New Results

The RAM signaling pathway links morphology, thermotolerance, and CO2 tolerance in the global fungal pathogen Cryptococcus neoformans

Benjamin J. Chadwick, Tuyetnhu Pham, Xiaofeng Xie, Laura C. Ristow, Damian J. Krysan, Xiaorong Lin
doi: https://doi.org/10.1101/2022.08.14.503895

Abstract

The environmental pathogen Cryptococcus neoformans claims over 180,000 lives each year. Survival of this basidiomycete at host CO2 concentrations has only recently been considered an important virulence trait. Through screening gene knockout libraries constructed in a CO2-tolerant clinical strain, we found mutations leading to CO2 sensitivity are enriched in pathways activated by heat stress, including calcineurin, Ras1-Cdc24, cell wall integrity, and Regulator of Ace2 and Morphogenesis (RAM). Overexpression of Cbk1, the conserved terminal kinase of the RAM pathway, partially restored defects of these mutants at host CO2 or temperature levels. In ascomycetes such as Saccharomyces cerevisiae and Candida albicans, transcription factor Ace2 is an important target of Cbk1, activating genes responsible for cell separation. However, no Ace2 homolog or any downstream component of the RAM pathway has been identified in basidiomycetes. Through in vitro evolution and comparative genomics, we characterized mutations in suppressors of cbk1Δ in C. neoformans that partially rescued defects in CO2 tolerance, thermotolerance, and morphology. One suppressor is the RNA translation repressor Ssd1, which is highly conserved in ascomycetes and basidiomycetes. The other is a novel ribonuclease domain-containing protein, here named PSC1, which is present in basidiomycetes and humans but surprisingly absent in most ascomycetes. Loss of Ssd1 in cbk1Δ partially restored cryptococcal ability to survive and amplify in the inhalation and intravenous murine models of cryptococcosis. Our discoveries highlight the overlapping regulation of CO2 tolerance and thermotolerance, the essential role of the RAM pathway in cryptococcal adaptation to the host condition, and the potential importance of post-transcriptional control of virulence traits in this global pathogen.

Introduction

There are over 278,000 cases of cryptococcal meningitis every year, causing over 180,000 deaths (Rajasingham et al., 2017). Cryptococcal meningitis is primarily caused by the ubiquitous environmental fungus Cryptococcus neoformans. Airborne spores or desiccated yeast cells of C. neoformans are inhaled into the lungs, where they are cleared or remain dormant until reactivation upon host immunosuppression (Casadevall & Perfect, 1998; Youbao Zhao, Lin, Fan, & Lin, 2019).

Litvintseva et al. found that most environmental Cryptococcus isolates cannot cause fatal disease in mouse models of cryptococcosis, despite having similar genotypes and in vitro phenotypes to known virulent isolates, including thermotolerance, melanization, and capsule production (Litvintseva & Mitchell, 2009). Mukaremera et al. also observed that in vitro phenotype assays for thermotolerance, capsule production, titan cell formation, or fluconazole heteroresistance, could not differentiate high-virulence strains from low-virulence strains (Mukaremera et al., 2019). These observations raise the possibility that other, unidentified virulence traits are important for Cryptococcus pathogenesis. Krysan and Lin laboratories demonstrated that tolerance to host levels of CO2 (∼5% CO2 in the host and ∼0.04% in ambient air) is likely a significant factor separating the potentially virulent natural isolates from the non-pathogenic environmental isolates that Litvintseva et al. tested (Krysan et al., 2019; Litvintseva & Mitchell, 2009).

The ability to adapt to host conditions is a prerequisite for cryptococcal pathogenesis. For instance, the ability of C. neoformans to replicate at human body temperature (≥37°C) has been extensively investigated. Many genes have been shown to be essential for thermotolerance (Perfect, 2006; Stempinski et al., 2021; Yang et al., 2017), including calcineurin which is currently being explored for antifungal drug development (Gobeil et al., 2021). By contrast, the underlying mechanisms or genes that play a role in CO2 tolerance have yet to be identified. Here, we set out to identify CO2-sensitive mutants and to gain the first insight into the genetic components involved in CO2 tolerance in C. neoformans.

Results

1. CO2 sensitivity is independent of pH

Our previous work indicates that many C. neoformans environmental strains are sensitive to 5% CO2 when grown on buffered RPMI media, commonly used for mammalian cell cultures and testing antifungal susceptibility (Krysan et al., 2019). CO2 at host concentrations also acts synergistically with the commonly used antifungal drug fluconazole in inhibiting cryptococcal growth on buffered RPMI media. Because CO2 lowers the pH of aqueous environments, it is possible that the CO2 growth inhibitory effect or its synergy with fluconazole is simply due to lower medium pH. To address this question, we tested sensitivity to fluconazole of wild-type strain H99 using E-test on buffered RPMI media of either pH 6 or pH 7, with or without 5% CO2. In this E-test, the size of halo (clearance zone) reflects fungal susceptibility to fluconazole. As shown in Figure 1A, clearance zones were much larger in 5% CO2 relative to those in ambient air at both pH6 and pH7, indicating that CO2 sensitizes cryptococcal susceptibility to fluconazole. Furthermore, CO2 inhibits the growth of H99 at both pH 6 and pH 7 (smaller colony size in 5% CO2 relative to that in ambient air). Additionally, growth of CO2-sensitive environmental strain A7-35-23 (Krysan et al., 2019) was severely inhibited by 5% CO2 at both pH6 and pH7 (Figure 1B). In general, C. neoformans grows better at acidic pH (can grow well in pH3), and both A7-35-23 and H99 grew better at pH6 than at pH7 in ambient air (Figure 1B). Taken together, these results suggest that cryptococcal growth inhibition by CO2 is not simply due to lowered pH.

Figure 1
Figure 1 CO2 sensitivity is not simply due to lowered medium pH.

(A) H99 cells were plated onto RPMI solid medium buffered to either pH 6 or pH 7. Fluconazole containing E-test strips were placed onto the lawn of H99 cells and the plates were incubated at 37°C in ambient air or in 5% CO2. The larger the halo surrounding the E-strip, the more sensitive the cells are to fluconazole. The intercept value of the halo with the E-strip is the minimal inhibitory concentration. (B) Cells of the previously identified CO2-tolerant H99 and CO2-sensitive A7-35-23 were serial diluted, spotted onto RPMI media buffered to pH 6 or pH7, and incubated at 37°C in ambient air or in 5% CO2.

2. Identifying genes important for CO2 tolerance

To identify genes involved in CO2 tolerance in C. neoformans, we screened gene deletion mutants constructed in the CO2-tolerant clinical reference strain H99. For large-scale screening, we were interested in using simplified medium. Accordingly, we tested the growth of two CO2-sensitive environmental strains and CO2-tolerant H99 in different levels of CO2 when cultured on the commonly used mycological YPD media. As expected, relative to H99, the CO2-sensitive strains A7-35-23 and A1-38-2 grew poorly at 5% CO2 and worse at 20% CO2 (Figure 2A). Using this approach, the following deletion mutant libraries were screened at 20% CO2 on YPD media: a set of strains previously constructed in our lab, the collections constructed by the Madhani lab, and a set generated in the Lodge Lab (Chun & Madhani, 2010). As some mutants are known to be temperature sensitive, we carried out the screens at 30°C rather than 37°C. Out of the over 5,000 gene knockout mutants screened, 96 were found to be sensitive to CO2 by visual observation (Table S1). We noticed that knockout mutants for multiple pathways known to be activated by heat stress are CO2 sensitive, including the Ras1-Cdc24 pathway, calcineurin, cell wall integrity (CWI), and Regulator of Ace2 and Morphogenesis (RAM). This finding indicates an overlapping nature of these two traits.

Figure 2.
Figure 2. The RAM pathway effector kinase Cbk1 is critical for CO2 tolerance.

(A). The clinical reference strain H99 and environmental strains A7-35-23 and A1-38-2 were grown overnight in YPD, serially diluted, and spotted onto solid YPD media plates. Photographs were taken two days after incubation in the indicated condition. (B) This serial dilution spotting assay was similarly performed for H99 and the mutants indicated. Two independent overexpression transformants for each mutant background were included as biological replicates. (C) Heatmap showing normalized total RNA counts of NanoString targets in H99 and cbk1Δ cultured at either ambient or 5% CO2, red indicates higher and blue indicates lower transcript abundance. (D) Volcano plot showing significantly differentially expressed transcripts (P value of <0.05) in the cbk1Δ compared to H99 in the 5% CO2 condition. (E) Serial dilution spotting assay of H99 and four of the mutants found in the deletion set screening to be CO2 sensitive which also correspond to significantly downregulated genes shown in the Volcano plot.

