ABSTRACT
Giardia lamblia, a parasitic protist of the metamonada supergroup, has evolved one of the most diverged endocytic compartment systems investigated so far. Peripheral endocytic compartments, currently known as peripheral vesicles or vacuoles (PVs), perform bulk uptake of fluid phase material which is then digested and sorted either to the cell cytosol or back to the extracellular space. Here, we present a quantitative morphological characterization of these organelles using volumetric electron microscopy and super-resolution microscopy (SRM). We defined a morphological classification for the heterogenous population of PVs and performed a comparative analysis of PVs and endosome-like organelles in representatives of phylogenetically-related taxa, Spironucleus spp. and Tritrichomonas foetus. To investigate the as-yet insufficiently understood connection between PVs and clathrin assemblies in G. lamblia, we further performed an in-depth search for two key elements of the endocytic machinery, clathrin heavy chain (CHC) and clathrin light chain (CLC) across different lineages in Metamonada. Our data point to the loss of a bona fide CLC in the last Fornicata common ancestor (LFCA) with the emergence of a protein analogous to CLC (GlACLC) in the Giardia genus. Taken together, this provides the first comprehensive nanometric view of Giardia’s endocytic system architecture and sheds light on the evolution of GLACLC analogues in the Fornicata supergroup and, specific to Giardia, as a possible adaptation to the formation and maintenance of stable clathrin assemblies at PVs.
INTRODUCTION
Endomembrane compartments, while present in a few prokaryotic lineages (Heimerl et al. 2017), have evolved and greatly diversified across eukaryotic lineages. A fundamental task performed by some membrane-bounded organelles is endocytosis – the controlled and directed uptake of nutrients and other materials from the extracellular space into the cell by membrane transport. Fluid phase or receptor-bound material at the cell surface is internalised via invaginations and formation of vesicles at the plasma membrane, mediated by clathrin-coated vesicles (CCVs) (Robinson 2015; Kaksonen and Roux 2018). In turn, CCVs fuse with early endosomes which mature into late endosomes upon lysosome fusion (Huotari and Helenius 2011; Naslavsky and Caplan 2018). Clathrin coats are also involved in protein secretion forming exocytic transport vesicles derived from the trans-Golgi compartment and play a role in Golgi apparatus reassembly after mitotic cell division (Radulescu et al. 2007; Jaiswal et al. 2009).
Evolutionary adaptations of endocytic pathways to specific environmental niches and nutrient sources are especially relevant to species adopting a fully parasitic or commensal lifestyle (Poulin and Randhawa 2015; Jackson et al. 2016; Dacks and Field 2018; Pipaliya et al. 2021). Within the extant Metamonada supergroup (Hampl et al. 2009; Hug et al. 2016; Burki et al. 2020), the parasitic protist Giardia lamblia (syn.: intestinalis or duodenalis) evolved a distinct endocytic pathway, which reflects its adaptation to the host intestinal lumen environment. This unicellular parasite is responsible for >300 million cases annually of water-borne infections causing gastroenteritis – giardiasis – with higher incidence in low to middle income countries (Caccìo and Ryan 2008) (Caccìo and Ryan 2008). Giardia is the etiological agent for symptomatic gastroenteritis in 15% of children in developing countries, with 1-2% fatality in children with severely compromised health status (Kotloff et al. 2013; Lanata et al. 2013). There is a strong association of Giardia infections with chronic conditions such as irritable bowel syndrome or inflammatory bowel disease as a result of intestinal barrier function disruption and microbiome dysregulation (Allain et al. 2017; Fekete et al. 2021).
Cellular evolution of the Giardia genus as an obligate parasite adapted to the small intestinal niche of vertebrates is characterised by a reduction in subcellular compartment diversity. Peroxisomes, late endosomes and a permanent stacked Golgi complex have not been detected in Giardia (Faso and Hehl 2011). Two nuclei (Benchimol 2005), an extensive endoplasmic reticulum (ER) (Soltys et al. 1996), highly reduced mitochondria-derived organelles – the mitosomes (Tovar et al. 2003) - and peripheral vesicles (PVs) (Lanfredi-Rangel et al. 1998) are the only membrane-bounded organelles with conserved morphology and function documented in the Giardia trophozoite (Marti, Regös, et al. 2003; Zumthor et al. 2016; Cernikova et al. 2020).
The complex array of PV organelles as the only documented endocytic membrane compartment system in Giardia is responsible for uptake of fluid-phase and membrane-bound material (Rivero et al. 2011; Zumthor et al. 2016; Frontera et al. 2018). These organelles acidify and presumably serve as digestive compartments with capability for sorting after processing, similar to early and late endosomes and lysosomes (Lanfredi-Rangel et al. 1998). The static system of PV organelles (Abodeely et al. 2009; Zumthor et al. 2016) is restricted to the peripheral cortex below the plasma membrane (PM) of the Giardia trophozoite. PV morphology was investigated using high-resolution electron microscopy serial sectioning and three-dimensional reconstruction (Zumthor et al. 2016). These organelles were resolved as tubular structures in close proximity to funnel-shaped invaginations of the PM (Zumthor et al. 2016). In the same report, the presence of focal accumulations of clathrin heavy chain (CHC) molecules and their main interactors, collectively termed clathrin assemblies, were demonstrated at PM and PV membrane interfaces.. The function of these stable focal assemblies as well as additional components at the interface of the PV membranes and the PM, has proved elusive (Zumthor et al. 2016). However, transient association of several members of the family of adaptor proteins (AP) suggests a role in dynamic processes linked to uptake of fluid-phase and receptor-bound material into PVs (Zumthor et al. 2016; Cernikova et al. 2020). Our current working model for bulk fluid-phase uptake of extracellular material into PVs invokes a “kiss and flush” mechanism, whereby acidified PV membranes and the PM transiently form channels at invaginations allowing exchange between PV lumen content and the extracellular space at regular intervals. Endocytosed material is digested in the sealed-off acidified PVs and transported towards the cell interior while residual material and waste is flushed to the extracellular space in the next round of membrane fusion, thus completing the PV cycle (Zumthor et al. 2016; Cernikova et al. 2020).
In this report, we address open questions concerning G. lamblia’s PV ultrastructure and its associated molecular machinery in a comparative approach with one closely and one more distantly related fornicata and metamonada species, Spironucleus sp. and Tritrichomonas foetus, respectively. Using volumetric electron microscopy and super resolution light microscopy we developed a classification of PVs based on organelle morphology. Comparative analysis of Giardia’s PVs with endocytic compartments of fornicata and metamonada species emphasized the genus-specific nature of the Giardia endocytic system architecture. In addition, using a combination of co-immunoprecipitation and phylogeny techniques, we provide evidence that a proposed diverged clathrin light chain previously named GlCLC (Zumthor et al. 2016) is unique to the Giardia genus and evolved de novo as structurally analogous to CLC after loss of a bona fide CLC in the last Fornicata common ancestor (LFCA). Taken together, the emergence of a unique and highly polymorphic endocytic system such as the one found in the genus Giardia is linked to the proposed convergent evolution of an independent CLC analogue concomitant with loss of a mostly conserved CLC orthologue.
RESULTS AND DISCUSSION
Complete FIB-SEM rendering of a G. lamblia trophozoite reveals a novel landscape of vesicular compartments
Volumetric scanning electron microscopy (vSEM) is currently considered the gold standard for the determination of biological ultrastructure (Titze and Genoud 2016). Focused ion beam electron scanning microscopy (FIB-SEM) uses a beam of gallium ions to mill and image consecutive layers of an embedded biological sample, resulting in a voxel resolution as low as 1-2 nm (Kizilyaprak et al. 2014). This technique allows for sectioning and imaging of entire cells (Wei et al. 2012). It was previously implemented for partial rendering of G. lamblia trophozoite sections (Zumthor et al. 2016) and more recently in (Tůmová et al. 2020). Here we sectioned for the first time a complete G. lamblia trophozoite at a voxel resolution of 125 nm3 (5×5×5 nm) after high pressure freezing (HPF) and embedding. Images representing the sagittal plane adjacent to the cell centre (figure 1A, 1D and supplementary figure 1A and B) show all the major cell compartments such as the nuclei (Figure 1A, N), the endoplasmic reticulum (Figure 1A, ER), mitosomes (Figure 1A and C, m) and elements of the cytoskeleton: axonemes (Ax), funis (F) and the ventral disc (VD) (Figure 1D; Dawson 2010). Two different types of small cytoplasmic organelles are observed: PVs (arrow heads) with heterogenous morphology and smaller and electron-dense membrane vesicles of uniform size and appearance which we termed Small Vesicles (SVs; asterisks) (figure 1B and E).
