ABSTRACT
Both Hedgehog (Hh) signaling and target of rapamycin complex 2 (TORC2) are central, evolutionarily conserved pathways that regulate development and metabolism. In C. elegans, loss of essential TORC2 component RICTOR (rict-1) causes delayed development, shortened lifespan, reduced brood, small size, and increased fat. Here we report that knockdown of Hedgehog-related morphogen grd-1 and its Patched-related receptor ptr-11 rescues delayed development in TORC2 loss of function mutants, indicating an unexpected role for grd-1/ptr-11 in slowing developmental rate downstream of nutrient sensing pathways. Further, we implicate chronic stress transcription factor pqm-1 as a key transcriptional effector of grd-1/ptr-11 in slowing whole-organism growth. We propose that the TORC2/grd-1/ptr-11/pqm-1 signaling relay acts as a critical executor of growth to slow development when C. elegans encounters unfavorable growth conditions.
Summary statement Developmental rate in C. elegans is dramatically slowed in animals deficient in nutrient-sensitive target of rapamycin complex 2 signaling and slowing is effected by increased activity of a previously uncharacterized Hh-r/Ptr signaling relay.
INTRODUCTION
Hedgehog (Hh) morphogens are highly conserved positive regulators of development found throughout vertebrates and invertebrates (Aspöck et al., 1999; Echelard et al., 1993; Nüsslein-Volhard and Wieschaus, 1980). Extensive study in organisms such as Drosophila melanogaster has revealed a canonical pathway wherein Hh proteins bind to Patched (Ptc) allowing for shifts in gene expression via the Gli transcription factors (Ingham, 2022). However, these proteins remain relatively unexplored in the model organism Caenorhabditis elegans. In C. elegans, divergence from the canonical signaling pathway leaves some Hh proteins missing while expanding the Hh-related (Hh-r) and Patched-related (Ptr) protein families from just 5 members to over 80 members (Aspöck et al., 1999). Of these, only 14 have been mechanistically characterized and just two, wrt-10 and grl-21, have been functionally associated with Patched/Patched-related receptors (Lin and Wang, 2017; Templeman et al., 2020). From molting to reproductive aging, all of the Hh-r proteins that have been studied serve important, non-redundant roles in C. elegans. Hh-r proteins such as qua-1 are indispensable to larval transition while others such as wrt-10 govern aspects of healthspan downstream of important, conserved regulators such as CREB (Hao et al., 2006; Templeman et al., 2020).
Activity of highly conserved, nutrient-sensing, signaling pathways is integral to ensuring normal growth rate in C. elegans. For instance, reduced target of rapamycin complex 2 (TORC2) signaling has pronounced effects on both developmental rate (Jones et al., 2009; Soukas et al., 2009). Loss of function of the gene encoding the essential TORC2 subunit rictor extends time to adulthood at 20ºC from 48 hrs. to 72 hrs., reduces size, lowers brood, increases fat, and shortens lifespan (Jones et al., 2009; Soukas et al., 2009). Our previous work showed that suppression of essential dosage compensation complex (DCC) member dpy-21 downstream of the TORC2 effector kinase serum- and glucocorticoid-induced kinase 1 (SGK-1) was sufficient to rescue the delayed development, reduced brood, and increased fat of rict-1 mutants – but not their reduced body size and shortened lifespan – via action of histone methyltransferases SET-1 and SET-4 (Webster et al., 2013). However, the spectrum of effectors of TORC2 governance over developmental rate and healthy growth remain incompletely characterized.
In this study, we identify a grd-1/ptr-11 signaling relay that negatively regulates development downstream of TORC2. We find that, like many other Hh-r proteins, grd-1 expression is animated during molting transitions, and, surprisingly, grd-1 knockdown by RNAi leads to developmental acceleration in wild type animals. Further, grd-1 knockdown significantly rescues TORC2 mutants’ slowed development and TORC2 signaling likely modulates grd-1 activity rather than expression. We also identify ptr-11 as a likely recipient of grd-1 signaling. ptr-11 knockdown phenocopies the ability of grd-1 knockdown to accelerate growth in wild type animals and to restore normal growth rate in TORC2 mutants. Importantly, augmented grd-1 expression is sufficient to delay development, and ptr-11 knockdown significantly rescues the delayed development of grd-1 overexpressor animals. Finally, we identify pqm-1 as a potential effector of the grd-1/ptr-11 signaling cascade. pqm-1 knockdown partially phenocopies grd-1/ptr-11 knockdown and pqm-1 target genes are upregulated in TORC2 loss of function mutants in a manner dependent upon both grd-1 and ptr-11. In aggregate, we propose a TORC2/SGK-1/GRD-1/PTR-11/PQM-1 signaling relay as the effector arm by which TORC2 slows development in response to unfavorable environmental conditions in C. elegans.