We were surprised by the absence of components of adenylyl cyclase-PKA pathway from the set of hits. In Candida albicans, the adenylyl cyclase pathway is crucial for the yeast-hypha transition in response to host levels of CO2 (Klengel et al., 2005). This pathway has also been proposed to play an important role for Cryptococcus to sense CO2 (Mogensen et al., 2006). However, we found that adenylyl cyclase pathway mutants showed no growth defects in CO2, including the adenylyl cyclase mutant cac1Δ, the adenylyl cyclase associated protein mutant aca1Δ, the alpha G protein subunit mutant gpa1Δ, and the cAMP-dependent protein kinase mutant pkr1Δ (SI Appendix, Figure S1). This indicates that growth defects in response to host levels of CO2 are likely independent of bicarbonate activation of adenylyl cyclase. This is not unexpected given that bicarbonate is not a limiting factor under the high level of CO2 used in our screen.

Because the calcineurin, Ras1-Cdc24, CWI, and RAM pathways are all activated at host temperature and were identified in our screen for CO2-sensitive mutants, we reasoned their downstream effectors may be related or genetically interact. As the RAM pathway effector kinase mutant cbk1Δ showed the most severe defect in thermotolerance and CO2 tolerance compared to the mutants of the other pathways, we first overexpressed the gene CBK1 in the following mutants, cdc24Δ (Ras1-Cdc24), mpk1Δ (CWI), cna1Δ (Calcineurin), and the cbk1Δ mutant itself, and observed their growth at host temperature and host CO2 (Figure 2B). Overexpression was achieved by placing the CBK1 open reading frame after the inducible CTR4 promoter, which is highly activated in YPD media (Ory, Griffith, & Doering, 2004; Wang et al., 2014; Wang, Zhai, & Lin, 2012). The CBK1 overexpression construct was specifically integrated into the “safe haven” locus SH2 (Jianfeng Lin, Fan, & Lin, 2020; Upadhya et al., 2017) in each mutant strain background to avoid complications due to positional effect. As expected, the growth defect of the cbk1Δ mutant at 37°C with and without 5% CO2 were largely restored by CBK1 overexpression. At 30°C, overexpression of CBK1 restored the growth of the mpk1Δ mutant, the cna1Δ mutant, and the cdc24Δ mutant in the CO2 condition. In terms of thermotolerance, overexpression of CBK1 restored growth of mpk1Δ but not cna1Δ, while the growth defect of cdc24Δ at 37°C was exacerbated. CBK1 overexpression failed to rescue growth of any of these mutants when both stressors were present (37°C + 5% CO2). We found that overexpression of CBK1 in the WT H99 background caused a modest growth defect at 37°C + 5% CO2. Thus, the detrimental effects from CBK1 overexpression under this growth condition may partially explain its inability to fully rescue growth of these tested CO2-sensitive mutants. The reciprocal overexpression of CDC24, MPK1, or CNA1 in the cbk1Δ mutant background did not restore growth under 37°C and/or 5% CO2 (SI Appendix, Figure S2). These results support a hypothesis that Cbk1 integrates multiple stress response pathways to regulate both CO2 tolerance and thermotolerance.

To determine the extent of Cbk1’s role in CO2 tolerance, we conducted NanoString gene expression profiling of the WT H99 and cbk1Δ mutant cultured in ambient air and in 5% CO2 at 30°C (Figure 2C). Transcript levels of 118 gene was measured and those genes were chosen based on RNA sequencing results from a separate study. In that study, these genes were differentially expressed in CO2 vs ambient air conditions in either two CO2-sensitive or two CO2-tolerant natural strains (Dataset S1). Out of these 118 CO2-associated genes, 81 were found to be significantly differentially expressed in the cbk1Δ mutant in both ambient air and in 5% CO2, indicating they are intrinsically dysregulated in the cbk1Δ mutant.

57/81 of these genes are downregulated and 24/81 upregulated compared to the WT H99 strain (Figure 2D). Interestingly, 16/57 of the downregulated genes were also hits in our deletion set screening. We confirmed sensitivity to host CO2 conditions for four of these mutants by spotting assay (Figure 2E).

Taken together, this transcriptomic profiling shows that loss of Cbk1 significantly affects the expression of CO2-related genes.

3. The RAM signaling pathway is critical for normal morphology, thermotolerance, and CO2 tolerance

The RAM pathway effector kinase Cbk1 is part of the NDR/LATS family of kinases, which is conserved from yeast to humans and affects a wide range of cellular functions including cell-cycle regulation. Through our genetic screen for CO2-sensitive mutants, we found that all tested Cryptococcus RAM pathway mutants are extremely sensitive to 5% CO2 and high temperature, and they show no growth at 37°C + 5% CO2 (Figure 3A). In ascomycetes such as S. cerevisiae and C. albicans, RAM pathway mutants are defective in cytokinesis and exhibit loss of polarity, resulting in enlarged round cells that cluster together (Saputo, Chabrier-Rosello, Luca, Kumar, & Krysan, 2012)(Figure S3). In contrast, though defective in cytokinesis (Walton, Heitman, & Idnurm, 2006), Cryptococcus RAM pathway mutants are hyper-polarized and constitutively form clusters of elongated pseudohyphal cells (Figure 3B). Moreover, we found that while the C. albicans homozygous cbk1ΔΔ mutant exhibits a general growth defect compared to the wild-type control, it shows no apparent specific growth defect at 37°C with or without 5% CO2 (Figure S3). These results suggest that, although the RAM pathway is conserved in its role in cytokinesis, the effects of its downstream targets are divergent between ascomycetes and basidiomycetes.

Figure 3.
Figure 3. The RAM pathway is critical for normal morphology, thermotolerance, and CO2 tolerance.

(A) C. neoformans WT H99 and RAM pathway mutants were serially diluted, spotted onto YPD medium, and incubated for two days at the indicated condition. (B) The cellular morphology of Cryptococcus neoformans WT H99 and RAM pathway mutants cultured in YPD medium.

4. Suppressors of the cbk1Δ mutant show improved growth at host conditions

In ascomycetes, Ace2 is a key downstream transcription factor of the RAM pathway (hence in the name of RAM − regulator of Ace2 and morphogenesis), which is important for the activation of genes responsible for cell separation. However, no homolog to Ace2 has been identified in Cryptococcus or other basidiomycetes. Furthermore, no downstream targets of the RAM pathway have been identified in any basidiomycetes. To investigate potential downstream effectors of the RAM pathway in Cryptococcus, we screened for spontaneous suppressor mutants of cbk1Δ. To do so, cbk1Δ mutant cells from an overnight culture in liquid YPD at 30°C were plated onto solid YPD media and incubated for two days at 37°C + 5% CO2. Out of >1×108 cells plated and cultured under this condition that is inhibitory for growth of the original cbk1Δ mutant, 11 suppressor colonies were isolated for further examination and sequencing. All the suppressor isolates showed dramatically improved growth over the original cbk1Δ mutant at 37°C and modestly improved growth at 37°C + 5% CO2 (Figure 4C). Based on their distinctive phenotypes, the 11 suppressors were classified into two groups: sup1 (2/11) and sup2 (9/11). Shorter chains of cells in both groups indicate a partial restoration in cytokinesis (Figure 4D). The sup2 group has slightly improved growth at 37°C + 5% CO2 and forms shorter chains of cells compared to the sup1 group (Figure 4C, 4D). Besides these observations, sup1 and sup2 displayed similar phenotypes in all other cryptococcal virulence traits tested, including melanin production, capsule, urease activity, and cell wall stress tolerance (SI Appendix, Figure S4).

Figure 4.
Figure 4. Natural suppressors of the RAM pathway cbk1Δ mutant restore multiple defects.

(A) Protein diagram of Psc1 showing the effects and positions of suppressor mutations in the two sup1 type natural suppressors. (B) Protein diagram of Ssd1 and the effects and positions of suppressor mutations in Ssd1 in the nine sup2 type natural suppressors. STOP indicates a nonsense mutation, MS a missense mutation, and FS a frameshift mutation. Asterisks (*) indicate mutations in the same suppressor strain. (C) Serial dilutions of H99 and the mutant strains were spotted onto YPD agar media and incubated for two days in the indicated condition to observe growth. (D) The cellular morphology of H99 and the mutant strains in liquid YPD cultures were examined under microscope.