After serial sectioning and alignment with TrakEM (Cardona et al. 2012), we used the supervised machine learning (ML) tool Ilastik for pixel based image segmentation of PVs and SVs (Sommer et al. 2011; Berg et al. 2019). The algorithm collection performs supervised learning and recognition of patterns based on ground truth training provided by the user. Patterns are sorted into classes. Once the algorithm is trained on a subset of image data, it is used to analyse complete datasets and assigning features to different classes following a decision tree method (Sommer and Gerlich 2013; Kan 2017). This process enabled the three-dimensional rendering of selected trophozoite features: the complete cytoskeleton, the ER, PVs and mitosomes (supplementary figure 1C). In addition, we were able to calculate the volume of the cell at 138 µm3 as well as the average volume of mitosome organelles (N=14) at 0.001093±0.0005698µm3 with a 95% confidence interval between [0.0007643, 0.001422] µm3 (supplementary figure 1D).
Similarly, supervised ML assisted pixel segmentation and object clustering analysis allowed identification of two statistically distinct morphological classes of PVs: spherical and tubular/elongated PVs. Individual PV organelles of both classes (N=467) were rendered in three dimensions (figure 1F and supplementary video 1). Spherical PVs average a volume of 9.243×10−4±3.322×10−4 µm3 in a 95% confidence interval between [9.022×10−4; 9.022×10−4] µm3 while tubular PVs average a volume of 1.067×10-3±3,322×10−4 µm3 with a 95% confidence interval between [9.843×10−4; 1.150×10−3] µm3, a statistically significant difference (t-student test, (p< 0.0001), corroborating PV grouping in these two classes. To further investigate morphological heterogeneity of PVs, we analysed trophozoite ultrastructure using freeze fracture scanning electron microscopy. We documented PV heterogeneity and the presence of spherical and tubular PV forms (supplementary figure 2). Additional ultrastructural studies using transmission electron microscopy (TEM) were consistent with this classification (Supplementary figure 3A and B).
We proceeded with the rendering of 269 SVs – small spherical vesicles, with distinctly higher electron density than PVs and what could be a coat on the cytoplasmic side of the delimiting membrane (figure 1G). SVs were also identified by TEM (Supplementary figure 3), proximal to the PM. SVs average a volume of 2.525×10−4±9.280×10−5 µm3 in a 95% confidence interval between [2.414×10−4; 2.637×10−4] µm3 (figure 1G, box-plot on the left). This equals to an average diameter of 77.23±9.666 nm in a 95% confidence interval between [76.07; 78.40] nm, differing significantly from spherical PVs which average 120.1±9.507 nm in a 95% confidence interval between [119.2; 121] nm (p< 0.0001) (figure 1G, box-plot on the right). Thus, there is statistical support for SVs as a distinct category of membrane-bounded vesicles (Supplementary figure 3A and C).
Taken together, these findings lead us to hypothesize that, unlike previously thought, PVs are morphologically heterogenous and may comprise different functional categories (Poteryaev et al. 2010; Hipolito et al. 2018; Suresh et al. 2020). However, these data are currently insufficient to determine whether distinct morphologies correlate with distinct functions.
Combining super-resolution microscopy with ML-assisted image analysis identifies three classes of endocytic compartments in G. lamblia trophozoites
FIB-SEM as a technique is not well-suited to the investigation of large cell numbers, and TEM cannot readily provide 3D volumetric information on subcellular compartments. Hence, to address PV heterogeneity in more detail, we continued our investigation of Giardia endocytic compartments by Super-resolution Light Microscopy (SRM) techniques and ML assisted image analysis of compartment shapes.
The dimensions of Giardia endocytic compartments are well below the diffraction limit of conventional light microscopy (Combs and Shroff 2017). To overcome the Abbe diffraction barrier we used stimulated emission depletion microscopy (STED), potentially achieving a lateral (x,y) and axial (z) resolution of 25-50 nm and 60-100 nm, respectively. This technique decreases the point spread function signal from the illuminated region (Klar et al. 2000; Willig et al. 2006) and allows for accurate imaging of trophozoite PV lumina loaded with a highly photostable fluid phase marker (10 kDa Dextran-Alexa Fluor 594) which is readily taken up into PVs via the fluid phase endocytic pathway (Figure 2A and Supplemental Video 2). In addition to spherical and tubular PVs documented in FIB-SEM, using STED we also determined the presence of polymorphic dextran-labelled organelles i.e., spherical PVs with elongated rods (figure 2A). All labelled PVs were further analysed using the ML-assisted algorithm of the Ilastik program suite. We first performed supervised pixel segmentation followed by supervised object classification. In this second step, we defined and trained the classifier in three organelle morphologies: spherical, tubular, and polymorphic. The latter comprised characteristics of both vesicular and tubular classes, generally with spherical centres with attached tubular protrusions (Figure 2B). After organelle classification we measured their projected areas. Spherical organelles (N =1684) have an average projected area of 0.0205±0.0169 µm2 with a 95% confidence interval between [0.0197;0.0213] µm2. Tubular endocytic organelles (N=835) present an average projected area of 0.0453±0.0278 µm2 with a 95% confidence interval between [0.0435;0.0472] µm2. Polymorphic organelles (N=400) have an average projected area of 0.0981±0.0429 µm2 with a 95% confidence interval between [0.0939;0.102] µm2. ANOVA analysis reveals that each of the three categories is indeed significantly distinct (p<0.0001) based on projected surface area (Figure 2C). This lends further support to the possibility that PV morphological heterogeneity may have functional implications..
Although a STED microscopy-based approach clearly allows resolution of individual organelles as small as PVs, the distinctly lower axial resolution remains limiting for three-dimensional rendering of organelles. Therefore, to push the boundaries of resolution and to further characterize PV morphology, we employed Single Molecule Localization Microscopy (SMLM) (Kao et al. 1994; Huang et al. 2008; Jones et al. 2011).
Giardia PVs in trophozoites were loaded with a 10 kDa Dextran-Alexa Fluor 647 fluid phase marker with a high degree of photostability to survive repeated cycles of photoactivation and excitation in SMLM experiments (Dempsey et al. 2011; Olivier et al. 2013). After acquisition, images were reconstructed using the ImageJ plugin ThunderStorm which performs signal centroid calculation, image reconstruction and output (Schindelin et al. 2012; Ovesný et al. 2014). Dextran uptake in PVs was confirmed using conventional widefield microscopy (Figure 3A). STORM image reconstruction shows the subcellular distribution of the fluorescent marker and defines individual organelle lumina (Figure 3B). A closer inspection revealed the presence of morphologically distinct endocytic organelles as previously observed in our FIB-SEM and STED datasets (Figure 3B, ROI and Supplementary Video 3). We again used the supervised ML-assisted algorithm in Ilastik to classify the different morphologies. After a pixel segmentation routine, we performed object classification using supervised ground truth training on subsets of organelles images. Three categories of PVs were defined: spherical, tubular and polymorphic (Figure 3C). To test whether the morphological categorization was consistent with categorization based on organelle volume, we calculated the average lumina volumes of >4000 organelles from the three PV categories. ANOVA testing of organelle volumes for vesicular (0.00507±0.00336 µm3, N=1989, 95% confidence interval: [0.00492;0.00522] µm3), tubular (0.0103±0.00925 µm3 N=838, 95% confidence interval: [0.00967, 0.0109] µm3), and polymorphic organelles (0.0227±0.0214 µm3 N=1494, 95% confidence interval: [0.0216, 0.0238] µm3 confirmed statistically significant (p <0.0001) morphological differences (Figure 3D and summarised in supplementary table 1).
Taken together, the data generated using three distinct imaging techniques clearly demonstrates PV heterogeneity which may be linked to distinct functions and/or maturation states in this unique endocytic system. To reflect this novel finding and considering that these endocytic and peripherally localized organelles are neither proper vesicles nor canonical vacuoles, we propose renaming PVs to peripheral endocytic compartments (PECs).