MATERIALS AND METHODS
Strains and maintenance
C. elegans animals were grown and maintained at 20°C on Nematode Growth Media (NGM) seeded with Escherichia coli OP50-1 as previously described (Soukas et al., 2009). The following strains were used: wild type N2 (Bristol), MGH266 rict-1(mg451), MGH300 sgk-1(mg455), CB1370 daf-2(e1370), DA465 eat-2(ad465), VC222 raga-1(ok386), MGH9 rsks-1(ok1255), MGH27 rict-1(mg451);sgk-1(mg455), MGH35 sinh-1(mg452), MGH629 ptr-11::GFP::AID*::3xFLAG::ptr-11 3’UTR, MGH531 grd-1p::grd-1g::grd-1 3’UTR, MGH563 grd-1p::GFP, SYS573 pqm-1p::GFP::pqm-1, and MGH618 rict-1(mg451);pqm-1p::GFP::pqm-1.
Animals were synchronized by hypochlorite bleach treatment of a population of gravid adults. Animals were collected in M9 medium, centrifuged at 4400 rpm for 1 minute and resuspended in 6 mL 1.3% bleach, 250 mM NaOH for 1 minute of vigorous shaking. Bleach solution exposure and shaking step was repeated after one wash in M9. After the second bleach step, pellet was resuspended in minimal M9 by gentle pipetting, and washed in M9 four times. Eggs were resuspended in 12 mL M9, and solution was left to rotate overnight for 23 hours at 20°C.
RNA interference (RNAi)
RNAi plates were prepared with standard NGM media mixed with 5 mM isopropyl-B-D-thiogalactopyranoside and 200 ug/mL carbenicillin. All RNAi clones were isolated from the genome wide E. coli HT115 Ahringer library (Horizon Discovery) and sequence verified before use. RNAi clones were obtained by seeding onto ampicillin/tetracycline treated Luria Broth (LB) plates. RNAi clones were grown overnight at 37°C with shaking for 18 hours in LB with 200 ug/mL carbenicillin. Cultures were spun down at 4400 rpm for 15 minutes, pellets resuspended in one tenth starting LB volume and dispensed onto RNAi plates no more than 48 hours prior to adding worms.
Developmental timing assays
Synchronized L1 animals prepared as described above were dropped onto RNAi plates with vector RNAi control or RNAi directed against the gene of interest at 20°C. Time to adulthood was measuring by evaluating the appearance of the vulvar slit in hermaphrodite animals. Two to three biological replicates were performed for all conditions and data is available in supplementary Table S1.
Developmental screening was performed by evaluating relative proportion of wild type adults on treatment RNAi as compared to vector RNAi at 49 hours. Three biological replicates were pooled for analysis.
Brood size assay
Synchronized L1 animals were dropped onto RNAi plates with the appropriate RNAi clone. After having reached young adult (YA) stage, two hermaphrodites were transferred onto five plates with the corresponding RNAi clone for a total of ten adults per condition. Adults were transferred every day for five days. Brood was measured as the total amount of progeny on the plates after three days at 20°C.
Body fat mass measurement
At day one of adulthood, synchronous animals were collected in M9, washed once, centrifuged at 500 rpm for 1 minute, and resuspended in 40% isopropanol for 3 minutes. Fixed worms were then stained with 3 ug/mL Nile red in 40% isopropanol for 2 hours. Animals were collected in M9 supplemented with 0.01% Triton-X100, mounted on glass slides, and imaged in the GFP channel for 10 ms at 5x magnification (Pino et al., 2013). Body fat mass was measured as the fluorescence intensity relative to body area in pixels using ImageJ.
Body size measurement
Adult day one animals were mounted on 2% agarose pads in 2.5 mM levamisole and imaged by brightfield microscopy at 2.5x. Body area was determined in pixels using ImageJ.
Longevity assay
Synchronous L1 animals were dropped onto the appropriate RNAi clones and allowed to grow to L4/YA stage. 40-60 worms were then transferred to four plates with the corresponding RNAi clone supplemented with 10-50 uM 5-fluorodeoxyuridine (FUDR) for a total of ∼200 adults per condition. Animals were scored as dead or alive by movement or response to gentle prodding every other day. Data were analyzed using OASIS2 software package (https://sbi.postech.ac.kr/oasis2/).
Quantitative RT-PCR
Worms were collected in TRIzol Reagent (Invitrogen), flash frozen in liquid nitrogen, and stored at -80°C prior to RNA isolation. Samples were lysed using metal beads and the Tissuelyser I system (Qiagen).