Along with the original cbk1Δ mutant, we sequenced the genomes of the 11 cbk1Δ suppressors. By comparing their genome sequences with each other and with the original cbk1Δ mutant, we found that both sup1 type suppressor mutants contained a disruptive in-frame deletion at the same location in CNAG_01919, which encodes a putative Poly(A)-specific ribonuclease (PARN) domain-containing protein (Figure 4A). Interestingly, while this domain is found in S. pombe (Marasovic, Zocco, & Halic, 2013), we did not identify this domain in the genomes of S. cerevisiae, C. albicans or other ascomycetes. By contrast, the PARN domain is common in basidiomycetes and higher eukaryotes. The in-frame deletion results in a change of two amino acids within the predicted PARN domain, the only discernable domain present in this protein. We named this previously uncharacterized gene Partial Suppressor of cbk1Δ (PSC1). All of the 9 sup2 isolates contained loss of function or missense mutations in the gene CNAG_03345 (Figure 4B), which encodes an RNA-binding protein homologous to S. cerevisiae Ssd1p, a known suppressor of cbk1Δ phenotypes in the model budding yeast. In S. cerevisiae, Ssd1p represses transcript translation and is negatively regulated by Cbk1p phosphorylation (Jansen, Wanless, Seidel, & Weiss, 2009; Wanless, Lin, & Weiss, 2014).

To confirm that the mutations in SSD1 and PSC1 are responsible for suppressing cbk1Δ, we created cbk1Δssd1Δ and cbk1Δpsc1Δ double mutants together with the control single mutants ssd1Δ and psc1Δ. Indeed, relative to cbk1Δ, the double mutants showed reduced sensitivity to host temperature and CO2 levels (Figure 4C), similar to the natural suppressor mutants. Likewise, the morphology of the double mutants resembles that of the spontaneous suppressor mutants (Figure 4D). The deletion of SSD1 and PSC1 alone in the wild-type background did not yield any discernable phenotype. The results confirm that loss of function in Ssd1 and Psc1 is responsible for the restoration of the cbk1Δ mutant’s growth defects observed in the natural suppressors. Interestingly, sup2 and the cbk1Δssd1Δ mutants both grew noticeably better than sup1 and cbk1Δpsc1Δ at 37°C and 37°C + 5% CO2. To test the genetic interaction between the two suppressor genes SSD1 and PSC1, we created a triple cbk1Δpsc1Δssd1Δ mutant and the control strain psc1Δssd1Δ. The psc1Δssd1Δ control strain did not exhibit any defect and grew similarly well to either single mutant or the wild type (Figure 4C). The triple mutant cbk1Δpsc1Δssd1Δ grew similarly well as sup2 or cbk1Δssd1Δ at 37°C + 5% CO2 (Figure 4C). However, the triple mutant displayed aberrant morphology and budding defects which are not observed in the natural suppressor mutants or the cbk1Δssd1Δ and cbk1Δpsc1Δ double mutants (Figure 4D). These results suggest that Psc1 and Ssd1 may function in the same pathway in regulating thermotolerance and CO2 tolerance, but their downstream effects on cell separation may be overlapping but distinct.

To determine if the suppressor mutations restore transcript abundance of the differentially expressed genes under CO2 in cbk1Δ, we compared the profiles of cbk1Δ to the two suppressor mutants: sup1 and sup2. Overall, we found that the spontaneous suppressors do not restore transcript abundances of most differentially expressed genes in cbk1Δ to WT levels (SI Appendix, Figure S5), suggesting that post-transcriptional regulation might play a role in CO2 tolerance.

5. Spontaneous suppressors of cbk1Δ mutant show improved ability to survive and amplify in the host

RAM mutants have previously been found to be attenuated in virulence in the invertebrate wax moth larva infection model and mouse intranasal infection models. Occasionally, cryptococcal strains with point mutations in RAM genes cause death of mice when revertant mutations occur (Magditch, Liu, Xue, & Idnurm, 2012). Consistently, we found that the cbk1Δ mutant shows severe defect in growth at host temperature and CO2 levels. Because sup1 and sup2 both largely restored growth at 37°C but only modestly restored growth at 37°C + 5% CO2, we decided to test if and how much these suppressor mutations could restore the virulence defect of cbk1Δ. We infected mice with 1 × 104 cells of WT, cbk1Δ, sup1, or sup2 intranasally. In this intranasal infection model, the WT H99 strain establishes lung infection first and typically disseminates to other organs including the brain at about 7-10 days post-infection (DPI). Mice infected by H99 normally reach clinical endpoint around 3-4 weeks post-infection and these mice have a high fungal burden in the lungs, brain, and kidney (Chadwick & Lin, 2020; Jianfeng Lin et al., 2022). As expected, all mice infected by H99 were moribund by DPI 26 (Figure 5A) while the cbk1Δ mutant failed to cause any mortality when we terminated the experiment at DPI 60. Surprisingly, sup1 and sup2 strains did not cause any mortality either. The organ fungal burden, however, revealed differences in virulence levels between these strains. At the time of euthanasia for H99-infected mice (prior to DPI 26), the median fungal burden in the lungs, brains, and kidneys was 2.1×108, 1.4×106, and 2.4×104 CFUs per organ respectively (Figure 5B). As expected, mice completely cleared the cbk1Δ cells when examined at DPI 35. Surprisingly, despite largely restored growth at 37°C, sup1 was completely cleared from the mouse lungs by DPI 35, similar to the cbk1Δ mutant. In comparison, although sup2 did not cause any death during the study period, it was able to grow in mouse lungs and the lung CFUs were ∼10-fold higher than the original inoculum when examined at DPI 35. The sup2 strain maintained the same high fungal cell count in the lungs even at DPI 60 (Figure 5B), indicating that it can persist in the animals for a long time. The only obvious in vitro difference observed between sup1 and sup2 was better growth of sup2 at host CO2 levels, which may explain the difference in their ability to propagate and persist in the mouse lungs.

Figure 5.
Figure 5. Suppressor mutants are partially restored for phagocytosis and can disseminate in the intravenous infection model of cryptococcosis.

(A) Mice were infected with 1×104 fungal cells intranasally, and their survival was monitored for 60 days post infection. (B) At day 35 post infection (DPI 35) and at the time of termination (DPI 60), 5 out of 10 mice per group for the cbk1Δ mutant, sup1 and sup2 groups were harvested for brains, kidneys, and lungs. For H99 infected mice, they were euthanized at their clinical end point (all before DPI 26). Tissue homogenate was serially diluted and plated onto YNB medium to count the colony forming units (CFUs) to measure the fungal burden per organ. (C) Murine macrophage J774A.1 cells were co-incubated with 2×106 cryptococcal cells opsonized with serum from naïve mouse for two hours. Nonadherent or phagocytosed cells were washed, and cryptococcal cells were released and then serially diluted before plating onto YNB medium for measurement of colony forming units (CFUs). Statistical analysis was performed on the percentage of phagocytosed cells relative to H99, using one-way ANOVA. A p-value < 0.05 is considered statistically significant. (D) The same as above, except opsonization was performed with serum of mice vaccinated against cryptococcosis. (E) Mice were challenged with 1×105 cryptococcal cells intravenously. At day 5 post infection, five mice per group were sacrificed. Brains, kidneys, and lungs of euthanized mice were dissected and homogenized. Serial dilutions were plated to count CFUs for quantification of fungal burden per organ.

Although the spontaneous suppressor sup2 was able to grow and survive in the mouse lungs, there was no fungal burden detected in the brain or the kidney at DPI 35 or 60 (all zeros in all mice examined), indicating a failure in dissemination. We considered two hypotheses: 1) Inability of suppressor sup2 to escape from the lungs; 2) Inability of suppressor sup2 to penetrate other organs from the blood. Because one way that C. neoformans disseminates from the lungs to other organs is by a “Trojan Horse” mechanism, where Cryptococcus travels within the mobile host phagocytes (Kechichian, Shea, & Del Poeta, 2007; Santiago-Tirado, Onken, Cooper, Klein, & Doering, 2017), we examined phagocytosis of the cbk1Δ mutant and its suppressors to test the first hypothesis. We expect that cryptococcal mutants defective in being phagocytosed by host cells might be defective in dissemination, and the cbk1Δ mutant was previously found to have poor phagocytosis index (J. Lin, Idnurm, & Lin, 2015). Here, we co-cultured murine macrophage JA774 cells with H99, cbk1Δ, sup1, sup2, the double mutant cbk1Δssd1Δ, or the control single mutant ssd1Δ. Opsonization was performed using either naïve mouse serum (complement mediated phagocytosis) or serum from mice vaccinated against cryptococcosis (complement + antibody mediated phagocytosis)(Jianfeng Lin et al., 2022; Zhai et al., 2015). Consistent with our previous finding, phagocytosis of cbk1Δ was extremely low (∼1% of the WT H99 level under complement mediated phagocytosis, Figure 5C). Opsonization with serum from vaccinated mice increased phagocytosis of cbk1Δ and the suppressor mutants, but the phagocytosis indexes of these mutants were still only 20% or less than that of the wildtype (Figure 5D). In both phagocytosis experiments, the suppressor mutants did not show rescued phagocytosis. The poor phagocytosis of the cbk1Δ mutant and its suppressors may have contributed to their lack of dissemination from the lungs to the other organs in the inhalation infection mouse model of cryptococcosis.