Comparative analysis of endocytic and secretory organelles in Giardia, Spironucleus sp. and T. foetus
Giardia spp. have evolved a unique cell architecture including a dedicated organelle for attachment to the small intestinal epithelium – the ventral disk (VD) (Dawson 2010; Brown et al. 2016). In turn, this innovation defines a distinct dorso-ventral as well as antero-posterior polarization of the flagellated trophozoite, marked by swimming directionality. PVs/PECs localize exclusively to the dome-shaped dorsal parasite PM except a small circular patch at the centre of the VD called the bare zone (Zumthor et al. 2016; Cernikova et al. 2020). The result is a maximally decentralized architecture of the Giardia endocytic system forming a single-layer interface of what we now appreciate as 3 morphologically distinct organelle classes between the cell exterior and the cytoplasm/ER (Abodeely et al. 2009; Zumthor et al. 2016). We asked whether this type of decentralized sub-PM localisation and polymorphic morphology of endocytic compartments was also represented in other tractable related members of the Diplomonadida and phylogenetically more distant metamonada lineages which do not have a VD, respectively Spironucleus vortens and Spironucleus salmonicida and the parabasalid Tritrichomonas foetus
The diplomonads Spironucleus vortens and Spironucleus salmonicida are amongst the closest tractable relatives of G. lamblia that can be grown axenically under similar conditions (Paull and Matthews 2001; Jørgensen and Sterud 2007; Kolisko et al. 2008a; Xu et al. 2014; Xu et al. 2016). Their endocytic compartments and machineries are partially characterized, with some reports of large vacuolar structures detected by electron microscopy in trophozoites (Sterud and Poynton 2002; Ástvaldsson et al. 2019). Unlike Giardia, both species lack dorso-ventral polarization but display a distinct antero-posterior axis. Putative endocytic organelles in S. vortens have been detected by fluorescence microscopy of live and fixed cells after incubation with fluorophore-coupled dextran (Zumthor et al. 2016). To further investigate these endocytic compartments, we incubated S. vortens and S. salmonicida trophozoites with a 10 kDa Dextran-TexasRed fluid phase marker (Figure 4). In stark contrast to the distinctly arrayed PV/PEC labelling seen in Giardia lamblia (Figure 4A), confocal microscopy revealed the presence of several dispersed labelled organelles in both S. vortens (Figure 4B) and S. salmonicida (Figure 4C). Spironucleus spp. display several relatively large globular membrane compartments, similar to those observed in well-characterized model organisms (Huotari and Helenius 2011; Day et al. 2018) lacking a fixed subcellular localization. While S. salmonicida endocytic compartments localise mostly at the cell periphery (Figure 4C), S. vortens organelles present both peripheral and central localizations (Figure 4B and Supplementary Video 4). We also assessed endosome morphology in T. foetus using the same labelled dextran-based approach. Similar to Spironucleus species, T. foetus presents an antero-posterior axis but no attachment organelle nor dorso-ventral polarization. Similar to Spironucleus spp., T. foetus accumulated the endocytosed fluid phase maker in several globular endocytic compartments (Figure 4D) consistent with previous reports on vacuolar structures identified in T. foetus by electron microscopy (Lealda et al. 1986). In our ultrastructure observations we could not detect multivesicular bodies or vacuoles containing intra-luminal vesicles in either Spironucleus spp. or T. foetus.
Taken together, these data show how, in closely-related protozoa lacking dorso-ventral polarization and a dedicated attachment organelle, endocytic organelles appear to have no specific localization. This lends support to the notion that PV organelle architecture is intimately associated to the emergence of the VD, both as adaptations to the mammalian small intestine niche (Zumthor et al., 2016).
To visualize and measure morphological parameters of Spironucleus and T. foetus endocytic compartments, we performed 2D-STED imaging and transmission electron microscopy (TEM). S. vortens cells loaded with 10 kDa Dextran-Alexa Fluor 594 showed accumulation of the fluid phase marker in roughly spherical organelles (Figure 5A). Labelled endocytic vacuoles have an average diameter of 468±206 nm (95% confidence interval [421;515] nm, N=10) (Figure 5A, box-plot). Volumetric rendering of 3D reconstructed optical sections document the uniformly globular morphology of these organelles (Supplementary Video 5). TEM analysis revealed an ellipsoid shape of endocytic organelles in S. vortens with an average maximal diameter of 844±335 nm in a 95% confidence interval between [763;905] nm (Figure 5B, box-plot). The dimensions measured in TEM represent those of the membrane-delimited organelle. In contrast, the dimensions measured by STED represent a projection of the fluid phase marker distribution within the available organelle lumen. The fact that the former (844±335 nm) is larger than the latter (468±206 nm) indicates that these organelles contain additional cargo which prevents the endocytosed fluid phase marker to distribute in the complete compartment volume delimited by the organelle membranes. TEM investigation in S. salmonicida cells (Supplemental figure 4A) showed the presence of small globular vacuoles (V) close to the PM (Supplemental figure 4B) with an average diameter of 205±62.6 nm (N=114) in a 95% confidence interval of [193;217] nm (Supplemental figure 4E). These vacuoles are smaller than the ones found in S. vortens (Supplementary figure 4C,D,F, p-value < 0.0001). In these conditions, neither coated vesicles nor a stacked Golgi apparatus could be documented in
S. vortens or S. salmonicida
2D-STED analysis of T. foetus cells incubated with 10 kDa Dextran-Alexa Fluor 594 revealed a roughly circular distribution of the marker within endocytic vacuoles (Figure 6A and Supplemental Video 6) with an average maximal diameter of 517±251 nm (95% confidence interval [455;580] nm, N=10) (Figure 6A, box-plot). TEM imaging revealed the presence of two distinct classes of endosome-like vesicles (Figure 6B) based on electron density of the lumen. Low-density vesicles were identified both at the cell periphery and in central areas termed vacuoles (V); vesicles of higher electron density were previously identified as digestive vacuoles (DVs) (Lealda et al. 1986) and contain structured material and membranes. Analysis of TEM micrographs showed that DVs are significantly larger than vacuoles, with an average diameter of 764±203 nm (N=50) (95% confidence interval [707;822] nm). Vacuoles in turn have an average diameter of 246±100 nm (N=153) in (95% confidence interval [230;262] nm) (Figure 6B, box-plot). Stacked Golgi organelles are abundant in TEM micrographs of T. foetus trophozoites, as documented previously (Rosa et al. 2014) (Supplemental figure 5A). Consistent with a more canonical architecture of the membrane trafficking system in T. foetus, coated vesicles were observed in the cytosol particularly in the vicinity of Golgi stacks (Supplemental figure 5B) (Lealda et al. 1986; Midlej et al. 2011; Schlacht et al. 2014). These vesicles averaged a diameter of 58.4±13.1 nm (N=128) (95% confidence interval [56.1;60.7] nm) corresponding to the size range of clathrin coated vesicles (CCVs) (Traub 2011).
Finally, to probe the dynamics of endocytic compartments in G. lamblia, S. vortens, S. salmonicida and T. foetus, cells were exposed to 10 kDa Dextran-TexasRed for 5, 10, 20 or 30 minutes, fixed chemically, and imaged by confocal microscopy (Figure 7). The number of G. lamblia PECs labelled with the fluid-phase marker increased over time, with the label accumulating strictly at the cell periphery (Figure 7A). In contrast, endocytic compartments in S. vortens were first visualized at the PM, and were then observed at more central locations of the cell at later time points. Given the overall increase in fluorescent intensity and the motile nature of these organelles, it appears there is a constant uptake of dextran over the analysed period (Figure 7B). In these conditions, S. salmonicida and T. foetus vacuoles behave similarly since both sets of organelles are diffused within the cell cytoplasm, with a steady decrease and then marked increase in dextran content (Figure 7C and D).