RNA was isolated from lysate using Direct-zol RNA Miniprep kit (Zymo). cDNA samples were synthesized with the QuantiTect reverse transcription kit (Qiagen). Quantitative RT-PCR was performed with the QuantiTect SYBR Green RT-PCR kit (Qiagen) in a Bio-Rad CFX96 RT-PCR thermocycler. Fold changes were determined via the 2-Δ Δ Ct method as previously described (Livak and Schmittgen, 2001). Primers used:
mlt-10 F: GGCCTTGGCAGCCGTAAC
mlt-10 R: TAAGCTCCACGGATGAGGTC
grd-1 F: CCGCTCTGCTGATATAAACCACG
grd-1 R: TCATCGCAACATTCTACCGT
ptr-11 F: AGCCGCCTATCCGGTTTATT
ptr-11 R: GACACGGGTTTCATATCCAGC
C49G7.7 F: CGGAGATCGGGAAACCCTTT
C49G7.7 R: GGGCGGCAAGGAAAGTTAAA
F18E3.12 F: CAATTTCCACCACACCAGCC
F18E3.12 R: TGAGCGCAGTTGAAATCGTTG
ugt-43 F: AGTTACCGGTCATTCTCATTTAAAGTT
ugt-43 R: TGAGTGGTAAGAGAAGAGTCACA
C15B12.8 F: TTGTGACGATCCCAGGAAGC
C15B12.8 R: GTCCGGGGAGTTGGTGTATT
F33H12.7 F: TGGATTTTTGGAACACAAACGA
F33H12.7 R: CGCACCGGAAAGGTCTACTT
str-7 F: ACGCGTTTTTCGGTTTTATCCT
str-7 R: GAGGTGGAGGAACGTGTGAA
Microscopy
All imaging unless otherwise specified was performed by mounting worms on 2% agarose pads in 2.5 mM levamisole using the Leica THUNDER Imager system. Imaging was performed within 5 minutes of sample preparation. Binning measurements were done with a minimum population of 10 worms per replicate. grd-1p::GFP activation was defined as intestinal expression.
Molting midpoint analysis
The molting midpoints were defined as the times at which ∼50% of the worm population is molting and were determined as the midpoint between two minima in mlt-10 expression as shown previously (McCulloch and Rougvie, 2014).
Statistical analysis
All statistical analyses and representations were performed in either Prism 9 (Graphpad) or Bioconductor (R). LogEC50 for developmental curves was determined by fitting a variable slope sigmoidal dose-response curve to each curve. The difference between the vector and grd-1 RNAi curves was calculated by percent difference between the logEC50 of each curve.
RNA sequencing analysis
L3 animals treated with empty vector (EV) control or grd-1 RNAi (grd-1) were collected in paired, biologically independent triplicate experiments. RNA was collected and purified in the same way as described above for qRT-PCR. Total purified RNA samples were sent to Azenta (Genewiz) for quality control, library preparation, and mRNA sequencing. Samples were first verified for RNA integrity scores greater than 8 using an Agilent Tapestation 4200. Illumina library preparation was performed using polyA selection for mRNA species. Approximately 20 million paired-end, 150 base pair reads were obtained per sample.
Read filtering and quasi-alignment were performed using custom UNIX/bash shell scripts on the Mass General Brigham ERISOne Scientific Computing Linux Cluster. Reads were analyzed for quality control using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and MultiQC (Ewels et al., 2016), and filtered for adapter contamination, truncated short reads, or low-quality bases using BBDuk (Grigoriev et al., 2012). Trimmed, cleaned reads were then quantified against the C. elegans reference transcriptome annotation (WBcel235, Ensembl Release 105) using Salmon, correcting for sequencing and GC content bias using the command parameters “--seqBias” and “—gcBias”, respectively (Cunningham et al., 2022; Patro et al., 2017).
All statistical analysis and visualizations were performed using the R (https://www.r-project.org) Bioconductor (http://www.nature.com/nmeth/journal/v12/n2/abs/nmeth.3252.html) environment. Quasi-aligned transcript quantification files for each sample were collapsed into gene-level count matrices using R package tximport (Soneson et al., 2015), and paired differential expression was calculated using R package DESeq2 (Love et al., 2014) with a design formula of “∼Replicate + Treatment”, where ‘Replicate’ accounts for inter-replicate batch effect variation in the paired experimental samples. Genes were considered differentially expressed with a Benjamini-Hochberg False Discovery Rate (FDR) corrected P value < 0.05 and an absolute log2 transformed fold change of 1.5 (Benjamini and Hochberg, 1995).
The top 100 genes contributing to variation in principal component 1 (PC1 – explanatory for the divergence seen between EV and grd-1 RNAi) were extracted and assessed for Gene Ontology (GO) term pathway overrepresentation using R package clusterProfiler (Wu et al., 2021). To perform transcription factor target enrichment analyses, promoter sequences 1500 bases upstream and 500 bases downstream of the transcription start site of significantly upregulated and downregulated genes were extracted using R package TxDb.Celegans.UCSC.ens11.ensGene (https://doi.org/doi:10.18129/B9.bioc.TxDb.Celegans.UCSC.ce11.ensGene). Transcription factor binding sites were retrieved from the modENCODE modMine v33 database (Contrino et al., 2012) and filtered for presence in the promoter sequences of the differentially expressed gene sets. Total binding site ratios in both upregulated and downregulated genes were tallied (defined as the number of binding sites identified for a given transcription factor divided by all transcription factor binding site identified) and visualized using Prism 9 (Graphpad). Significance of the enrichment in observed binding site ratio versus expected ratio was calculated using a two-tailed exact binomial test with a 95% confidence level using R function binom_test(), and FDR adjusted P values were obtained using R function p.adjust().