To test the second hypothesis, we infected mice intravenously with H99, cbk1Δ, sup1, sup2, the double mutant cbk1Δssd1Δ, or the control single mutant ssd1Δ. In this intravenous infection model, the barrier of the lungs is bypassed. H99 cells are expected to disseminate to the brain and other organs within hours. Because of H99’s rapid dissemination in this model, infected mice typically reach clinical endpoint after 1 week. Therefore, we euthanized mice at DPI 5 before H99-infected mice would have become moribund. As expected, H99-infected mice showed high fungal burdens in the lungs, brains, and kidneys, with the highest fungal burden in the brain (over 106 CFUs) (Figure 5E). The cbk1Δ mutant is avirulent in this intravenous infection model as no viable cells were recovered in any organ. Similarly, we could not recover any sup1 cells from the lungs or the brain, and only detected few fungal cells in the kidney. In contrast, sup2 suppressor mutants were recovered in all three organs, albeit with reduced fungal burdens (∼104 CFUs in the brain and a few hundred in lungs/kidney) compared to the wildtype H99 control group (Figure 5E). This finding indicates that the sup2 suppressor, once disseminated into the bloodstream, can invade other organs and replicate. Combined with the earlier observations that 1) both suppressors fully restore growth at host temperature and 2) sup2 is slightly more CO2 tolerant than sup1, the observation that only sup2 can survive, amplify, and persist in animals stresses the importance of CO2 tolerance in cryptococcal pathogenesis. Collectively, the results from phagocytosis, the inhalation infection model, and the intravenous infection model, support the hypothesis that failure of the suppressor mutants to disseminate to other organs in the intranasal model is largely due to reduced phagocytosis and inability to escape the lungs. That said, other factors, such as increased systemic clearance by the immune system, could potentially contribute to the containment of the mutant in the lungs. Again, the cbk1Δssd1Δ mutant recapitulated the phenotype of the sup2 strain in intravenous infection model and other in vitro assays, demonstrating that our observed sup2 phenotypes are due to disruption of SSD1.

Discussion

Detection of and adaptation to changing CO2 levels is an important trait across biological kingdoms and may play a crucial role in the pathogenicity of fungi (Bahn & Mühlschlegel, 2006; Cummins, Selfridge, Sporn, Sznajder, & Taylor, 2014; Hetherington & Raven, 2005). Here we report the identification of genes required for growth at high levels of CO2 in the fungal pathogen C. neoformans. Multiple pathways important for growth at high temperature, such as the Ras1-Cdc24, CWI, Calcineurin, and RAM pathways, were found to be required for normal growth in high CO2, indicating that growth in response to host CO2 may be intricately coordinated and co-regulated with response to host temperature. It is therefore likely that both host CO2 and host temperature stress hamper related biological functions in cryptococcal cells.

Calcineurin and RAM pathways both appeared as hits in our mutant screen for cryptococcal CO2 sensitivity. A previous study found synthetic lethality between the RAM and Calcineurin pathways in C. neoformans but not in S. cerevisiae (Walton et al., 2006). This corroborates our findings of the key differences between the basidiomycete C. neoformans and the ascomycete yeasts. In ascomycete fungal pathogen C. albicans, CO2 levels are sensed through bicarbonate or cAMP-dependent activation of adenylyl cyclase (Du et al., 2012; Hall et al., 2010). Our results indicate that this pathway does not play a significant role in CO2 tolerance in C. neoformans. We also found that disruption of the RAM pathway effector kinase Cbk1 caused a severe growth defect at host CO2 in C. neoformans, but not in C. albicans. The vast differences between these organisms in terms of growth response to CO2 may reflect the evolutionary distance between these species and/or the distinct niches they normally occupy. Indeed, C. albicans is a human commensal and is commonly exposed to host CO2 levels. S. cerevisiae is a powerful fermenter that thrives in conditions with high levels of CO2. For the environmental fungus C. neoformans, however, the ability to grow in a CO2-enriched condition does not appear to be strongly selected for in the natural environment, and the host level of CO2 (∼5% CO2) is over 100-fold higher than the ambient air (∼0.04% CO2).

The RAM pathway mutants were among the most sensitive mutants to host levels of CO2. Remarkably, the growth defects of cbk1Δ could be partially restored by single mutations in the genes PSC1 or SSD1. While the PARN ribonuclease-encoding gene PSC1 represents an uncharacterized protein, SSD1 is a known suppressor of cbk1Δ phenotypes that has been extensively characterized in ascomycete yeasts to regulate the translation of numerous and diverse mRNA transcripts (Hu et al., 2018; Jansen et al., 2009; Lee, Kim, Kang, Yang, & Kim, 2015; L. Li et al., 2009; Wanless et al., 2014). Our genetic interaction analysis indicates that Psc1 likely functions in the same pathway as Ssd1. Interestingly, in S. cerevisiae, deletion of SSD1 can suppress the lethality of cbk1Δ but not the cell separation defect, which is regulated by the transcription factor Ace2 (Kurischko, Weiss, Ottey, & Luca, 2005). However, an Ace2 homolog has not been identified in C. neoformans or any other basidiomycete (J. Lin et al., 2015). The observation that cbk1Δpsc1Δ and cbk1Δssd1Δ suppressor mutants partially rescue cell separation defects suggests that C. neoformans may primarily utilize Ssd1/Psc1 rather than a potential Ace2 homolog to regulate cell separation. Differential regulation of target mRNA transcripts by Ssd1 and Psc1 may explain the functional divergence of the RAM pathway we observed here between basidiomycete Cryptococcus and the ascomycete yeasts. Our observation that the natural suppressors do not restore transcript abundances of CO2-associated genes in cbk1Δ to WT levels supports a hypothesis that disruption of Ssd1 and Psc1 suppresses cbk1Δ mutant’s defects at a post-transcriptional level. C. neoformans has been demonstrated to use post-transcriptional regulation to adapt to various host stresses (Bloom et al., 2019; Kalem, Subbiah, Leipheimer, Glazier, & Panepinto, 2021; Stovall, Knowles, Kalem, & Panepinto, 2021). A temperature-sensitive environmental species of Cryptococcus, C. amylolentus, fails to initiate host stress-induced translational reprogramming and is non-pathogenic (Bloom et al., 2019). Whether or not translatome reprogramming is initiated in C. neoformans in response to host CO2, and whether such reprogramming, if occurs, relies on Ssd1 and/or Psc1, has yet to be determined.