GlCHC foci associate with different classes of giardial PECs with different stoichiometry
Previously, we established that Giardia clathrin heavy chain (GlCHC) associates to discrete static foci at the dorsal PM of trophozoites, in close proximity to PV/PECs. Further, GlCHC strongly interacts with a putative albeit highly diverged Giardia clathrin light chain homologue previously named GlCLC (Zumthor et al. 2016; Cernikova et al. 2020). We wondered whether association to clathrin assemblies holds any relation to the heterogeneity of PV morphology. To address this question, we used STED microscopy to investigate epitope-tagged GlCHC (GlCHC-HA) deposition at distinct foci at the dorsal PM and the cell periphery, consistent with PV/PECs location (Figure 8A). Segmentation of foci using a ML-assisted Ilastik tool, allowed to determine the dimensions of GlCHC at an average diameter of 134±36.6 nm (N = 4524) (95% confidence interval [132;135] nm) (Figure 8B). Similar to GlCHC, subcellular distribution of epitope-tagged GlCLC (GlCLC-HA) showed an identical pattern consistent with its demonstrated direct interaction with GlCHC (figure 8C) (Zumthor et al. 2016). Segmentation of foci using a ML-assisted Ilastik tool, determined the dimensions of GlCLC foci at an average diameter of 159±48.8 nm (N = 984) (95% confidence interval [156;162] nm) (Figure 8D), Notably, the average size of GlCLC foci is larger than that of GlCHC foci (p< 0.0001, t-student test) (Figure 8E).
Using STED microscopy, we further determined the number of GlCHC foci showing signal overlap with the 3 classes of Dextran-Texas Red loaded PV/PECs (figure 8F). By calculating the degree of signal overlap between GlCHC foci and PEC lumina, we determined that spherical PECs are associated with at most one GlCHC focus with an average of 0.488±0.159 foci per spherical PEC (95% confidence interval [0.403;0.573]). Tubular PECs associated with at least one GlCHC focus with an average of 1.15±0.287 foci per tubular PEC (95% confidence interval [0.994;1.3]). Polymorphic PECs associated with 3 or more GlCHC foci with an average of 3.85±1.14 foci per PEC (95% confidence interval [3.25;4.46]). Taken together, we find a directly proportional and statistically-significant ratio of clathrin foci to PEC size and type (ANOVA; p-value < 0.0001). This is in line with the notion that PV morphological heterogeneity is indeed correlated with organelle functional diversity, as measured by association to clathrin assemblies.
Pan-eukaryotic searches for CHC and CLC reveal loss of a bona fide CLC within the fornicata lineage and the emergence of putative CLC analogues
We previously proposed that PV/PEC localization at the dorsal PM of trophozoites and evolution of the adhesive disc attachment organelle are interdependent adaptations to life in direct contact with the host’s gut epithelium (Zumthor et al. 2016). Furthermore, we found a direct correlation between types of PV/PEC and the number of foci of clathrin assemblies. Given that the role for clathrin assemblies in Giardia has not been elucidated and that the nature of GlCLC (Gl4259) as a clathrin light chain orthologue is dubious, we sought to shed light on the significance of this correlation by investigating the distribution of both CHC and CLC orthologues in selected eukaryotic lineages. To do this, we employed protein homology searches based on Hidden-Markov Models (HMM) (Eddy 2011) using as query an alignment of canonical and documented CHC or CLC sequences from several protozoa and metazoan species (Supplementary Tables 2 and 5) (Morgan et al. 2001; Kaksonen et al. 2005; Adung’a et al. 2013; Kirchhausen et al. 2014; Karnkowska et al. 2016; Karnkowska et al. 2019, Füssy et al., 2021). In our search we considered assembled read data from RNA-seq experiments (transcriptomics) as reliable as genomic sequence data (Cheon et al. 2020). In this case, we used the reference CHC or CLC sequences and performed tblastn searches. Nucleotide sequences from each reliable hit (lowest e-value) were translated and subjected to a reciprocal blast-p analysis to validate protein identity. We found CHC homologues in all selected genomes and transcriptomes we searched, highlighting the likely essential nature of CHC (Figure 9A and supplementary table 4 and 5).
GlCHC is a clearly divergent ortholog compared to its counterpart in eukaryotic model organisms, with only 24% amino acid identity to human CHC (Marti, Regös, et al. 2003). A domain analysis of selected CHC sequences (supplementary figure 6 and supplemental table 10) reveals that GlCHC contains fewer α-helical domains than other analysed CHC sequences, further highlighting its divergence. We also performed an in-depth search for the CHC triskelion uncoating “QLMLT” motif which we documented previously to be missing in Giardia (Fotin et al. 2004; Rapoport et al. 2008; Zumthor et al. 2016). Notably, this motif appears to be only present in Metazoa and in the closely related Filastera and Choanoflagellata (King et al. 2008; Fairclough et al. 2013; Suga et al. 2013). In Fungi only a partial “L(M)TL”motif was identified and we were unable to detect a conserved uncoating motif in CHC sequences of members of the Archaeplastida, Amoebozoa or SAR supergroups (supplementary figure 7).
In stark contrast to CHC, the search for bona fide CLC sequences did not retrieve any reliable predictions in available genomes and transcriptomes from species of the Fornicata lineage, including the lineages Hexamitidae, Retortamonas and Carpediemonas-like organisms (Xu et al. 2014; Leger et al. 2017; Tanifuji et al. 2018; Füssy et al. 2021; Salas-Leiva et al. 2021). Importantly, this search did not return the putative, highly diverged GlCLC (Zumthor et al. 2016). There are documented CLC orthologues in members of the Discoba, such as Trypanosoma brucei CLC (Tb927.10.14760) (Manna et al. 2017) and in the parabasalid Trichomonas vaginalis (TVAG_29749) (Carlton et al. 2007; Aurrecoechea et al. 2009). Furthermore, we readily identified a CLC homologue in T. foetus (gene accession OHT14195.1, forward HMMer e-value of 1.00E-26 and reverse Blastp e-value of 2.00E-11, returning the human CLC homologue) (Figure 9A). Therefore, while bona fide CLC orthologues can be readily identified in Discoba and Euglenozoa members and Preaxostyla – as in the metamonad Monocercomonoides exilis (Karnkowska et al. 2016) – no sequence could be found among members of the Fornicata lineage. Further, we were unable to identify a bona fide CLC sequence within the newly documented transcriptome of Hemimastigophora (Lax et al. 2018). These observations are in line with the notion that, unlike CHC, CLC is dispensable. This is also supported by failures to identify bona fide CLC in chromerids such as Cryptosporidium parvum and Babesia bovis (Woo et al. 2015) and in some ciliate lineages, such as Tetrahymena thermophila and Paramecium caudatum (Richardson and Dacks 2022).
Given that GlCLC’s predicted 3D structure is reminiscent of CLCs (Zumthor et al., 2016) but it could not be retrieved as related to a bona fide CLC, with its only known orthologue found in Giardia muris (Figure 9A), GlCLC was further analysed using the HHPred suit, in the attempt to find distantly-related non-Giardia sequences (Zimmermann et al. 2017). This search retrieved no robust prediction for a non-Giardia sequence (supplemental table 9). Given that the degree of divergence is such that no reliable claim to orthology can currently be supported and no orthologue for GlCLC can be found outside the Giardia genus, we propose the renaming of GlCLC to Giardia lamblia Analogous to Clathrin Light Chain-GlACLC-as a CLC structural analogue acquired and retained in the last Giardia common ancestor (LGCA). This appears to correlate with loss of a bona fide CLC with the last Fornicata common ancestor (LFCA).
To test the extent of environmental pressure on this protein family’s evolution, we calculated synonymous vs non-synonymous mutation ratios (ω = ks/kn) for GlACLC homologues (supplemental figure 8). Interestingly, known sequences for all Giardia isolates present a ω < 1 which indicates that current sequences are not under selective pressure to evolve.
To further investigate the structural analogy of GlACLC to canonical CLCs, we performed in silico modelling of its C-terminal domain () using the new standard in ab initio protein structure modelling – AlphaFold - based on deep-learning neural networks (Jumper et al. 2021; Tunyasuvunakool et al. 2021) (Figure 9B and supplemental table 11). Template modelling score independent of sequence (Tm-align) and Root Mean Square Deviation (RMSD) (Zhang and Skolnick 2005; Kufareva and Abagyan 2012) values provide substantial evidence for structural analogy of GlACLC and canonical CLCs, in line with previous observations (Zumthor et al. 2016). The newly predicted structures for GlACLC have a stronger resemblance to the predicted structure of a mammalian clathrin light chain (Wilbur et al. 2010). Altogether, the presented in silico data strongly suggest GlACLC to be structural analogue of CLC.