RESULTS
Knockdown of Hedgehog-related morphogen grd-1 unexpectedly accelerates C. elegans development
Knockdown of Hh-r proteins in C. elegans has been reported to prompt developmental delay, arrest, or defects (Cohen et al., 2021; Hao et al., 2006; Zugasti et al., 2005). Besides high-level transcriptional analyses, the Groundhog (GRD) family is absent from previous investigations into Hh-r proteins, and we sought to determine whether knockdown of these proteins affects worm development (Aspöck et al., 1999). We performed a small-scale screen of grd family RNAi on larval development, finding that although grd-7 knockdown does slow larval development, grd-1 knockdown accelerates development (Fig. 1A-B; Table S1). We confirmed that the Ahringer RNAi clone reduces grd-1 transcript levels by ∼90% (Fig. S1A).
(A) We confirm that the Ahringer library grd-1 RNAi clone knocks down grd-1 (n = 3, ***P<0.001 by two-tailed Student’s T-test).
(A) Developmental screening of grd family members reveals that grd-1 RNAi uniquely and unexpectedly accelerates wild type C. elegans development (n = 3, **P<0.05 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Note that vector control = 1. (B) Developmental rate in wild type animals is accelerated by 2 hours on grd-1 RNAi (n ≥ 100, ****P<0.0001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data in biological triplicate in supplementary Table S1. (C) Measurement of mRNA transcript levels for grd-1 and mlt-10 from 9 hours to 39 hours reveals that grd-1 is expressed cyclically with molting cycles. Fold changes normalized to vector at 9 hours. Data from three replicates. (D) grd-1p::GFP animals imaged from mid L3 to adult day 1 (AD1) show intestinal GFP expression that peaks at molting midpoints of 36 and 48 hours and is totally extinguished in day one of adulthood at 72 hours (n > 20, P<0.05 by one-way ANOVA with Dunnett’s correction for multiple comparisons). Data represented as mean ± s.e.m. (E) Representative images of an L3 larval animal with intestinal, hypodermal, head neuron, and rear epithelial grd-1 expression (top panel) and a young adult (YA) exhibiting grd-1 expression in the intestine, rear epithelial cells, vulva, hypodermis, and head neurons (bottom panel). (F) GO-term enrichment analysis of the top 100 genes contributing to principal component 1 (PC1) variance in RNA-sequencing of grd-1 suppressed L3 animals shows the strongest signal for cuticle genes and other molting associated factors (n = 3, adjusted P < 0.05, see supplementary Table S2 for differentially expressed genes and top 100 most variance PC1 genes).
Previous transcriptomic profiling of C. elegans development indicates cyclical expression of grd-1 mRNA (Hendriks et al., 2014), which we confirmed via qRT-PCR (Fig. 1C). Further, a grd-1::GFP promoter reporter confirms a significant increase in grd-1 expression during the L3/L4 molt and the L4/young adult (YA) molt, specifically in the intestine (Fig. 1D). We also replicated previous reports of grd-1 expression in rectal epithelial cells (Aspöck et al., 1999) and further observe expression in other tissues including head neurons, hypodermis, intestine, and vulva (Fig. 1E).
Having determined that grd-1 is necessary for normal developmental rate in wild type animals and that it is cyclically expressed with molting, we performed an RNA sequencing analysis of grd-1 RNAi vs. vector at the L3 developmental stage in order to ascertain whether molting factors are relevant to the acceleration caused by grd-1 knockdown. Indeed, we find that analysis of the top 100 differentially expressed genes explaining the variance caused by grd-1 knockdown indicates enrichment for GO terms matching molting genes (Fig. 1F; Table S2).
C. elegans TORC2 mutant rict-1 is sensitized to grd-1 knockdown
Larval progression is gated by nutritional rheostats and heterochronic genes that tightly determine when and if the animal transitions from one larval stage to the next (Mata-Cabana et al., 2021; Moss, 2007). Based upon its developmental pattern of expression, we hypothesized that grd-1 may act downstream of major controllers of larval growth. We assessed the effect of grd-1 RNAi on the development of several mutants in growth factor/nutrient sensing pathways that manifest growth delay including daf-2(e1370) (insulin-like receptor hypomorph), eat-2(ad465) (defective pharyngeal pumping which leads to caloric restriction), raga-1(ok386) (hypomorphic defects in mTOR complex 1 signaling), rsks-1(ok1255) (S6 Kinase), and rict-1(mg451) (mTOR complex 2 loss of function) (Fig. 2A-E; Table S1). As in wild type, grd-1 RNAi accelerates all the mutants’ L1 to young adult (YA) development time by ∼2 hours, except for rict-1 mutants which matured ∼6 hours faster (Fig. 2E). Moreover, the proportional acceleration in median time to adulthood is significantly greater in rict-1 mutants subjected to grd-1 RNAi relative to acceleration seen in wild type and other mutants assessed (Fig. 2F).
