmid (Fig. 1B). An overlapping immunostaining pattern was clearly found in Hela cells transiently expressing GFP-CCDC38 and MYC-CCDC42, and GFP-CCDC38 could also co-localized with γ-TUBULIN as reported (Firat-Karalar et al., 2014) (Fig. 1C). These results suggest that CCDC42 indeed could interact with CCDC38.
Next, we examined the localization of the endogenous CCDC38 during spermatogenesis. CCDC38 was detected as two adjacent spots near the nuclei of spermatocytes or round spermatids, while it localized to the skirt-like structure encircling the spermatid head from step 9 to step 14 and the testicular sperm tail (Fig. 1D). We therefore speculate that CCDC38 might participate in flagellum biogenesis during spermiogenesis.
Ccdc38 knockout leads to male infertility
Reverse transcription-polymerase chain reaction (RT-PCR) revealed that Ccdc38 was detected in the testis and firstly expressed at postnatal day 14 (P14), and peaked on P35 (Fig. 2A, B). To determine the physiological role of CCDC38, we generated Ccdc38-deficient mice by applying the CRISPR-Cas9 system to delete Exon 5 to Exon 11 of the Ccdc38 gene (Fig. 2C). The Ccdc38 knockout mice were genotyped by genomic DNA sequencing and further confirmed by PCR with 591 bp in Ccdc38+/+, and 750 bp in Ccdc38-/- mice (Fig. 2D). Subsequent Western blotting analysis validated complete ablation of CCDC38 protein extracted from Ccdc38-/- testes (Fig. 2E). We then examined the fertility of Ccdc38-/- mice. Male Ccdc38-/- mice exhibited normal mounting behaviors and produced coital plugs, but failed to produce any offspring after mating with WT adult female mice, in contrast, female Ccdc38-/- mice generated offspring after mating with WT adult males (Fig. 2F). Surprisingly, the knockout of Ccdc38 did not affect either testis size (Fig 2G) or the ratio of testis weight and body weight (Fig. 2H, I, J). Taken together, Ccdc38 knockout leads to male infertility.
Ccdc38 knockout results in MMAF
To further explore the cause of the male infertility, we examined the cauda epididymis of Ccdc38+/+ and Ccdc38-/- mice by Hematoxylin and Eosin (H&E) staining, and found there was fewer spermatozoa in the epididymal lumen of Ccdc38-/- mice compared with Ccdc38+/+ mice (Fig. 3A). We then released the spermatozoa from epididymis, and found that the sperm number of Ccdc38-/- mice was significantly less than that of Ccdc38+/+ mice (Fig. 3B), especially the motile spermatozoa decreased sharply (Fig. 3C). We further noticed Ccdc38-/- spermatozoa bearing morphological aberrations, including abnormal nuclei and MMAF-like phenotype of short tail, curly tail, tailless (Fig. 3D). The ratio of spermatozoa with abnormal heads and flagella was shown in Fig. 3E. Scanning electron microscopy (SEM) detailed the morphological abnormalities of Ccdc38-/- spermatozoa as follows (Fig. 3F): short tail (Type 1); disordered filaments (Type 2); impaired spermatozoa head (Type 4); curly tail (Type 5). Therefore, the knockout of Ccdc38 results in MMAF-like phenotype in mice.
Spermiogenesis is defected in Ccdc38-/- mice
To further investigate why Ccdc38 knockout leads to MMAF-like phenotype, we first used Periodic Acid Schiff (PAS) staining to determine at which stage the defect occurred. In Ccdc38+/+ mice testis section, round spermatid differentiated into elongating spermatids at stage IX, while there still were round spermatid and mature sperm at stage IX in Ccdc38-/- mice testis (Fig. 4A). In order to delineate the detail defects of Ccdc38-/- spermatids, we analyzed step 1-16 spermatids of both Ccdc38+/+ and Ccdc38-/- mice, and found that in steps 1-8, the morphology of acrosome and nucleus of Ccdc38-/- spermatids were similarly to that of the WT. In Ccdc38+/+ mice, spermatid head began elongation and mature from step 9, while in Ccdc38-/- mice, spermatid head were abnormally elongated in step 9, eventually formed abnormal sperm at step16 (Fig. 4B). These results mean CCDC38 plays essential role during spermiogenesis.