SsCHC is distributed in the cytosol and interacts with a putative light chain structural analogue
We hypothesize that GlACLC is a Giardia-specific CLC analogue, which arose de novo in the LGCA, possibly to supplant the loss of a bona fide CLC, We wondered whether de novo acquisition of a CLC analogue with divergent sequence but preservation of structural and potentially also functional features had occurred independently in other Diplomonadida lineages. To address this question, we selected Spironucleus salmonicidathe closest genetically tractable and sequenced relative to Giardia (Jerlström-Hultqvist et al. 2012; Xu et al. 2014) in which a bona fide CLC cannot be detected, We expressed an epitope-tagged variant of the S. salmonicida CHC orthologue (SsCHC-3xHA) and detect it distributed in a punctate pattern throughout the trophozoite cytosol. Using higher resolution confocal microscopy, SsCHC-3xHA was shown in cytoplasmic structures reminiscent of giardial CHC focal assemblies (Supplemental figure 9A and B and Supplemental Video 7).
To probe for the presence of a CLC analogue in Spironucleus, we performed native co-immunoprecipitation experiments (native co-IP) using the SsCHC-3xHA-expressing S. salmonicida transgenic line. In silico analysis of the mass spectrometry dataset focused on the most abundant proteins pulled down with a minimum of 10 peptide hits using stringent criteria. This yielded 171 proteins which were either exclusive to the native co-IP sample derived from the transgenic reporter line, or ≥3-fold enriched in the transgenic line compared to the non-transgenic parental strain (Supplemental Table 12). We identified several endocytosis-related proteins, with Ss-dynamin being the most abundant (48 hits and exclusive to SsCHC co-IP reaction), together with Ss-β-adaptin, Ss-calmodulin and SsSec7 (Supplemental figure 9C and D). Despite its intranuclear localization, annexin 5 is also found to be a putative interactor of SsCHC (Einarsson et al. 2019).
Since we postulated that a possible CLC analogue would be among the hypothetical proteins, we probed those hits using the HHPred algorithm (Zimmermann et al. 2017), focusing on candidates with predicted secondary structures composed of alpha-helical and coiled-coil domains and a size < 40 kDa, consistent with all CLC documented thus far. One of these, protein Ss50377_11905, was found to be prominently pulled down and contains several coil-coil domains, at a predicted weight of 39kDa. The 150 amino acid C-terminus of the protein was modelled in AlphaFold and superimposed with CLC structures (supplementary figure 9E). TM-align values within structure similarity (0.5 or above), and RMSD values of circa 5-6 Å make a compelling case for Ss50377_11905 to be a S. salmonicida CLC analogue, similar to GlCLC. Using Ss11905, we also performed homology searches in the available transcriptome of the related diplomonad Trepomonas sp. (Kolisko et al. 2008b; Xu et al. 2016). We found a candidate ortholog, TPC1_16039 (forward tblastn e-value of 1E-5 and reverse blastp e-value of 4E-12) (supplementary table 11). Notably, however, searches using Ss50377_11905 into the remaining fornicata representatives failed to retrieve candidate homologues, whether GlACLC or other (data not shown). Protein structure modelling with AlphaFold and super-imposition with Ss11905, GlACLC, T. brucei CLC and H. sapiens CLC suggest that TPC1_16039 is also a structural CLC analogue, orthologous to Ss11905 (supplementary figure 10).
DISCUSSION
Giardia lamblia’s endocytic organelle system consists of three classes of small acidifying membrane compartments
Subsequent to ingestion and excystation, Giardia trophozoites attach to the intestinal lumen, proliferating and encysting on localised foci throughout the mucosa of the small intestine (Barash et al. 2017). Nutrients required for this propagation are taken up from the environment through PV/PEC-mediated endocytosis of fluid phase and membrane bound material (Lanfredi-Rangel et al. 1998; Adam 2001; Abodeely et al. 2009; Carranza and Lujan 2009; Cotton et al. 2011; Zumthor et al. 2016; Touz et al. 2018). Despite the essential nature of these endocytic organelles, complete resolution of the ultrastructure of the Giardia endocytic pathway remains unsolved. To address this we performed an ultrastructural investigation of G. lamblia endocytic compartments to obtain a nanometric view of their morphology as defined by their membrane as well as the lumen accessible to fluid phase markers in labelling experiments (Abodeely et al. 2009; Zumthor et al. 2016).
We began by dissecting an entire G. lamblia trophozoite using scanning electron microscopy and focused our analysis on PVs. These structures were segmented and rendered in three dimensions. Using this method unambiguously detected at least two distinct classes of PV morphologies, with some being obviously globular in shape while others presenting a more tubular nature. After expanding our analysis of PVs/PECs to super resolution light microscopy methods STED and STORM (Jacquemet et al. 2020) we determined that PVs/PECs are present in three discernible morphologies: spherical, tubular and polymorphic. Thus, we proposed the renaming of these organelles into peripheral endocytic compartments (PECs).
Furthermore, in line with previous reports (McCaffery et al. 1994; McCaffery and Gillin 1994; Benchimol 2002; Zumthor et al. 2016), we also detected smaller vesicles (SVs) of around 80 nm in radius which appear to be coated, based on their electron-dense surface, and are not related to CHC foci at the PV-PM interface. Identifying the nature of SV coats may shed light on their corresponding cargo. For instance, COPI components such as the small GTPase ARF1 and β’-COPI were found to be located not only at the parasite’s ER but also at the cell periphery (Marti, Regös, et al. 2003; Stefanic et al. 2006; Stefanic et al. 2009), in line with SV distribution. If indeed COPI were found to act as coat for these currently uncharacterized membrane carriers, an intriguing possibility emerges for SVs as vehicles for the trafficking of variant surface proteins (VSPs) to the Giardia cell surface. VSP secretion is compromised by the presence of brefeldin-A, implicating ARF-GTPase cycles in VSP trafficking (McCaffery et al. 1994; Lujan et al. 1995; Marti, Li, et al. 2003; Marti, Regös, et al. 2003). Currently, the exact mechanism for VSP translocation from the ER to the plasma membrane remains unknown, although it has been postulated that PVs/PECs may be involved. Furthermore, previous reports exclude the presence of an intermediate VSP trafficking compartment between the ER and the PM detectable by microscopy (Marti, Li, et al. 2003; Marti, Regös, et al. 2003). Given the estimated diameter of SVs at ca. 80 nm, these compartments would have easily escaped detection in standard light microscopy experiments. An alternative hypothesis concerning SVs is that they are peroxisome derivatives. Recently, peroxisomes have been found in Entamoeba histolytica, a microaerophile like Giardia, with diameters between 90-100 nm, in the range of Giardia SVs (Verner et al. 2021). Furthermore, reports on immuno-EM detection of peroxisome-like proteins in Giardia highlighted the presence of small dense vesicles with diameters of circa. 100 nm (Acosta-Virgen et al. 2018). Taken together, while we favour the hypothesis of SVs being secretory trafficking vesicles considering their apparent coating, the possibility of SVs corresponding to cryptic peroxisome-like organelles cannot be excluded.
Compared to endosome-like vacuoles in Carpediemonas-Like Organisms (CLOs) (Yubuki et al. 2013; Yubuki et al. 2016; Hamann et al. 2017) and large vesicular endosome-like structures observed in S. salmonicida and S. vortens and the more distantly related Parabasalia member, T. foetus, specific and complete remodelling of endosomes has occurred in the Giardia genus. T. foetus, except for the presence of endosome-like vesicles, presents digestive vacuoles and a stacked Golgi apparatus. Coated vesicles, likely CCVs, are observed near the
T. foetus Golgi apparatus and the PM. In our analysis, we could not confirm fluid phase material uptake through the cytostome present in Spironucleus sp (Sterud and Poynton 2002). As noted, dextran accumulated in spherical vesicles of different dimensions and unknown origin, similar to endosomes. Figures 10A and B summarize the results of our comparative analysis and highlight the unique endocytic system in Giardia where, unlike related species and other excavates, PEC-mediated uptake is restricted to the dorsal side of the cell (Ebneter and Hehl 2014; Zumthor et al. 2016) while the ventral side is deputed to attachment to host structures. Interestingly, endosome and lysosome tubulation has been documented in macrophages (Hipolito et al. 2018; Suresh et al. 2020) and are linked with different physiological states of the organelles and subsequent function in the cell – like prompting the cell for phagocytosis. This does permit the hypothesis for the different kinds of PECs present in G. lamblia also representing different stages in organelle maturation and or active role at a given time. In line with this, we provide evidence for different stochiometric association of CHC foci with different kinds of PECs. Naturally, only further biochemical dissection of Giardia endocytic pathway will help clarify the matter.