(A-D) grd-1 RNAi accelerates daf-2, eat-2, raga-1, and rsks-1, mutant developmental rates by ∼2 hours, quantitatively comparable to wild type (n > 50, *P<0.05, ***P<0.001, 01, by log-rank test). (E) grd-1 RNAi accelerates rict-1 mutant development by ∼6 hours (Bonferroni P<0.0001 by log-rank test). (F) LogEC50 percent difference in hypothetical midpoint times in transition to adulthood between the vector and grd-1 RNAi developmental curves for each mutant described in (A) to (E) shows that the difference between vector and grd-1 RNAi developmental curves for rict-1 mutants is significantly greater than for wild type and other mutants tested (n ≥ 2, P<0.0001 by one-way ANOVA with Dunnett’s correction for multiple comparisons). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data represented as mean ± s.e.m. Data from a minimum of two biological replicates shown in supplementary Table S1.
grd-1 knockdown rescues slowed growth in TORC2 pathway sgk-1 and sinh-1 loss of function mutants, and grd-1 overexpression is sufficient to slow growth
Previous work has identified the serine-threonine kinase SGK-1 as a major downstream effector of TORC2 in C. elegans and Saccharomyces cerevisiae (Aronova et al., 2008; Jones et al., 2009; Webster et al., 2013; Zhou et al., 2019). sgk-1 loss-of-function mutants phenocopy rict-1 mutants’ slowed development, reduced brood, small body size, and shortened lifespan (Webster et al., 2013; Zhou et al., 2019). We therefore tested whether grd-1 suppression functions to accelerate rict-1 hypomorph development by increasing SGK-1 activity or by acting downstream of sgk-1. We find that sgk-1 mutant development on grd-1 RNAi is accelerated by ∼6 hours, similar to rict-1 mutants (Fig. 3A; Table S1). Further substantiating that grd-1 acts downstream of both rict-1 and sgk-1, grd-1 knockdown on a rict-1;sgk-1 double mutant speeds up development by ∼6 hours (Fig. 3B; Table S1). Slowed development caused by lowered TORC2 signaling in loss-of-function mutants in the essential TORC2 subunit sinh-1(Sin1) is similarly accelerated by grd-1 knockdown (Fig. 3C; Table S1). Finally, broader relevance of grd-1 to TORC2 biology is indicated by the fact that grd-1 RNAi also rescues shortened lifespan, increased fat mass, small body size, and reduced brood size of rict-1 mutants (Fig. S2A-D; Table S3) (Soukas et al., 2009).
(A) rict-1(mg451) shortened lifespan is rescued to near wild type by grd-1 RNAi (n > 100, P<0.0001 for wt vs. rict-1[vector] curves, P<0.0001 for rict-1[vector] vs. rict-1[grd-1 RNAi], P<0.05 for wt[grd-1 RNAi] vs. rict-1[grd-1 RNAi], all other curves n.s. by Bonferroni corrected log-rank test). Data in biological triplicate shown in supplementary Table S3. (B) Body fat mass, as assessed by Nile red fixative staining, is reduced by grd-1 RNAi in both wild type and rict-1(mg451) mutants (n > 15). (C) Body area is increased by grd-1 RNAi in wild type worms and in rict-1(mg451) mutants. (D) Brood size is increased by grd-1 RNAi in both wild type and rict-1(mg451) mutants (n = 5). *P<0.05, ****P<0.0001 by two-way ANOVA with Tukey’s correction for multiple comparisons. Data from three biological replicates. Data represented as mean ± s.e.m.
(A) Developmental rate of sgk-1(mg455) mutants is accelerated by ∼6 hours by grd-1 RNAi (n > 100, P<0.0001 by Bonferroni corrected log-rank test). (B) Developmental rate of rict-1(mg451);sgk-1(mg455) double mutants is accelerated by ∼6 hours by grd-1 RNAi (n > 50, P<0.0001 by Bonferroni corrected log-rank test). (C) Developmental rate of sinh-1(mg452) mutants is accelerated by ∼6 hours by grd-1 RNAi (n > 50, P<0.0001 by Bonferroni corrected log-rank test). (D) grd-1 overexpression is sufficient to slow developmental rate similar to rict-1 mutant developmental rate (n > 50, P<0.001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data in biological triplicate shown in supplementary Table S1. Note the same N2 controls are used in B and C.
As grd-1 is necessary for slowed development downstream of TORC2, this suggests that increased grd-1 activity might be sufficient to slow development. In order to test this possibility, we generated transgenic C. elegans overexpressing grd-1 under the control of its native promoter. Indeed, grd-1 overexpression is sufficient to prompt slowing of developmental rate of wild type animals to a degree similar to rict-1 mutants (Fig. 3D).
We have previously identified non-canonical activity of the dosage compensation complex (DCC) as partially necessary for developmental delay downstream of TORC2 (Webster et al., 2013). This raised the possibility that grd-1 may be acting downstream of or in concert with the DCC. However, grd-1 transcript levels are unperturbed in both rict-1 mutants and DCC subunit dpy-21 knockdown by RNAi treated animals, suggesting that grd-1 is not transcriptionally regulated by either TORC2 or the DCC during larval development (Fig. S3A-B).