Flagellum is disorganized and Manchette is ectopically placed in Ccdc38-/- spermatids
To study the causes of abnormal sperm morphology after Ccdc38 depletion, H&E staining was used to detect the morphology of seminiferous tubules between Ccdc38+/+ and Ccdc38-/- mice. Compared with Ccdc38+/+ testis, obvious shortened tail and tailless sperm could be detected in Ccdc38-/- testis (Fig. 5A). Immunofluorescence staining for acetylated TUBULIN, the specific flagellum marker, further confirmed the flagellum biogenesis defects in Ccdc38-/- testis (Fig. 5B). We conducted immunofluorescence analysis of both PNA and α/β TUBULIN to determine which stages were affected by Ccdc38 knockout, and found that the flagella of Ccdc38-/- spermatids were shorter and curly from stage IV-V than that of Ccdc38+/+ spermatids (Fig. 5C). By using transmission electron microscopy (TEM), we observed that the Outer Dense Fibrous (ODF), Fibrous Sheath (FS) and mitochondria sheath were also abnormally organized in the Ccdc38 KO elongating spermatids (Fig. 5D).
When spermatids were elongated, the sperm head was abnormal, indicating that the manchette might be abnormally formed (Fig. 5C). Manchette is important for sperm head shaping (Wei and Yang, 2018). So, we scrutinized manchette structure, and found the manchette of Ccdc38-/- spermatids were roughly normal at steps 8-10, but from steps 11-12, they displayed abnormally longer than that of the control mice (Fig. 6A). We also used TEM to detect the manchette, Ccdc38 knockout spermatids became abnormally elongated from step 11 but not in the control spermatids (Fig. 6B). In support of these result, we found that CCDC38 co-localized with α-TUBULIN at manchette in the control mice (Fig. 6C). All these results suggest that CCDC38 should be involved in flagellum biogenesis.
CCDC38 interacts with IFT88
It has been reported that CCDC42, IFT88 and KIF3A are involved in the anterograde transportation during flagellum biogenesis (Wu et al., 2021). To test whether CCDC38 also participates in anterograde transportation by interacting with IFT complexes, such as IFT88 and IFT20, we co-transfected pCSII-MYC-IFT88 or pRK-FLAG-IFT20 with pEGFP-C1-CCDC38 to the HEK293T cells, then immunoprecipitated CCDC38 with anti-GFP antibody, and found that IFT88 could be immunoprecipitated by CCDC38 (Fig. 7A), but not IFT20 (Fig. 7B). We also detected their expression level in Ccdc38+/+ and Ccdc38-/- mice testis, and found IFT88 and IFT20 expression were all obviously decreased in Ccdc38-/- mice testis (Fig. 7C, D). Then we detected the distribution of IFT88 in spermatids at different steps, and found that IFT88 was presented in the manchette and elongating sperm tails in Ccdc38+/+ mice, while in the Ccdc38-/- spermatids, IFT88 still trapped close to the nucleus with a puncta-like structure (Fig. 7E). Therefore, CCDC38 might regulate sperm flagellum biogenesis by interacting with IFT B complexes.
ODF transportation is defected in Ccdc38 knockout spermatids
It has been reported that ODF1 and ODF2 could interact with CCDC42, and they are found to be involved in the formation of male germ cell cytoskeleton (Tapia Contreras and Hoyer-Fender, 2019). To study the relationship between CCDC38 and ODF2, reciprocal coimmunoprecipitation assays were carried out. we transfected pCDNA-HA-ODF2 plasmid and pEGFP-C1-CCDC38 plasmid in to HEK293T cells, CCDC38 and ODF2 were able to interact with the other in reciprocal immunoprecipitation experiments (Fig. 8A), suggesting CCDC38 might interact with ODF2.
As the main cytoskeleton protein in the ODFs, ODF2 is essential for sperm flagellum integrity and beating (Donkor et al., 2004, Ito et al., 2019, Fawcett, 1975). We examined the effect of Ccdc38 knockout on ODF1 and ODF2 protein levels, and found that ODF2, but not ODF1, was significantly decreased in Ccdc38-/- testicular extracts (Fig. 8B, C). Then, we used immunofluorescence to detect the expression of ODF2 in spermatids and epididymal spermatozoa. We found that ODF2 localized on manchette along with the sperm tail in elongated spermatids of Ccdc38+/+ mice, whereas ODF2 was detected on manchette without tail staining in most of elongated spermatids (Fig. 8D). Of note, ODF2 co-localized with α-TUBULIN on the midpiece and principal piece of Ccdc38+/+ sperm tail, while ODF2 signal displayed discontinuous, punctiform short or curly on Ccdc38 knockout spermatozoa (Fig. 8E), suggesting that the defects of ODFs in Ccdc38 knockout spermatozoa might come from a defect of ODF2 transportation during spermiogenesis.