G. lamblia possesses a highly divergent clathrin heavy chain and a newly acquired clathrin light chain analogue
We performed an in-depth search for CHC homologs within excavates and other key eukaryotic groups. We found that CHC is conserved in all of these organisms, underlining the vital role of CHC in eukaryotic organisms. The sequence divergence of the giardial CHC protein is reflected in an overall decrease in the number of α-helical domains which are essential for the formation of the triskelion leg, and hence necessary for coat assembly (Kirchhausen et al. 2014). Thus, the reduction in α-helical domains during GlCHC evolution, may have led to a lower propensity of GlCHC forming triskelion assemblies and membrane coats. So far, none of the many attempted methods to detect GlCHC in association with small vesicles have been able to show anything other than an exclusive focal localization at PVs/PEC membrane interfaces (Zumthor et al. 2016)). Also, the GlCHC protein does not contain the C-terminal uncoating motif “QLMLT” nor is this motif present in the CHC homologs of any diplomonad. In fact, this motif appears to be only present in Metazoa and in the closely related Filastera and Choanoflagellata (King et al. 2008; Fairclough et al. 2013; Suga et al. 2013) despite the documented ability to form and uncoat bona fide CCVs in some protozoa (Link et al. 2021). In Fungi only a partial “L(M)TL”motif was identified. We could not detect a conserved uncoating motif in CHC sequences of members of the Archaeplastida, Amoebozoa or SAR supergroups (supplementary figure 7). Taken together, this data indicates the uncoating QLMLT motif is apparently specific to and likely and invention of the Holozoa lineage. This observation points to as yet uncharacterised uncoating mechanisms are present in other lineages. For example, clathrin mediated endocytosis is essential in the parasitic protist Trypanosoma brucei and CCVs have been documented in this organism (Morgan et al. 2001; Allen et al. 2003; Adung’a et al. 2013; Link et al. 2021). Clathrin and other coat proteins associated with CCVs need to be recycled. While HSC70 is documented in T. brucei and likely involved in clathrin uncoating (Rapoport et al. 2008), no bona fide uncoating motif has been documented (Adung’a et al. 2013; Manna et al. 2017; Link et al. 2021).
In contrast to GlCHC, evolution of the previously identified putative GlCLC/Gl4259 protein, presents a different and surprising natural history. This protein was identified as the strongest interactor of GlCHC (Zumthor et al. 2016) and is present in all sequenced Giardia lineages. GlCLC/Gl4259 has no measurable sequence conservation but a high degree of structural similarity to bona fide CLCs, warranting its proposed renaming to GlACLC. Aside from the Giardia genus, we were unable to identify homologues for GlACLC in any other eukaryotic taxa, nor could we find any orthologues of CLC in any available Fornicata genome/transcriptome sequence, suggesting that the last Fornicata common ancestor (LFCA) lacked a canonical CLC. Taken together, the available data is currently insufficient to decide between two mutually exclusive evolutionary scenarios: 1) secondary loss of a canonical CLC in the last fornicate common ancestor, with acquisition of a structurally and functionally related GlACLC, or 2) massive sequence divergence of the original CLC due to significant changes in function particularly in Giardia where originally dynamic membrane coating machinery has evolved to become a static structural element supporting interfaces between plasma membrane and the endocytic system. The discovery of a strong interactor of CHC in the closely related S. salmonicida Ss11905, with structural similarity to GlACLC as well as to bona fide CLCs is consistent with both scenarios. Notably, this protein neither retrieves GlACLC nor CLCs in BLAST searches, leaving no evidence of direct homology. By contrast, robust predictions for CLC homologues were made for members of the Preaxostyla, Discoba and Parabasalia lineages. Nonetheless, other lineages appear also to have lost a bona fide CLC, like C. parvum and T. thermophila (Woo et al. 2015; Richardson and Dacks 2022), but perhaps similar investigations to ours of CHC may identify CLC analogues/divergent homologues. Taken together, this data suggests that the constraints on the CHC primary structure are higher than on CLC even after massive changes in clathrin coat function with demonstrated complete losses in some protists. Members of the Giardia genus as well as S. salmonicida have no identifiable bona fide CLC, yet, at least the giardial GlACLC has retained its function as a CHC interacting partner.
Our data provide a robust understanding of Giardia, Hexamitidae members, and Tritrichomonas foetus endocytic pathway organellar ultrastructure. Contrary to Spironucleus or Tritrichomonas and other excavates, Giardia underwent a complete remodelling of its endocytic machinery. Our analysis revealed its organelles to be polymorphic in nature, justifying the proposed name change to peripheral endocytic compartments. Our analysis of GCHC sequences highlights its divergence which is likely due to a massive reorganization of the endocytic pathway in these species, whilst origin and evolution of CLC structural and to some extent functional homologs in Giardia (GlACLC) and in certain Hexamitidae members (S. salmonicida and Trepomonas sp. PC1) remains uncertain.
MATERIALS AND METHODS
Cell culture and transfection
Giardia intestinalis strain WB (clone C6; ATCC catalog number 50803) trophozoites were grown using standard methods as described in Morf et. al. (Morf et al. 2010) Episomally-transfected parasites were obtained via electroporation of the circular pPacV-Integ-based plasmid prepared in E. coli as described in Zumthor et al. (Zumthor et al. 2016) Transfectants were selected using Puromycin (final conc. 50LμgLml−1; InvivoGen). Spironucleus vortens and Spironucleus salmonicida were cultured as described before (Paull and Matthews 2001; Xu et al. 2014). S. salmonicida was transfected using a modified PAC vector and selected with Puromycin (final conc. 50LμgLml−1; InvivoGen) (Jerlström-Hultqvist et al. 2012). Tritrichomonas foetus was axenically grown also as described (Lealda et al. 1986).
Construction of expression vectors
Spironucleus salmonicida CHC sequence (SS50377_14164) was amplified with the primers ATATTTAATTAAGGCGGATCTATAGTTTCTTGGAATACTAAAATAGGA (forward) and TATGCGGCCGCCACCAGTTATCAGCGGGTGCC (reverse) containing a MluI and a NotI rectrictyion site respectively. The genomic sequence amplified contained a 5’ UTR region of 179bp which encodes a putative promoter. The genomic fragment was inserted in the previously described vector pSpiro-PAC-3xHA-C (Jerlström-Hultqvist et al. 2012).
Focused Ion Bean Scanning Electron Microscopy (FIB-SEM) of a full Giardia trophozoite and image analysis
Wild type Giardia lamblia trophozoites were subject to High Pressure Freezing, and processed as established in (Zumthor et al. 2016). Ion milling and Imaging was performed in a Auriga 40 Crossbeam system (Zeiss, Oberkochen, Germany) using the FIBICS Nanopatterning engine (Fibics Inc., Ottawa, Canada) following the aforementioned established protocol. Pixel size was set to 5 nm, obtaining isotropic imaging. Alignment of the dataset was performed resorting to the ImageJ plugin Sift (Schindelin et al. 2012). Image segmentation was done using the semi-autonomous algorithm ilastik (Sommer et al. 2011). The routine of pixel and object classification and used. Algorithm training was performed in a small representative region of the dataset which was then applied to the complete dataset. Imaris (Bitplane AG) was used for three-dimensional rendering and volume measuring.
Transmission Electron Microscopy analysis of Giardia lamblia, Spironucleus spp. And Tritrichomonas foetus cells and analysis
G. lamblia, S. vortens, S. salmonicida and Tritrichomonas foetus samples were subject to high pressure freezing and processed as we previously established (Gaechter et al. 2008; Zumthor et al. 2016). Samples were imaged in a FEI CM100 Transmission Electron Microscope. Pixel size was assigned to 0.8 nm. Tiles were obtained automatically after determination of focal point. Tiles were aligned with TrakEM2 (Cardona et al. 2012).
Immunofluorescence Assays
Chemically fixed cells for subcellular recombinant protein localization were prepared as previously described (Konrad et al. 2010). HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200, Invitrogen). Samples were embedded in Vectashield (VectorLabs) or Prolong Diamond Mounting medium (Invitrogen) containing 4’,6-diamidino-2-phenylindole (DAPI) for nuclear staining.