(A) grd-1 mRNA levels are not significantly changed following dpy-21 knockdown in wild type animals (n = 3, n.s. = non-significant, by two-tailed Student’s t-test). (B) Intestinal grd-1 expression as measured by GFP expression is not downregulated in dpy-21 RNAi (the hypothesized direction if dpy-21 were driving increases in grd-1 in rict-1 mutants) treated animals at any timepoint. In fact, dpy-21 knockdown induces earlier induction of intestinal GFP expression in grd-1p::GFP transgenic worms as shown by an increased proportion of GFP positive worms at 28 and 32 hours (n = 2, **P<0.01, ***P<0.001, by two-way ANOVA with Tukey’s correction for multiple comparisons). (C) grd-1 transcript levels are not significantly dysregulated in rict-1(mg451) mutants (n = 5, n.s. = non-significant, by two-tailed Student’s t-test). Data represented as mean ± s.e.m.
ptr-11 knockdown rescues development in TORC2 mutants and in grd-1 overexpressors
Thus, since grd-1 is not transcriptionally regulated, we hypothesized that its activity is likely to be increased in TORC2 mutants. In order to begin to identify how what we hypothesize to be increased activity of grd-1 may be transduced, we performed a screen on Patched and Patched-related receptor (ptc and ptr, respectively) gene families to identify phenocopiers of grd-1. Of ptc and ptr family members tested by RNAi, only ptr-11 knockdown accelerates development (Fig. 4A). Indeed, treatment of rict-1 mutants, rict-1;sgk-1 double mutants, and sinh-1 mutants with ptr-11 RNAi produces quantitatively similar acceleration of growth rate as grd-1 RNAi (Fig. 4B; Fig S4A-B; Table S1), suggesting that grd-1 and ptr-11 may function in a common genetic pathway downstream of TORC2/SGK-1 signaling. Consistent with this possibility, in slow-growing grd-1 overexpressors, ptr-11 RNAi accelerates development by ∼4 hours compared to ∼1 hour in wild type animals, substantiating the notion that ptr-11 functions downstream of grd-1 (Fig. 4C; Fig. S4E; Table S1).
(A) ptr-11 RNAi accelerates development of rict-1(mg451);sgk-1(mg455) mutants by ∼6 hours (n > 50, ****P<0.0001 by Bonferroni corrected log-rank test). (B) ptr-11 knockdown accelerates development of sinh-1(mg452) mutants by ∼4 hours (n > 50, ****P<0.0001 by Bonferroni corrected log-rank test). Data available in biological triplicate in supplementary Table S1.
(A) Developmental screening of ptc/ptr family members reveals that ptr-11 RNAi also accelerates wild type C. elegans development (n = 3, *P<0.1 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Note that vector = 1. (B) ptr-11 knockdown accelerates rict-1(mg451) development by ∼5 hours (n > 50, P<0.0001 by Bonferroni corrected log-rank test). (C) ptr-11 RNAi significantly rescues slowed grd-1oe development (n > 50, P<0.0001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data in biological triplicate shown in supplementary Table S1. Note that the same wild type vector control used in (B) is used in Fig. S4A-B. (D) An endogenous ptr-11::GFP fusion shows expression in the hypodermis (where expression appears to be on the cell surface), dorsal and ventral nerve cords, neurons, and seam cells at both the L3 and L4 stages. (E) Similar to grd-1, ptr-11 mRNA expression oscillates with molting.
Using an endogenously tagged ptr-11::GFP generated by CRISPR/Cas9 genome engineering, we observe ptr-11 expression in the hypodermis, head and tail neurons, dorsal and ventral nerve cords, and seam cells at both the L3 and L4 stages (Fig. 4D). As is the case for grd-1, previous transcriptomics analyses have shown that ptr-11 oscillates in expression throughout development (Hendriks et al., 2014), which we confirmed by qRT-PCR (Fig. 4E).
pqm-1 and its target genes are dysregulated in rict-1 mutants in a grd-1 dependent manner
In order to identify potential downstream effectors of grd-1/ptr-11 signaling that mediate growth rate downstream of TORC2, we returned to our RNA sequencing results. Analysis of these data indicate that target genes of transcription factors PQM-1 and BLMP-1 are enriched following grd-1 knockdown (Fig. 5A; Table S3). Assessment of developmental rate of both wild type and rict-1 animals with pqm-1 and blmp-1 RNAi indicates that only pqm-1 knockdown accelerates development (Fig 5B; Fig S5A). From our RNA sequencing data, we identified the six pqm-1 target genes that are most decreased by grd-1 suppression and find that two of these, C49G7.7 and ugt-43, are upregulated in rict-1 loss of function mutants and confirmed to be downregulated by grd-1 RNAi by qRT-PCR (Fig. 5C). This suggests that PQM-1 activity is increased in TORC2 loss of function in a grd-1-dependent manner. In support of the conclusion that grd-1 drives PQM-1 activity, pqm-1 knockdown decreases ugt-43 expression in rict-1 mutants (Fig. S5B). Further, RNAi against ugt-43 mildly accelerates development in both wild type and rict-1 mutant animals (Fig 5D), indicating that targets of PQM-1 are indeed active in governance of developmental rate, albeit to a lesser degree than PQM-1 itself, as expected.
(A) blmp-1 RNAi does not accelerate development in either wild type or rict-1(mg451) animals (n > 50, n.s. by Bonferroni corrected log-rank test). Data available in biological duplicate in supplementary Table S1. (B) pqm-1 knockdown significantly reduces ugt-43 mRNA transcript levels in rict-1(mg451) mutants (n = 3, *P<0.05, **P<0.01 by one-way ANOVA with Dunnett’s correction for multiple comparisons). Data represented as mean±s.e.m.