Materials and Methods

Strains, growth conditions, and microscopy examination

Strains used in this study are listed in Table S2. Unless stated otherwise, all C. neoformans cells were maintained at 30°C on yeast peptone dextrose (YPD) media or YPD + CuSO4 (25 μM) for strains transformed with PCTR4-CBK1. For morphological examination, all strains were examined under a Zeiss Imager M2 microscope, equipped with an AxioCam MRm camera. For spotting assays, the tested strains were grown overnight in liquid YPD medium at 30°C with shaking at 220 RPM. The cells were then adjusted to the same cell density of OD600 = 1 and serially diluted 10-fold. The cell suspensions were then spotted onto YPD agar medium and incubated at the indicated condition for two days. CO2 levels were controlled by a VWR CO2 incubator or by a Pro-CO2 controller (Biospherix, Lacona, NY, USA)

Genetic manipulation

Gene Deletion Constructs: To delete the gene SSD1, a deletion construct with a Nourseothricin (NAT) resistance marker cassette with 5’ and 3’ homology arms to SSD1 was used. Primers Linlab7974 (gctgcctttgcgtcatctc) and Linlab7976 (ctggccgtcgttttactctcgccttccttctcctta) were used to amplify the 5’ arm from the H99 genome. The 3’ arm was amplified from H99 with primers Linlab7977 (gtcatagctgtttcctgcgattgacattgccgtcttag) and Linlab7979 (cgacctgatcaaactactcgc). The NAT marker was amplified with universal primers M13F and M13R from plasmid pPZP-NATcc. The three pieces were fused together by overlap PCR and amplified with nested primers Linlab7975 (acaatgagccactgccag) and Linlab7977 (tgcgtgttcactactgtagac). To disrupt the gene PSC1, a Hygromycin (HYG) marker cassette was used to insert into the PARN domain. To generate the sgRNA for specific targeting to the SSD1 locus, the U6 promoter and sgRNA scaffold were amplified from JEC21 genomic DNA and the plasmid pDD162 using primers Linlab7980/Linlab4627 (ttgagtggggtgggtcaattaacagtataccctgccggtg and ggctcaaagagcagatcaatg) and Linlab7981/Linlab4628 (aattgacccaccccactcaagttttagagctagaaatagcaagtt and cctctgacacatgcagctcc). For sgRNA targeted mutation of PSC1, the primers Linlab8380/Linlab4627 (tagttgttttcgccgacgccaacagtataccctgccggtg and ggctcaaagagcagatcaatg) were used to amplify the U6 promoter, and Linlab8381/Linlab4628 (ggcgtcggcgaaaacaactagttttagagctagaaatagcaagtt and cctctgacacatgcagctcc) to amplify the sgRNA scaffold. The U6 promoter and sgRNA scaffold were fused together by overlap PCR with primers Linlab4594/Linlab4595 (ccatcgatttgcattagaactaaaaacaaagca and ccgctcgagtaaaacaaaaaagcaccgac) to generate the final sgRNA construct as described previously (Fan & Lin, 2018; Jianfeng Lin et al., 2020).

Gene Overexpression Constructs: The CBK1 overexpression construct was generated by amplifying the CBK1 open reading frame with primers Linlab7005/BC (ataggccggccatgtcgtatcgcccaatccag) and Linlab7006/BC (cagcatctcgtatcgtcggaag) and cloning the fragment with FseI and PacI into the pXC plasmid backbone (Wang et al., 2012), which contains the promoter of CTR4 and Neomycin resistance marker. The CTR4 promoter is highly induced on the copper limiting YPD media. The MPK1 overexpression construct was generated by amplifying the MPK1 open reading frame with primers Linlab8326/BC (ataggccggccatggacaatacccctagacac) and Linlab8327/BC (ccttaattaaggctatgataatttctgcctctcc) and cloning the fragment with FseI and AsiSI into a pUC19 plasmid backbone, containing the promoter of GPD1 and Neomycin resistance marker. The CDC24 overexpression construct was generated by amplifying the CDC24 open reading frame with primers Linlab6674/BC (ataggccggccatgtctgtatccggtcccatctc) and Linlab6675/BC (ccttaattaaggataaatctctccttgtggggtacc) and cloning the fragment with FseI and PacI into a pUC19 plasmid backbone, containing the promoter of CTR4 and Neomycin resistance marker. The overexpression constructs were integrated into the SH2 locus as described previously (Fan & Lin, 2018; Jianfeng Lin et al., 2020).

Transformation: Constructs for overexpression and deletion were transformed into Cryptococcus strains by the TRACE method (Fan & Lin, 2018; Jianfeng Lin et al., 2020), and transformants were selected on YPD medium with 100 μg/mL of nourseothricin (NAT),100 μg/mL of neomycin (NEO), or 200 μg/mL of hygromycin (HYG).

NanoString RNA profiling

Overnight YPD cultures of H99, cbk1Δ, cbk1Δssd1Δ, and cbk1Δpsc1Δ were washed 2X in PBS and resuspended in RPMI+165mM MOPS, pH 7.4 before quantification on an Invitrogen Countess automated cell counter. Cells were diluted to 7.5×105 cells per mL in 3 mL per well in a 6-well plate. Two wells were used for each biological replicate (n=3) and condition (ambient or 5% CO2). Plates were sealed with BreatheEasy sealing membranes (Sigma #Z380059) and incubated in a static incubator at 30°C in ambient air or 5% CO2 for 24 hours. Cells were harvested, pelleted at 3,200xg for 5 minutes, and the supernatant was removed. The pellets were then frozen at -80°C and lyophilized overnight. Lyophilized cells were disrupted for 45 seconds with 0.5mm glass beads on an MP Biomedicals FastPrep-24 benchtop homogenizer. RNA was extracted following manufacturer instructions for the Invitrogen PureLink RNA mini-kit with on-column DNAse treatment. Purified RNA was quantified on a NanoDrop OneC spectrophotometer and a total of 100ng per sample was combined with a custom probeset (Dataset S1) from NanoString Technologies according to manufacturer instructions. Probes were hybridized at 65°C for 18 hours, then run on a NanoString nCounter SPRINT profiler according to manufacturer instructions. Data from Reporter Code Count (RCC) files were extracted with nSolver software (version 4.0) and raw counts were exported to Microsoft Excel. Internal negative controls were used to subtract background from raw counts (negative control average + 2 standard deviations). Counts were normalized across samples by total RNA counts. Probes below background were set to a value of 1. Fold change and significance were calculated in Excel after averaging biological triplicates, using a Student t-test (p<0.05). Volcano plot was generated with transformed values (-log[p-value] and log2[fold change]) in GraphPad Prism 9. Normalized total counts were used in Morpheus (https://software.broadinstitute.org/morpheus/) to generate a heat map, with hierarchical clustering, one minus Pearson correlation, average linkage method and clustered according to rows and columns.

Bioinformatics

Whole genome sequencing was performed using the Illumina platform with NovaSeq 6000 at the University of California – Davis Sequencing Center, Novogene USA. A paired-end library with approximately 350 base inserts was constructed for each sample, and all libraries were multiplexed and run in one lane using a read length of 150 bases from either side.

The Illumina reads were first trimmed with Trim Galore v0.6.5 (Krueger, 2021), and then mapped to the Cryptococcus neoformans H99 reference genome (FungiDB version 50) using the BWA-MEM algorithm of the BWA aligner v0.7.17(Li, 2013). SAMtools v1.10 (H. Li et al., 2009), Picard Tools v2.16.0 (Broad_Institute), and bcftools v1.13 (Danecek et al., 2021) were used for variant calling from each sample. Variants in the suppressor strains were called with the original cbk1Δ mutant as a reference.

The protein diagrams of Psc1 and Ssd1 were made with the illustrator of biological sequences (IBS) software package (Liu et al., 2015).

Phagocytosis Assays

Mouse macrophage cell line J774A.1 (ATCC® TIB-67™) was acquired from the American Type Culture Collection. Phagocytosis assays were performed using similar procedures as we described previously (J. Lin et al., 2015). Briefly, 1mL of 2×105 J774A.1 macrophages (MΦ) in DMEM media was seeded into a 24 well plate and incubated at 37°C with 5% CO2 for 24 hours. Cryptococcus strains with a starting OD600 of .2 in 3mL of liquid YPD were cultured for 16 hours. Each strain had three technical replicates. The cells were washed three times in sterile H2O. 2×106 cryptococcal cells of each strain were opsonized in either 40ul of 100% fetal bovine serum, naïve mouse serum, or mouse serum from LW10 vaccinated A/J mice (Jianfeng Lin et al., 2022; Zhai et al., 2015), for 30 minutes prior to co-incubation with MΦ. Old DMEM media from MΦ was removed and 1mL of fresh DMEM with the opsonized Cryptococcus cells were added, followed by a 2-hour incubation at 37°C with 5% CO2. The co-culture was then washed six times with warm PBS to remove non-adherent Cryptococcus cells. To lyse the macrophages, the cell suspensions were washed with 1mL of cold PBS + 0.01% Triton X. Serial dilutions in PBS of the cell suspensions were then plated onto YNB agar medium and allowed to grow at 30°C for two days to count colony forming units (CFUs).

Ethical statements

This study was performed according to the guidelines of NIH and the University of Georgia Institutional Animal Care and Use Committee (IACUC). The animal models and procedures used have been approved by the IACUC (AUP protocol numbers: A2017 08-023 and A2020 06-015).