Fluid phase marker uptake
Dextran uptake assays were performed as described in (Gaechter et al. 2008; Zumthor et al. 2016) using Dextran 10kDa at 2mg/mL (Invitrogen). Coupled fluorophore was chosen based on image technique chosen. Immunostaining was performed as described above with the exception of using only 0.02% Triton-X100 (Sigma) in 2% BSA (Sigma) for permeabilization, to prevent leakage and loss of Dextran signal. Intensities were calculated with a costume developed macro in Fiji/ImageJ (Schindelin et al. 2012), resorting to WEKA algorithms for segmentation (Arganda-Carreras et al. 2017).
Laser Scan Confocal Microscopy (LSCM)
Imaging was performed in an inverted Confocal Laser Scanning Microscope Leica SP8 using appropriate parameters. Confocal images were subsequently deconvolved using Huygens Professional (https://svi.nl/Huygens-Professional) and analysed using Fiji/ImageJ (Schindelin et al. 2012).
Stimulated Emission Depletion (STED) Microscopy
Sample preparation was done as described for LSCM. For imaging, samples were mounted in ProLong Diamond antifade reagent (Thermo Fisher Scientific). Super resolution microscopy was performed on a LSCM SP8 gSTED 3X Leica (Leica Microsystems) using appropriate gating settings. Nuclear labelling was omitted due to possible interference with the STED laser. A pulse depletion laser of 775 nm at 100% strength was used to deplete signal coming from samples using the fluorophore Alexa Fluor 594. Signal from samples containing Alexa Fluor 488 were depleted with the depletion laser line 592 nm at 50% strength. Pinhole was kept at 1 AU. Images were deconvolved using Huygens Professional (https://svi.nl/Huygens-Professional). After deconvolution, signal was segmented following a pixel and object classification routine in ilastik. Thresholding was processed in Fiji/ImageJ (Schindelin et al. 2012) with respective calculation of organelle area.
Single Molecule Localization Microscopy (SMLM)
Cells were fixed into a coverslip using a cytospin (6 min, 600 g). Samples were then embedded in Vectashield based imaging medium (Olivier et al. 2013). Excess buffer was dried up and samples were sealed. Single Molecule Imaging was performed on a on a Leica SR-GSD 3D microscope (Leica Microsystems) as described in (Mateos et al. 2016) with a cylindrical lenses, in order to image the apical cell region, giving a z-depth of about 800 nm.. A minimum of 100 000 events were recorded. Image reconstruction was performed with the ImageJ plugin Thunderstorm (Ovesný et al. 2014). Reconstructed images were segmented following a pixel and object classification routine in ilastik (Sommer et al. 2011; Berg et al. 2019). Thresholding and volume calculation was performed in Imaris (Bitplane AG).
Native Co-immunoprecipitation of S. salmonicida CHC
Co-immunoprecipitation assays on control wild type S. salmonicida and transgenic S. salmonicida bearing the HA-tagged CHC were processed as previously established (Zumthor et al. 2016) in non-cross-linking conditions agent.
Protein analysis and sample preparation for mass spectrometry (MS)-based protein identification
SDS-PAGE analysis was performed on 4%-10% polyacrylamide gels under reducing conditions. Blotting was done as described in (Konrad et al. 2010) using primary rat-derived anti-HA antibody (dilution 1:500, Roche) followed by anti-rat (dilution 1:2000; Southern Biotech) antibody coupled to horseradish peroxidase. Gels for mass spectroscopy (MS) analysis were stained with Instant blue (Expedeon) and de-stained with ultrapure water. MS-based protein identification was performed as previously reported (Zumthor et al. 2016).
In silico co-immunoprecipitation dataset analysis
The co-IP datasets derived from transgenic cells expressing epitope-tagged “baits” as affinity handles were filtered using dedicated control co-IP datasets generated from non-transgenic wild-type parasites to identify candidate interaction partners unique to bait-specific datasets. This was done using Scaffold4 (http://www.proteomesoftware.com/products/scaffold/). Unless otherwise indicated, bait-derived co-IP data was filtered using high stringency parameters (Exclusive Spectrum Counts at 95-2-95, 0% FDR) and manually curated to rank putative interaction partners in a semi-quantitative fashion using ESCs as a proxy for relative abundance. Only proteins with more than 10 hits were considered. Proteins in both datasets were only considered if present 3-fold in the transgenic line versus the control. In silico analysis of hypothetical proteins was mainly carried out using BLASTp for protein homology detection (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins) and HHPred (http://toolkit.tuebingen.mpg.de/hhpred) for protein homology detection based on Hidden Markov Model (HMM-HMM) comparisons and a cut-off at e-value < 0.05 was implemented to assign in silico annotation to otherwise non-annotated proteins of unknown function (Zimmermann et al. 2017).
Protein structure was modelled with the ab initio modelling tool AlphaFold (https://alphafold.ebi.ac.uk/) from Alphabet, powered by Google DeepMind (https://deepmind.com/) deep learning neural network algorithms (Jumper et al. 2021; Tunyasuvunakool et al. 2021). Modelling was done via Google Colab in a Jupyter notebook environment(//colab.research.google.com/github/deepmind/alphafold/blob/main/notebooks/). TM-align calculation was performed online in the server: https://zhanggroup.org/TM-score/. Pymol (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.) was used for protein structure prediction visualisation, superimposing and RMSD calculation using the cealign command.
Data Availability
Access to raw mass spectrometry data is provided through the ProteomeXchange Consortium on the PRIDE platform (Perez-Riverol et al. 2019). Data is freely available using project accession number and project DOI. Project DOI/accession number for datasets derived from bait specific and control co-IP MS analyses are as follows: PXD020201.
Homologue search and Phylogenetic analysis and tree construction
CHC and CLC sequences were probed among several available genomes and transcriptomes with special focus within the fornicata members. Query protein sequences for CHC and CLC from several pan-eukaryotic representatives were obtained and aligned using MUSCLE v.3.8.31 (Edgar 2004) (Supplementary Table 2). Resulting alignments were used to generate Hidden Markov Models using the hmmbuild option and HHMer searches were made on all available genomes with an e-value cutoff to 0.01 (Eddy 2011). Hits were considered valid if reciprocal BLASTp returned a Homo sapiens homologue with a e-value < 0.05. Transcriptome searches were carried out resorting to tBLASTn searches using the Homo sapiens and Monocercomonoides exilis respective sequences for CHC or CLC. Once a hit was found it was translated into an amino acid sequence and was considered valid if it pulled a Homo sapiens homolog with an e-value < 0.05. All found sequences can be found in supplementary tables 2 to 9. Protein domain searches were performed at the Conservate Domain Database (CDD), through the Pfam database (Lu et al. 2020; Mistry et al. 2021). The interPro and SMART platforms were also used for domain classification (Letunic and Bork 2017; Mitchell et al. 2019). Synonymous vs non-synonymous mutation ratio was calculated with an available online software (http://services.cbu.uib.no/tools/kaks) following maximum likelihood parameters.
Statistical analysis and further used software
All data was analysed for statistical significance and plotted using Prism 9 (Graphpad, https://www.graphpad.com/scientific-software/prism/) software. Images were composed using Affinity Designer software (https://affinity.serif.com/en-gb/). Video processing was made using Da Vinci Resolve v17.3.
CONFLICTS OF INTEREST
No conflicts of interest
AUTHOR CONTRIBUTIONS
RS, ABH and CF designed and curated the study. RS performed all experiments and analysed all ensuing experimental data with the exception of Spironucleus salmonicida culturing and uptake experiments performed by AA and SS, and SEM experiments performed by JPZ. SVP, RS and JBD performed molecular phylogeny analyses. RS, ABH and CF wrote and revised the manuscript. All authors read and approved the final manuscript prior to submission.
Supplementary figures
Supplementary figure 1 – Rendering of a G. lamblia trophozoite scanned with FIB-SEM reveals the cell’s inner ultrastructure. (A) 3D view of acquired FIB-SEM trophozoite data. (B) Single slice showing inner cellular structures such as cytoskeleton elements at the median body (MB), the ventral disk (VD), the endoplasmic reticulum (ER), mitosomes (m) and peripheral vacuoles (PV), highlighted in the region of interest (ROI). (C) Segmentation of different categories of the dataset: cell volume (138 µm3), cytoskeleton, endoplasmic reticulum, peripheral vacuoles, small vesicles and mitosomes. (D) Mitosome volume (N = 14, box-plot) was determined post segmentation at an average volume of 0.001093±0.0005698µm3 in a 95% confidence interval between [0.0007643, 0.001422] µm3.