Discussion
Ccdc38 is a testis specific expression gene (Lin et al., 2016), but its role during spermiogenesis has not been investigated yet. In order to study its role during spermiogenesis, we generated Ccdc38-/- mouse model. Ccdc38-/- male mice was sterile (Fig. 2F) due to significantly reduced spermatozoa number and motility (Fig. 3B, C), albeit with no significant size difference between Ccdc38+/+ and Ccdc38-/- testes (Fig. 2G).
The manchette is a transient structure in developing germ cells, which is required for sperm nuclear condensation and flagellum biogenesis (Wei and Yang, 2018). It provides the structural basis for intra-manchette transport (IMT), IMT transfers structural and functional proteins to the basal body and is essential for nucleo-cytoplasmic transport (Kierszenbaum, 2002, Kierszenbaum et al., 2002). As an IMT component, CCDC42 localizes to the manchette, connecting piece and sperm tail during spermiogenesis, and it can interact with ODF1, ODF2 to regulate germ cell cytoskeleton formation (Tapia Contreras and Hoyer-Fender, 2019, Pasek et al., 2016). Here, we found that CCDC38 could interact with CCDC42, and co-localized with CCDC42 on centrosome in Hela cells (Fig. 1A, B, C). In addition, CCDC38 were found to localize on manchette and sperm tail (Fig. 1D), and it interacted with ODF2 (Fig. 8A). ODF2 is a component of outer dense fibers, and it is important for sperm flagellum assembly, the knockout of this gene leads to preimplantation lethal, and even the absence of a single copy of this gene results in sperm neck-midpiece separation (Qian et al., 2016, Tarnasky et al., 2010). Here, we found that once Ccdc38 was knocked out, the protein level of ODF2 was decreased in testis (Fig. 8B, C) and its distribution was disturbed in flagella (Fig. 8D, E). Thus, CCDC38 either works as a partner of ODF2 to keep its stability or participates in IMT to intermediate ODF2 transportation during flagellum biogenesis. Since CCDC38 also interacted with CCDC42, we prefer the second one, and this possibility is also supported by its interaction with IFT88.
In addition to IMT, the intra-flagellar transport (IFT) is also required for flagellum biogenesis. IFT is responsible for sperm-protein transportation during the development of the flagella. During IFT, cargoes are transported from the basal body to the tips of the flagellum and then back to the sperm head along the axoneme (Scholey, 2003, Taschner and Lorentzen, 2016, Ishikawa and Marshall, 2017). IFT88 is an IFT B components, it presents in the heads and tails only in step 15, and no longer being detected in mature sperm (San Agustin et al., 2015), it can interact with kinesin to regulate the anterograde transport along axoneme (Rosenbaum and Witman, 2002). Worked as an IFT88 interacting protein (Fig. 7A), CCDC38 may also participate in the anterograde transport along the flagellum. Thus, CCDC38 may interact with both CCDC42 and IFT88 to regulate cargoes transportation by IMT and IFT during flagellum biogenesis.
In summary, we identified a new CCDC42 interacting protein, CCDC38, which is essential for spermiogenesis and flagellum biogenesis, the knockout of this gene results in MMAF-like phenotype in mice. Since these genes are evolutionary conserved in human beings, we believe that some mutations of these genes should be existed in MMAF patients, albeit we do not find them right now.
Materials and methods
Animals
The mice Ccdc38 gene is 1692 bp and contains 16 exons. The knockout mice of Ccdc38 were generated by CRISPER-Cas9 system from Cyagen Biosciences. The genotyping primers for knockout were as follows: F1: GTAGCTGTTTCTAAGCGATCATCA, R1: ACTAGGTACCTCAAGCTGGTTTAGA, and for WT mice, the specific primers were: F1: GTAGCTGTTTCTAAGCGATCATCA, R2: GTCATGGGACAGATGTGGAACTA.
All the animal experiments were performed according to approved institutional animal care and use committee (IACUC) protocols (# 08-133) of the Institute of Zoology, Chinese Academy of Sciences.
Antibodies
Mouse anti-GFP antibody (1:1000, M20004L, Abmart), rabbit anti-MYC antibody (1:1000, BE2011, Abmart), ODF2 antibody (12058-1-AP, Proteintech) was used at a dilution at 1:1000 for western blotting and 1: 200 for immunofluorescence. Mouse anti-α-TUBULIN antibody (1:200, AC012, Abclonal) for immunofluorescence. Mouse anti-GAPDH antibody (1:10000, AC002, Abclonal) for western blotting. Mouse anti-ODF1 antibody (1:500, sc-390152, santa) for western blotting. Mouse anti-CCDC38 were generated from Dia-an Biotech (Wuhan, China). The Alexa Fluor 488 conjugate of lectin PNA (1:400, L21409, Thermo Fisher), the Mito-Tracker Deep Red 633 (1:1000, M22426, Thermo Fisher) were used for immunofluorescence. The secondary antibodies were goat anti rabbit FITC (1:200, ZF-0311, Zhong Shan Jin Qiao), goat anti TRITC (1:200, ZF-0316, Zhong Shan Jin Qiao), goat anti mouse FITC (1:200, ZF-0312, Zhong Shan Jin Qiao), goat anti rabbit TRITC (1:200, ZF0313, Zhong Shan Jin Qiao).