Murine models of cryptococcosis

Intranasal infection model: Female Balb/C mice of 8-10 weeks old were purchased from the Jackson Labs (Bar Harbor, Maine). Cryptococcal strains were inoculated in 3mL of liquid YPD medium with the initial OD600= 0.2 (approximately 106 cell/mL) and incubated for 15 hours at 30°C with shaking. Prior to intranasal infection, cells were washed with sterile saline three times and adjusted to the final concentration of 2×105 cell/mL. Once the mice were sedated with ketamine and xylazine via intraperitoneal injection, 50μL of the cell suspension (1×104 cells per mouse) were inoculated intranasally as previously described (Jianfeng Lin et al., 2022; Zhai, Wu, Wang, Sachs, & Lin, 2012; Zhai et al., 2013; Y. Zhao, Wang, Upadhyay, Xue, & Lin, 2020; Zhu, Zhai, Lin, & Idnurm, 2013). Mice were monitored daily for disease progression. Surviving animals were euthanized at day 35 or 60 post-infection (DPI) and the brain, lungs, and kidneys, were dissected.

Intravenous infection model: Prior to intravenous infections, cryptococcal cells were washed with sterile saline three times and adjusted to the final concentration of 1×106 cell/mL. Mice were sedated with Isoflurane. 100μL of the cell suspension (1×105 cells per mouse) were injected intravenously as previously described (Zhai et al., 2012; Zhai et al., 2013; Y. Zhao et al., 2020; Zhu et al., 2013). After DPI 5, animals were euthanized and the brain, lungs, and kidneys were dissected.

For fungal burden quantifications, dissected organs were homogenized in 2mL of cold sterile PBS using an IKA-T18 homogenizer as we described previously (Zhai et al., 2015; Zhai et al., 2012). Tissue suspensions were serially diluted and plated onto YNB agar medium and incubated at 30°C for 2 days before counting the colony-forming units (CFUs).

Data Availability

Sequences generated from this research has been deposited to the Sequence Read Archive (SRA) under project accession number: PRJNA791949.

Competing Interest Statement

The authors declare no competing interest.

Supplementary Information

Fig. S1.
Fig. S1. The cAMP pathway is not essential for CO2 tolerance.

The reference strain H99 and the indicated gene deletion mutants were grown overnight in YPD, serially diluted, and spotted onto solid YPD media plates. Photographs were taken two days after incubation in the indicated condition.

Fig. S2.
Fig. S2. Overexpression of CDC24, MPK1, or CNA1 does not restore growth at host CO2 or temperature levels.

The strains above were grown overnight in YPD, serially diluted, and spotted onto solid YPD media plates. Photographs were taken two days after incubation in the indicated condition.

Fig. S3.
Fig. S3. Conserved and divergent roles of the RAM pathway in ascomycete Candida albicans and basidiomycete Cryptococcus neoformans.

(A) The colony and cellular morphology of Candida albicans WT strain SN250 and the homozygous cbk1ΔΔ mutant grown on RPMI. (B) The cellular morphology of Cryptococcus neoformans WT H99 and RAM pathway mutants cultured in YPD medium. (C) C. neoformans and C. albicans WT and RAM pathway mutants were serially diluted, spotted onto YPD medium, and incubated for two days at the indicated condition. The image of C. neoformans strains is the same as shown in Figure 3A and is included here for direct comparison with C. albicans strains.

Fig. S4.
Fig. S4. Phenotypic characterization of cbk1Δ suppressor mutants.

(A, B) The strains above were grown overnight in YPD, serially diluted, and spotted onto the indicated solid media. YPD+2% Congo Red was used to assay cell wall stress tolerance. L-DOPA media was used to assay melanin synthesis ability. RPMI media buffered with MOPS was used to test tolerance to 37°C or 37°C+ 5% CO2 at pH6 and pH7.4 to test growth at different pH levels. Photographs were taken two days of incubation. (B) Christensen Urea Agar was used to assay urease activity, indicated by change in media coloration from yellow to pink. (C) The cells incubated for two days on RPMI pH7.4, 37°C+ 5% CO2, were stained with India Ink and observed under the microscope to check capsule size.

Fig. S5.
Fig. S5. Suppressor mutants do not restore transcript levels of Nanostring targets in cbk1Δ.

Heatmap showing normalized total RNA counts of NanoString targets in H99, cbk1Δ, sup1, and sup2 cultured at either ambient air or 5% CO2. Red indicates higher and blue indicates lower transcript abundance.

View this table:
Table S1. Hits from forward genetic screening
View this table:
Table S2. Strains and plasmids used

Acknowledgments

This work was supported by National Institutes of Health (http://www.niaid.nih.gov) (R01AI147541 to D.J.K. and X.L., and R01AI140719 to X.L.). The funder had no role in study design, data collection, and interpretation, or the decision to submit the work for publication. We thank all Lin lab members for their helpful suggestions. We thank Dr. Fanglin Zheng for the plasmid pFZ1, and Dr. Lukasz Kozubowski for the plasmid LKB61.