Supplementary figure 2 – Cryo-SEM of freeze-fractured trophozoites reveals varying vacuolar morphology in Giardia lamblia. (A) Overview of cryo-preserved Giardia trophozoites subjected to freeze-fracture and SEM imaging. Nuclei (N), Endoplasmic Reticulum (ER), Ventral Disk (VD) and peripheral endocytic compartments (PEC) and plasma membrane (PM) are clearly identifiable. (B and C) Insets showing different PEC morphology: vesicular (asterisk) and tubular (hashtag). Scale bar: (A) 2 µm and (B and C) 500 nm.
Supplementary figure 3 – TEM investigation of Giardia lamblia endocytic and secretory pathway. (A) Overview of a trophozoite. Different PEC structures, vesicular and tubular are observed, together with small vesicles (SV). The N (nucleus) and ER are also highlighted. (B) Close up on tubular PECs (hashtag). (C) Close up on vesicular PECs (asterisk) and SVs (arrowhead). Scale bars: (A) 2 µm, (B) 1 µm and (C) 500 nm.
Supplementary figure 4 – TEM investigation of S. salmonicida endocytic and secretory pathway. (A) S. salmonicida presents vacuolar formations close to the plasma membrane. Cells also present a prominent endoplasmic reticulum (ER; blue-framed inset). (B) Highlight of vacuolar formations (V) and ER. (C) Second cell displaying an abundance of PV close to its plasma membrane. (D) Highlight of vacuoles (V) and the prominent ER that connects to the plasma membrane (asterisk). (E) S. salmonicida PVs average a diameter of 205±62.6 nm (N=114) in a 95% confidence interval of [193;217]. (F) S. vortens peripheral vacuoles are larger than S. salmonicida vacuoles in a statistically significant manner (p-value < 0.0001). Diameters were manually determined. Scale bars: (A and C) 2 µm and (B and D) 500 nm.
Supplementary figure 5 – TEM investigation of T. foetus Golgi vesicles. (A) More than one Golgi apparatus (G) can be found per cell. These organelles resemble canonical stacked Golgi releasing small coated vesicles. (B) These vesicles average a diameter of 58.4±13.1 nm (N=128) in a 95% confidence interval of [56.1;60.7] nm. Scale bar: (A) 500 nm.
Supplementary figure 6 – Pan-Eukaryotic prediction of clathrin heavy chain protein domains. Pfam analysis of predicted protein domains for several clathrin heavy chain proteins sequences from the following species: Giardia lamblia, Spironucleus vortens, Spironucleus salmonicida, Trepomonas sp., Hexamita inflata, Dysnectes brevis, Kipferlia bialata, Carpediomonas membranifera, Aduncisulcus paluster, Chilomastix cuspidata, Trypanosoma brucei, Naegleria gruberi, Tritrichomonas foetus, Monocercomonoides exilis, Tetrahymena thermophila, Hemimastix kukwestjiik, Chlamydomonas reinhardtii, Dyctiostilium discoideum, Saccharomyces cerevisiae, Caenorhabditis elegans, Homo sapiens, Salpingoeca rosetta, Capsospora owczarzaki and Monosiga brevicollis. A general decrease in domain complexity is observed in excavates compared with higher eukaryotes. CLOs: Carpediomonas-like organisms. Diplom: Diplomonada.
Supplementary figure 7 – The QLMLT motif is exclusive to Holozoa. Alignment of the C-terminii of CHC sequences from selected Opisthokonta, Archaeplastida, Amoebozoa and SAR species highlights the present of the QLMLT uncoating motif only in Holozoa supergroup. The positioning of the QLMLT is highlighted in blue.
supplemental figure 8 – Calculation of Giardia ACLC synonymous vs non-synonymous mutation ratio (ω = ks/kn). (A) Phylogenetic tree resulting of maximum likelihood analysis of the Giardia ACLC sequences. Each node is represented by a number. (B) Overall ω < 1 indicating there is no selective pressure on Giardia ACLC.
supplemental figure 9 – S. salmonicida CHC (SsCHC) is distributed in the cell cytosol in foci and does interact with a structural form of CLC. (A) SsCHC was tagged C-terminally with three HA tags. It is found throughout the cell cytosol. Signal is observed in 88% of the analyzed cells (N = 171). (B) High resolution imaging of SsCHC using confocal imaging reveals CHC foci. (C) Distribution of the 171 proteins found in higher abundance in the SsCHC native co-IP dataset. (D) Native co-IP of tagged SsCHC reporter reveals interaction with several members of the endocytic pathway such as dynamin or beta-adaptin and calmodulin. (E) Ab initio in silico protein modelling with AlphaFold of Ss11905, GlACLC, TbCLC and HsCLC. TM-align and RMSD scores for predicted structures of Giardia ACLC, Trypanosoma brucei CLC and Ss11905 with respect to Homo sapiens CLC show overall structural conservation with respect to a bona fide CLC. Scale bars: (A) 20 µm. (B) 5 µm.
Supplementary figure 10 – Trepomonas sp. PC1 also harbours a putative CLC analogue. Ab initio protein modelling of TPC1_16039, orthologous to Ss11905 in combination with Ss11905, GlACLC, TbCLC and HsCLC. RMSD and TM-align cores show overall structural conservation with respect to a bona fide CLC.
Supplementary Videos
Supplementary Video 1 – Three-dimensional rendering of endocytic compartments in G. lamblia derived from FIB-SEM sectioning and imaging. Scale bar 1 µm.
Supplementary Video 2 – Comparison between confocal and STED imaging of Giardia PECs. Scale bar: 3 µm.
Supplementary Video 3 – Tri-dimensional reconstruction of PV/PECs from STORM data.
Supplementary Video 4 – Tri-dimensional confocal imaging of S. vortens with Dextran-Texas Red. Both peripheral and near-nuclear endosome-like vacuoles are observed.
Supplementary Video 5 - Tri-dimensional STED imaging of S. vortens with Dextran Alexa Fluor 594 reveals endosome-like vacuoles in greater detail.
Supplementary Video 6 - Tri-dimensional STED imaging of T. foetus with Dextran Alexa Fluor 594 reveals endosome-like vacuoles in greater detail.
Supplemental Video 7 – Tri-dimensional high resolution confocal imaging and representation of SsCHC-3xHA foci in the cell cytoplasm.
Supplementary Tables
Supplementary Table 1- PECs volume comparison as calculated in FIB-SEM and STORM experiments
Supplementary Tables 2-9 (one file)
Supplementary Table 2 - Queries used for CHC HHM profile building
Supplementary Table 3 - Results from Pan-Eukaryotic search of CHC homologues in available Proteomes
Supplementary Table 5 - Queries used for CLC HHM profile building Supplementary Table 6 - Results for GlCLC search in available Giardia genomes
Supplementary Table 7 - Results for bona fide CLC present in other genomes/transcriptomes Supplementary Table 8 - Comparison of GlCLC with bona fide CLC
Supplementary Table 9 - Ten best hits from HHPred
Supplementary Table 10 - Search for domains from Clathrin heavy chain super family repeats
Supplementary Table 11 - Modelled sequences for CLC and alike
Supplementary Table 12 - SsCHC co-IP results
ACKNOWLEDGMENTS
ABH and CF are funded by Swiss National Foundation grant 31003A-166437 and PR00P3_179813, respectively. Imaging and image analysis were performed with equipment from the Centre of Microscopy and Image Analysis (ZMB) of the University of Zurich. We thank the following members of the ZMB for technical and scientific support: Dr. Jana Döhner, Dr. Moritz Kirchmann, Dr. Dominik Hänni, Dr. José Mateos and Dr. Urs Ziegler. Finally we would like to thank members of the Hehl lab for insightful discussions.
Footnotes
Authors’ email addresses: RS: rui.santos{at}anatomy.uzh.ch
AA: asgeir.astvaldsson{at}gmail.com
SVP: shweta.pipaliya{at}epfl.ch
JPZ: JonPaulin.Zumthor{at}alt.gr.ch
JBD: dacks{at}ualberta.ca
SS: staffan.svard{at}icm.uu.se
ABH: Adrian.hehl{at}uzh.ch