Immunoblotting
As previously reported (Liu et al., 2016), testis albuginea was peeled and added in RIPA buffer supplemented with 1mM phenyl methyl sulfonyl fluoride (PMSF) and PIC (Roche Diagnostics, 04693132001), the solution was sonicated transiently and then on the ice for 30 min. The samples were centrifuged at 12000 rpm for 15 min at 4°C. Then, the supernatant was collected at a new tube. The protein lysates were electrophoresed and electrotransfered, then incubated with primary antibody and second antibody, next the membrane was scanned via an Odyssey infrared imager (LI-COR Biosciences, Lincoln, NE, RRID:SCR_014579).
Immunoprecipitation
Transfected cells were lysed in a lysis buffer (50mM HEPES, PH 7.4, 250mM NaCl, 0.1% NP-40 containing PIC and PMSF) on ice for 30 min, and centrifugated at 12000 rpm at 4°C for 15 min, cell lysates were incubated with primary antibody overnight at 4 °C, next incubated with protein A for 2h at 4°C, then washed 3 times with lysed buffer and subjected to immunoblotting analysis.
Epididymal sperm count
The cauda epididymis was isolated from 8 weeks mice. Sperm was released from the cauda epididymis with HTF and incubated at 37°C for 15 min. Then the medium was diluted at 1:100 and counted the sperm number with hemocytometer.
Tissue collection and histological analysis
As previously reported (Wang et al., 2018), the testes were dissected after euthanasia, and fixed with Bouin’s fixative for 24h at 4 °C, then the testes were dehydrated with graded ethanol and embedded in paraffin. The 5um sections were cutted and covered on glass slides. Sections were stained with H&E and PAS for histological analysis after deparaffinization.
Transmission electron microscopy
The methods were as reported previously with some modifications (Liu et al., 2016). The testis from WT and Ccdc38 depletion mice testis and epididymis were dissected and fixed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer at 4 overnight. After washing in 0.1 M cacodylate buffer, samples were cutted into small pieces, then immersed in 1% OsO4 for 1h at 4°C. Samples were dehydrated through a graded acetone series and embedded in resin for staining. Ultrathin sections were cutted and stained with uranyl acetate and lead citrate, images were acquired and analyzed using a JEM-1400 transmission electron microscope.
Scanning electron microscopy
The sperm were released from epididymis in HTF at 37°C 15 min, centrifugated 5 min at 500 g, then washed twice with PB, and fixed in 2.5% glutaraldehyde solution overnight, and dehydrated in a graded ethanol, subjected to drying and coated with gold. The images were acquired and analyzed using SU8010 scanning electron microscope.
Immunofluorescence
The testis albuginea was peeled and incubated with collagenase IV and hyaluronidase in PBS for 15 min at 37°C, then washed twice with PBS. Next, fixed with 4% PFA 5 min, and then coated on slide glass to dry out. The slides were washed with PBS three times and then treated with 0.5% TritonX-100 for 5 min, and blocked with 5% BSA for 30 min. Added the primary antibodies and incubated at 4°C overnight, followed by incubating with second antibody and DAPI. The images were taken using a LSM880 and Sp8 microscopes.
Statistical Analysis
All data are presented as the mean ±SEM. The statisti cal significance of the differences between the mean values for the various genotypes was measured by Student’s t-tests with paired, 2-tailed distribution. The data were considered significant when the P-value was less than 0.05(*), 0.01(**) or 0.001(***).
Authors Contributions
RDZ and BBW performed most of the experiments and wrote the manuscript. CL, XGW, LYW, XS and YHC performed part of the experiment. WL supervised the whole project and revised the manuscript.
Compliance with ethical standards
All animal experiments were performed according to approved institutional animal care and use committee (IACUC) protocols (#08-133) of the Institute of Zoology, Chinese Academy of Sciences. All surgery was performed under sodium pentobarbital anesthesia, and every effort was made to minimize suffering.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgements
This work was funded by the National Natural Science Foundation of China (grants 91649202), the Strategic Priority Research Program of the Chinese Academy of Sciences (grant XDA16020701), and the National Key R&D Program of China (grant 2016YFA0500901).