References

  1. ↵
    Bahn, Y. S., & Mühlschlegel, F. A. (2006). CO2 sensing in fungi and beyond. Curr Opin Microbiol, 9(6), 572–578. doi:10.1016/j.mib.2006.09.003
    OpenUrlCrossRefPubMedWeb of Science
  2. ↵
    Bloom, A. L. M., Jin, R. M., Leipheimer, J., Bard, J. E., Yergeau, D., Wohlfert, E. A., & Panepinto, J. C. (2019). Thermotolerance in the pathogen Cryptococcus neoformans is linked to antigen masking via mRNA decay-dependent reprogramming. Nature communications, 10(1), 4950–4950. doi:10.1038/s41467-019-12907-x
    OpenUrlCrossRef
  3. Broad_Institute. Picard Tools. Broad Institute, GitHub repository. doi:http://broadinstitute.github.io/picard/
  4. ↵
    Casadevall, A., & Perfect, J. R. (1998). Cryptococcus Neoformans: ASM Press.
  5. ↵
    Chadwick, B. J., & Lin, X. (2020). On the History and Applications of Congenic Strains in Cryptococcus Research. Pathogens, 9(9). doi:10.3390/pathogens9090750
    OpenUrlCrossRef
  6. ↵
    Chun, C. D., & Madhani, H. D. (2010). Applying genetics and molecular biology to the study of the human pathogen Cryptococcus neoformans. Methods Enzymol, 470, 797–831. doi:10.1016/s0076-6879(10)70033-1
    OpenUrlCrossRefPubMed
  7. ↵
    Cummins, E. P., Selfridge, A. C., Sporn, P. H., Sznajder, J. I., & Taylor, C. T. (2014). Carbon dioxide-sensing in organisms and its implications for human disease. Cell Mol Life Sci, 71(5), 831–845. doi:10.1007/s00018-013-1470-6
    OpenUrlCrossRefPubMed
  8. ↵
    Danecek, P., Bonfield, J. K., Liddle, J., Marshall, J., Ohan, V., Pollard, M. O., … Li, H. (2021). Twelve years of SAMtools and BCFtools. GigaScience, 10(2), giab008. doi:10.1093/gigascience/giab008
    OpenUrlCrossRefPubMed
  9. ↵
    Du, H., Guan, G., Xie, J., Cottier, F., Sun, Y., Jia, W., … Huang, G. (2012). The transcription factor Flo8 mediates CO2 sensing in the human fungal pathogen Candida albicans. Mol Biol Cell, 23(14), 2692–2701. doi:10.1091/mbc.E12-02-0094
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Fan, Y., & Lin, X. (2018). Multiple Applications of a Transient CRISPR-Cas9 Coupled with Electroporation (TRACE) System in the Cryptococcus neoformans Species Complex. Genetics, 208(4), 1357–1372. doi:10.1534/genetics.117.300656
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Gobeil, S. M. C., Bobay, B. G., Juvvadi, P. R., Cole, D. C., Heitman, J., Steinbach, W. J., … Spicer, L. D. (2021). Leveraging Fungal and Human Calcineurin-Inhibitor Structures, Biophysical Data, and Dynamics To Design Selective and Nonimmunosuppressive FK506 Analogs. mBio, 12(6), e0300021–e0300021. doi:10.1128/mBio.03000-21
    OpenUrlCrossRef
  12. ↵
    Hall, R. A., De Sordi, L., Maccallum, D. M., Topal, H., Eaton, R., Bloor, J. W., … Mühlschlegel, F. A. (2010). CO(2) acts as a signalling molecule in populations of the fungal pathogen Candida albicans. PLoS Pathogens, 6(11), e1001193–e1001193. doi:10.1371/journal.ppat.1001193
    OpenUrlCrossRefPubMed
  13. Hergovich, A., Stegert, M. R., Schmitz, D., & Hemmings, B. A. (2006). NDR kinases regulate essential cell processes from yeast to humans. Nature Reviews Molecular Cell Biology, 7(4), 253–264. doi:10.1038/nrm1891
    OpenUrlCrossRefPubMedWeb of Science
  14. ↵
    Hetherington, A. M., & Raven, J. A. (2005). The biology of carbon dioxide. Current biology : CB, 15(11), R406–410. doi:10.1016/j.cub.2005.05.042
    OpenUrlCrossRefPubMedWeb of Science
  15. ↵
    Hu, Z., Xia, B., Postnikoff, S. D., Shen, Z. J., Tomoiaga, A. S., Harkness, T. A., … Tyler, J. K. (2018). Ssd1 and Gcn2 suppress global translation efficiency in replicatively aged yeast while their activation extends lifespan. eLife, 7. doi:10.7554/eLife.35551
    OpenUrlCrossRef
  16. ↵
    Jansen, J. M., Wanless, A. G., Seidel, C. W., & Weiss, E. L. (2009). Cbk1 regulation of the RNA-binding protein Ssd1 integrates cell fate with translational control. Current biology : CB, 19(24), 2114–2120. doi:10.1016/j.cub.2009.10.071
    OpenUrlCrossRefPubMed
  17. ↵
    Kalem, M. C., Subbiah, H., Leipheimer, J., Glazier, V. E., & Panepinto, J. C. (2021). Puf4 Mediates Post-transcriptional Regulation of Cell Wall Biosynthesis and Caspofungin Resistance in Cryptococcus neoformans. mBio, 12(1). doi:10.1128/mBio.03225-20
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Kechichian, T. B., Shea, J., & Del Poeta, M. (2007). Depletion of alveolar macrophages decreases the dissemination of a glucosylceramide-deficient mutant of Cryptococcus neoformans in immunodeficient mice. Infect Immun, 75(10), 4792–4798. doi:10.1128/iai.00587-07
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Klengel, T., Liang, W.-J., Chaloupka, J., Ruoff, C., Schröppel, K., Naglik, J. R., … Mühlschlegel, F. A. (2005). Fungal adenylyl cyclase integrates CO2 sensing with cAMP signaling and virulence. Current biology : CB, 15(22), 2021–2026. doi:10.1016/j.cub.2005.10.040
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    Krueger, F. (2021). Trim Galore! doi:10.5281/zenodo.5127899
    OpenUrlCrossRef
  21. ↵
    Krysan, D. J., Zhai, B., Beattie, S. R., Misel, K. M., Wellington, M., & Lin, X. (2019). Host carbon dioxide concentration is an independent stress for Cryptococcus neoformans that affects virulence and antifungal susceptibility. mBio, 10(4), e01410–01419. doi:10.1128/mBio.01410-19
    OpenUrlCrossRef
  22. ↵
    Kurischko, C., Weiss, G., Ottey, M., & Luca, F. C. (2005). A Role for the Saccharomyces cerevisiae Regulation of Ace2 and Polarized Morphogenesis Signaling Network in Cell Integrity. Genetics, 171(2), 443–455. doi:10.1534/genetics.105.042101
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Lee, H. J., Kim, J. M., Kang, W. K., Yang, H., & Kim, J. Y. (2015). The NDR Kinase Cbk1 Downregulates the Transcriptional Repressor Nrg1 through the mRNA-Binding Protein Ssd1 in Candida albicans. Eukaryot Cell, 14(7), 671–683. doi:10.1128/ec.00016-15
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Li, H. (2013). Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. doi:arXiv:1303.3997
  25. ↵
    Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., … Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, England), 25(16), 2078–2079. doi:10.1093/bioinformatics/btp352
    OpenUrlCrossRefPubMedWeb of Science
  26. Li, L., Lu, Y., Qin, L. X., Bar-Joseph, Z., Werner-Washburne, M., & Breeden, L. L. (2009). Budding yeast SSD1-V regulates transcript levels of many longevity genes and extends chronological life span in purified quiescent cells. Mol Biol Cell, 20(17), 3851–3864. doi:10.1091/mbc.e09-04-0347
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Lin, J., Fan, Y., & Lin, X. (2020). Transformation of Cryptococcus neoformans by electroporation using a transient CRISPR-Cas9 expression (TRACE) system. Fungal genetics and biology : FG & B, 138, 103364–103364. doi:10.1016/j.fgb.2020.103364
    OpenUrlCrossRef
  28. ↵
    Lin, J., Idnurm, A., & Lin, X. (2015). Morphology and its underlying genetic regulation impact the interaction between Cryptococcus neoformans and its hosts. Med Mycol, 53(5), 493–504. doi:10.1093/mmy/myv012
    OpenUrlCrossRefPubMed
  29. ↵
    Lin, J., Pham, T., Hipsher, K., Glueck, N., Fan, Y., Lin, X., & Chowdhary, A. (2022). Immunoprotection against Cryptococcosis Offered by Znf2 Depends on Capsule and the Hyphal Morphology. mBio, 0(0), e02785–02721. doi:doi:10.1128/mbio.02785-21
    OpenUrlCrossRef
  30. ↵
    Litvintseva, A. P., & Mitchell, T. G. (2009). Most environmental isolates of Cryptococcus neoformans var. grubii (serotype A) are not lethal for mice. Infect Immun, 77(8), 3188–3195. doi:10.1128/iai.00296-09
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Liu, W., Xie, Y., Ma, J., Luo, X., Nie, P., Zuo, Z., … Ren, J. (2015). IBS: an illustrator for the presentation and visualization of biological sequences. Bioinformatics (Oxford, England), 31(20), 3359–3361. doi:10.1093/bioinformatics/btv362
    OpenUrlCrossRefPubMed
  32. ↵
    Magditch, D. A., Liu, T.-B., Xue, C., & Idnurm, A. (2012). DNA Mutations Mediate Microevolution between Host-Adapted Forms of the Pathogenic Fungus Cryptococcus neoformans. PLoS Pathogens, 8(10), e1002936. doi:10.1371/journal.ppat.1002936
    OpenUrlCrossRefPubMed
  33. ↵
    Marasovic, M., Zocco, M., & Halic, M. (2013). Argonaute and Triman Generate Dicer-Independent priRNAs and Mature siRNAs to Initiate Heterochromatin Formation. Molecular Cell, 52(2), 173–183. doi:https://doi.org/10.1016/j.molcel.2013.08.046
    OpenUrlCrossRefPubMed
  34. Mazanka, E., Alexander, J., Yeh, B. J., Charoenpong, P., Lowery, D. M., Yaffe, M., & Weiss, E. L. (2008). The NDR/LATS Family Kinase Cbk1 Directly Controls Transcriptional Asymmetry. PLOS Biology, 6(8), e203. doi:10.1371/journal.pbio.0060203
    OpenUrlCrossRefPubMed
  35. ↵
    Mogensen, E. G., Janbon, G., Chaloupka, J., Steegborn, C., Fu, M. S., Moyrand, F., … Mühlschlegel, F. A. (2006). Cryptococcus neoformans Senses CO2 through the Carbonic Anhydrase Can2 and the Adenylyl Cyclase Cac1. Eukaryotic Cell, 5(1), 103–111. doi:10.1128/ec.5.1.103-111.2006
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Mukaremera, L., McDonald, T. R., Nielsen, J. N., Molenaar, C. J., Akampurira, A., Schutz, C., … Nielsen, K. (2019). The Mouse Inhalation Model of Cryptococcus neoformans Infection Recapitulates Strain Virulence in Humans and Shows that Closely Related Strains Can Possess Differential Virulence. Infect Immun, 87(5). doi:10.1128/iai.00046-19
    OpenUrlCrossRef
  37. ↵
    Ory, J. J., Griffith, C. L., & Doering, T. L. (2004). An efficiently regulated promoter system for Cryptococcus neoformans utilizing the CTR4 promoter. Yeast, 21(11), 919–926. doi:10.1002/yea.1139
    OpenUrlCrossRefPubMedWeb of Science
  38. ↵
    Perfect, J. R. (2006). Cryptococcus neoformans: the yeast that likes it hot. FEMS yeast research, 6(4), 463–468. doi:10.1111/j.1567-1364.2006.00051.x
    OpenUrlCrossRefPubMed
  39. ↵
    Rajasingham, R., Smith, R. M., Park, B. J., Jarvis, J. N., Govender, N. P., Chiller, T. M., … Boulware, D. R. (2017). Global burden of disease of HIV-associated cryptococcal meningitis: an updated analysis. The Lancet Infectious Diseases, 17(8), 873–881. doi:10.1016/S1473-3099(17)30243-8
    OpenUrlCrossRefPubMed
  40. ↵
    Santiago-Tirado, F. H., Onken, M. D., Cooper, J. A., Klein, R. S., & Doering, T. L. (2017). Trojan Horse Transit Contributes to Blood-Brain Barrier Crossing of a Eukaryotic Pathogen. mBio, 8(1). doi:10.1128/mBio.02183-16
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Saputo, S., Chabrier-Rosello, Y., Luca, F. C., Kumar, A., & Krysan, D. J. (2012). The RAM Network in Pathogenic Fungi. Eukaryotic Cell, 11(6), 708. doi:10.1128/EC.00044-12
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Stempinski, P. R., Zielinski, J. M., Dbouk, N. H., Huey, E. S., McCormack, E. C., Rubin, A. M., … Kozubowski, L. (2021). Genetic contribution to high temperature tolerance in Cryptococcus neoformans. Genetics, 217(1), 1–15. doi:10.1093/genetics/iyaa009
    OpenUrlCrossRef
  43. ↵
    Stovall, A. K., Knowles, C. M., Kalem, M. C., & Panepinto, J. C. (2021). A Conserved Gcn2-Gcn4 Axis Links Methionine Utilization and the Oxidative Stress Response in Cryptococcus neoformans. Front Fungal Biol, 2. doi:10.3389/ffunb.2021.640678
    OpenUrlCrossRef
  44. ↵
    Upadhya, R., Lam, W. C., Maybruck, B. T., Donlin, M. J., Chang, A. L., Kayode, S., … Lodge, J. K. (2017). A fluorogenic C. neoformans reporter strain with a robust expression of m-cherry expressed from a safe haven site in the genome. Fungal Genet Biol, 108, 13–25. doi:10.1016/j.fgb.2017.08.008
    OpenUrlCrossRef
  45. ↵
    Walton, F. J., Heitman, J., & Idnurm, A. (2006). Conserved elements of the RAM signaling pathway establish cell polarity in the basidiomycete Cryptococcus neoformans in a divergent fashion from other fungi. Molecular Biology of the Cell, 17(9), 3768–3780. doi:10.1091/mbc.e06-02-0125
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Wang, L., Tian, X., Gyawali, R., Upadhyay, S., Foyle, D., Wang, G., … Lin, X. (2014). Morphotype transition and sexual reproduction are genetically associated in a ubiquitous environmental pathogen. PLoS Pathogens, 10(6), e1004185–e1004185. doi:10.1371/journal.ppat.1004185
    OpenUrlCrossRefPubMed
  47. ↵
    Wang, L., Zhai, B., & Lin, X. (2012). The link between morphotype transition and virulence in Cryptococcus neoformans. PLoS Pathogens, 8(6), e1002765–e1002765. doi:10.1371/journal.ppat.1002765
    OpenUrlCrossRefPubMed
  48. ↵
    Wanless, A. G., Lin, Y., & Weiss, E. L. (2014). Cell morphogenesis proteins are translationally controlled through UTRs by the Ndr/LATS target Ssd1. PLOS ONE, 9(1), e85212. doi:10.1371/journal.pone.0085212
    OpenUrlCrossRefPubMed
  49. ↵
    Yang, D.-H., Jung, K.-W., Bang, S., Lee, J.-W., Song, M.-H., Floyd-Averette, A., … Bahn, Y.-S. (2017). Rewiring of Signaling Networks Modulating Thermotolerance in the Human Pathogen &lt;em&gt;Cryptococcus neoformans&lt;/em&gt. Genetics, 205(1), 201. doi:10.1534/genetics.116.190595
    OpenUrlAbstract/FREE Full Text
  50. ↵
    Zhai, B., Wozniak, K. L., Masso-Silva, J., Upadhyay, S., Hole, C., Rivera, A., … Lin, X. (2015). Development of protective inflammation and cell-mediated immunity against Cryptococcus neoformans after exposure to hyphal mutants. mBio, 6(5), e01433–01415. doi:10.1128/mBio.01433-15
    OpenUrlCrossRef
  51. ↵
    Zhai, B., Wu, C., Wang, L., Sachs, M. S., & Lin, X. (2012). The antidepressant sertraline provides a promising therapeutic option for neurotropic cryptococcal infections. Antimicrob Agents Chemother, 56(7), 3758–3766. doi:10.1128/AAC.00212-12
    OpenUrlAbstract/FREE Full Text
  52. ↵
    Zhai, B., Zhu, P., Foyle, D., Upadhyay, S., Idnurm, A., & Lin, X. (2013). Congenic strains of the filamentous form of Cryptococcus neoformans for studies of fungal morphogenesis and virulence. Infect Immun, 81(7), 2626–2637. doi:10.1128/IAI.00259-13
    OpenUrlAbstract/FREE Full Text
  53. ↵
    Zhao, Y., Lin, J., Fan, Y., & Lin, X. (2019). Life cycle of Cryptococcus neoformans. Annual Review of Microbiology, 73(1), null. doi:10.1146/annurev-micro-020518-120210
    OpenUrlCrossRef
  54. ↵
    Zhao, Y., Wang, Y., Upadhyay, S., Xue, C., & Lin, X. (2020). Activation of Meiotic Genes Mediates Ploidy Reduction during Cryptococcal Infection. Curr Biol, 30(8), 1387–1396 e1385. doi:10.1016/j.cub.2020.01.081
    OpenUrlCrossRefPubMed
  55. ↵
    Zhu, P., Zhai, B., Lin, X., & Idnurm, A. (2013). Congenic strains for genetic analysis of virulence traits in Cryptococcus gattii. Infect Immun, 81(7), 2616–2625. doi:10.1128/IAI.00018-13
    OpenUrlAbstract/FREE Full Text