(A) Analysis of the ratio of total modENCODE transcription factor binding sites for differentially regulated transcripts in grd-1 suppressed L3 animals reveals that PQM-1 and BLMP-1 are most positionally enriched (n = 3, adjusted two-tailed binomial *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). (B) pqm-1 knockdown accelerates development of wild type animals by ∼1 hour and rict-1(mg451) mutant development by ∼4 hours (n > 100, ****P<0.0001 by Bonferroni corrected log-rank test). (C) Measuring transcript levels for six genes most downregulated by grd-1 RNAi reveals that both C49G7.7 and ugt-43 are upregulated in rict-1 animals at the L3 stage and significantly downregulated by grd-1 knockdown (n = 3, **P<0.01, ****P<0.0001, by two-way ANOVA with Tukey’s correction for multiple comparisons). (D) ugt-43 knockdown accelerates wild type development by ∼1 hour and rict-1 development by ∼2 hours (n > 100, ****P<0.0001 by Bonferroni corrected log-rank test). (E) pqm-1::GFP nuclear localization in the posterior intestine is significantly increased in rict-1(mg451) mutants relative to wild type animals (n = 10, three biological replicates, ****P<0.0001 by Chi square goodness of fit test). Representative images for weak, moderate, and strong binning categories are shown on the right. (F) ugt-43 mRNA transcript levels are upregulated in both rict-1(mg451) and grd-1oe animals and downregulated by ptr-11 RNAi in both backgrounds (n = 3, *P<0.05,**P<0.01,****P<0.0001, by one-way ANOVA with Dunnett’s correction for multiple comparisons). Note ugt-43 and pqm-1 curves (B and D) are nested with the same control. Developmental data available in biological duplicate in supplementary Table S1. Data represented as mean ± s.e.m.
To further elucidate a connection between rict-1 and pqm-1, we examined endogenously tagged pqm-1::GFP nuclear localization at the L3 stage in both wild type and rict-1 loss of function mutants. PQM-1::GFP shows strong nuclear localization in rict-1 mutants vs. wild type (Fig. 5E). Using ugt-43 as a proxy of pqm-1 activity, we further show that PQM-1 is more active at the L3 stage in both rict-1 mutant and grd-1 overexpressing animals (Fig 5F). In support of a TORC2/SGK/GRD-1/PTR-11/PQM-1 signaling axis, increased PQM-1 activity read out as ugt-43 expression in TORC2/rict-1 mutants and grd-1 overexpression transgenics is dependent upon ptr-11, as knockdown abrogates increased ugt-43 mRNA levels (Fig. 5F).
DISCUSSION
Correctly integrating nutritional signals from the environment is paramount to ensuring optimal growth rate and development. Ours and others’ previous work indicates that TORC2 is critical governance of growth, reproduction, and lifespan, regulating these processes in a diet-dependent manner (Jones et al., 2009; Soukas et al., 2009). Defects in TORC2/SGK-1 signaling lead to slow growth, substantiating the important role of this complex in ensuring environmentally-appropriate organismal growth. In this report, we show that an effector arm of slowed growth downstream of TORC2 is a heretofore unappreciated grd-1/ptr-11 Hedgehog signaling cascade that relies on chronic stress transcription factor pqm-1. Based upon data presented here, we suggest that increased grd-1 activity signals through ptr-11 to slow growth by activating pqm-1 transcriptional responses. This work not only identifies a new cognate ligand-receptor pair of Hh-Ptr in grd-1/ptr-11 but is also the first indication that TORC2 and Hh signaling cooperate to control whole organismal development, growth, and metabolism.
The study of developmental timing in C. elegans has most extensively explored heterochronic genes required for correct developmental event sequencing, such as lin-4, lin-14, and let-7 (Ambros and Horvitz, 1984; Ambros and Moss, 1994; Reinhart et al., 2000). By comparison, there have been fewer dissections of the specific mechanisms controlling developmental rate in C. elegans. Many such investigations have focused on pathways controlling developmental progression in the absence of food or certain nutrients, revealing critical roles for IIS signaling, TORC1, lipid metabolism, the one-carbon cycle, and micronutrients in dauer formation and larval arrest (Baugh and Sternberg, 2006; Galles et al., 2018; Long et al., 2002; Watson et al., 2014; Watts et al., 2018). However, our understanding of the role of TORC2 signaling in development remains largely incomplete, confined to the DCC, a gut-neuronal axis linking TORC2 to TGF-β signaling, and CDC-42 induced neuronal protrusions (Alan et al., 2013; O’Donnell et al., 2018; Webster et al., 2013). Here, our results point to a mechanism by which Hh-r morphogens grd-1/ptr-11 act downstream of TORC2 to control development and growth. Although study of grd-1 and ptr-11 activity per se, is challenging, and given that neither grd-1 nor ptr-11 are regulated at the RNA or protein level downstream of TORC2, we are able to connect TORC2 inactivation to increased GRD-1 signaling by invoking downstream activity of PQM-1. Specifically, both loss of TORC2 and grd-1 overexpression lead to increased PQM-1 activity measured by target gene expression, suggesting that under conditions of lowered TORC2 signaling, activity of grd-1/ptr-11 is induced to slow development. Although we find that these Hh-r proteins function downstream of major TORC2 effector kinase SGK-1, it remains unclear how grd-1 activity is directly regulated. However, the lack of grd-1 transcriptional changes in rict-1 loss of function mutants suggests a post-transcriptional regulatory mechanism. Attempts to make an endogenously tagged mature GRD-1 protein were not successful and have proven challenging by previous reports (Aspöck et al., 1999), so additional work is needed to define the precise mechanisms of GRD-1 activation. Notably, our data do not show a transcriptional interaction between the DCC and grd-1, indicating that TORC2 likely controls development through these two arms in parallel.