SI References

  1. 1.
    F. J. Walton, J. Heitman, A. Idnurm, Conserved elements of the RAM signaling pathway establish cell polarity in the basidiomycete Cryptococcus neoformans in a divergent fashion from other fungi. Molecular biology of the cell 17, 3768–3780 (2006).
    OpenUrlAbstract/FREE Full Text
  2. 2.
    R. S. Wakade, L. C. Ristow, M. A. Stamnes, A. Kumar, D. J. Krysan, The Ndr/LATS Kinase Cbk1 Regulates a Specific Subset of Ace2 Functions and Suppresses the Hypha-to-Yeast Transition in Candida albicans. MBio 11 (2020).
  3. 3.
    L. Kozubowski, E. F. Aboobakar, M. E. Cardenas, J. Heitman, Calcineurin colocalizes with P-bodies and stress granules during thermal stress in Cryptococcus neoformans. Eukaryot Cell 10, 1396–1402 (2011).
    OpenUrlAbstract/FREE Full Text
  4. 4.
    Y. S. Bahn, K. Kojima, G. M. Cox, J. Heitman, A unique fungal two-component system regulates stress responses, drug sensitivity, sexual development, and virulence of Cryptococcus neoformans. Mol Biol Cell 17, 3122–3135 (2006).
    OpenUrlAbstract/FREE Full Text
  5. 5.
    Y.-S. Bahn, K. Kojima, G. M. Cox, J. Heitman, Specialization of the HOG Pathway and Its Impact on Differentiation and Virulence of Cryptococcus neoformans. Molecular Biology of the Cell 16, 2285–2300 (2005).
    OpenUrlAbstract/FREE Full Text
  6. 6.
    K. T. Lee et al., Systematic functional analysis of kinases in the fungal pathogen Cryptococcus neoformans. Nat Commun 7, 12766 (2016).
    OpenUrlCrossRefPubMed
  7. 7.
    D. J. Dickinson, J. D. Ward, D. J. Reiner, B. Goldstein, Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nature methods 10, 1028–1034 (2013).
    OpenUrl
  8. 8.
    F. J. Walton, A. Idnurm, J. Heitman, Novel gene functions required for melanization of the human pathogen Cryptococcus neoformans. Mol Microbiol 57, 1381–1396 (2005).
    OpenUrlCrossRefPubMedWeb of Science
Back to top
Posted August 14, 2022.
Download PDF
Email
The RAM signaling pathway links morphology, thermotolerance, and CO2 tolerance in the global fungal pathogen Cryptococcus neoformans
Benjamin J. Chadwick, Tuyetnhu Pham, Xiaofeng Xie, Laura C. Ristow, Damian J. Krysan, Xiaorong Lin
bioRxiv 2022.08.14.503895; doi: https://doi.org/10.1101/2022.08.14.503895
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area