C. elegans has a much-expanded family of Hedgehog morphogens that are thought to share a common ancestor with other phyla (Aspöck et al., 1999). Further, C. elegans possesses an expanded family of Patched-related receptors but lacks several canonical Hedgehog signaling components such as Smoothened and a truly orthologous Gli transcription factor (Zugasti et al., 2005). Hh-r morphogens and Ptr receptors have shared biological functions in controlling developmental progression and have been shown to interact cell non-autonomously with one another as in the case of wrt-10/ptc-1 and grl-21/ptr-24 (Lin and Wang, 2017; Templeman et al., 2020).
Here we provide just the third example of an Hh-r-Ptr pair that functions in tandem to regulate metabolism in C. elegans. Our findings complement prior reports indicating that Hh-r proteins control important parts of organismal homeostasis such as reproductive health downstream of CREB via wrt-10/ptr-2 signaling (Templeman et al., 2020). Based upon patterns of grd-1 promoter activity, we suggest that grd-1 is produced in the intestine in a cyclical fashion during molting, and that under conditions of lowered TORC2 signaling, grd-1 function is increased to put the brakes on development. When grd-1 levels are artificially increased by overexpressing the protein under its native promoter, worm development is slowed to near rict-1 hypomorph levels. Given that the intestine is both the primary tissue where grd-1 is expressed and the principal tissue of action for TORC2 in regulation of growth and metabolism (Soukas et al., 2009), it seems plausible that TORC2 controls development by modulating grd-1 activity in the intestine. However, like other Hh-r proteins, grd-1 is predicted to be an extracellular protein, suggesting a cell non-autonomous role for the morphogen. We identify ptr-11 as the likely receptor for grd-1 given that its knockdown significantly restores developmental rate in TORC2 mutants and grd-1 overexpression transgenics. Our endogenous ptr-11::GFP fusion indicates cell surface expression in several tissues including the hypodermis and seam cells, but not the intestine. Definitive determination of the respective sites of action of grd-1 and ptr-11 will require additional investigation. In aggregate, these results compellingly suggest that TORC2/SGK-1 takes stock of nutrient and growth environment status. If conditions are favorable, TORC2/SGK-1 signaling tamps down grd-1 activity. However, in response to unfavorable conditions, reduced TORC2/SGK-1 signaling increases grd-1 activity, likely in the intestine, and grd-1 executes a program delaying organismal growth by relaying the signal of unfavorable conditions to other tissues through ptr-11.
Moreover, we identify pqm-1 as a downstream effector of the grd-1/ptr-11 signaling relay. Globally, PQM-1 acts antagonistically to DAF-16 in IIS signaling mutants to regulate lifespan and development (Tepper et al., 2013). Also, PQM-1 has been previously shown to work downstream of TORC2 to mobilize fat from the intestine to the germline at the onset of adulthood (Dowen et al., 2016). Although pqm-1 loss of function mutations cause slight developmental delay (Tepper et al., 2013), larval knockdown by RNAi causes developmental acceleration that partially recapitulates grd-1/ptr-11 knockdown in both wild type animals and TORC2 hypomorphs. Using increased expression of pqm-1 target gene ugt-43 as a barometer for increased pqm-1 activity in rict-1 and grd-1oe animals, we conclude that grd-1 is activated in rict-1 mutants, which in turn activates pqm-1 to effectuate a slowing of growth in a ptr-11 dependent manner. These data strongly support our conclusion that under lowered TORC2 signaling conditions, growth is slowed by increased signaling through a grd-1/ptr-11/pqm-1 signaling relay. Definitive proof that grd-1 and ptr-11 represent a ligand-receptor pair and how ptr-11 signaling increases pqm-1 activity will require more investigation.
In summary, we define a heretofore unappreciated coordination of the TORC2 and Hedgehog pathways in a signaling axis that functions to put the brakes on development when reduced TORC2 signaling indicates unfavorable environmental conditions. Future work will focus on which aspects of the nutrient milieu are sensed by TORC2 and how changes that prompt developmental slowing are communicated through the GRD-1/PTR-11/PQM-1 signaling relay delineated herein. Better understanding of this biology will inform how organisms govern growth rate through ancient and complex communication between diverse signaling networks.
REFERENCES
