New Results

Modular small RNA drives pathogen emergence

Deepak Balasubramanian, Salvador Almagro-Moreno
doi: https://doi.org/10.1101/2023.03.17.533193

ABSTRACT

Pathogen emergence is a poorly understood complex phenomenon. To date, the molecular mechanisms that allow strains within a bacterial population to emerge as human pathogens remain mostly enigmatic. We recently uncovered that toxigenic Vibrio cholerae encode preadaptations to host colonization, what we term virulence adaptive polymorphisms (VAPs), however, the molecular mechanisms driving them are not known. ompU is a VAP-encoding gene that is associated with the production of the major outer membrane porin OmpU. Here, we show that the ompU ORF also encodes a modular small RNA overlapping its 3’ terminus that plays a major role in V. cholerae physiology. We determined that the OmpU-encoded sRNA (OueS) strongly suppresses biofilm formation, a phenotype that is essential for host intestinal colonization, via repression of iron uptake. OueS controls over 84% of the genes regulated by ToxR, a major virulence regulator, and plays an integral role during the infection process. We demonstrate that OueS is critical for intestinal colonization and its bimodular nature dictates the virulence potential of V. cholerae. Overall, our study reveals specific molecular mechanisms leading to the emergence of pathogenic traits in bacteria unveiling the hidden genetics associated with this process. We propose a scenario where a limited number of modular genes could explain the emergence of novel phenotypic traits in biological systems.

INTRODUCTION

The emergence of human pathogens is one of the most pressing public health concerns of modern times. Pathogen emergence is a complex and multifactorial phenomenon that culminates with the organism acquiring the ability to colonize and harm the human host1–3. Understanding the specific elements associated with this process is critical for successful disease management and control4. Even though recent insights have begun to elucidate some of the mechanisms and forces driving pathogen emergence, to date, the molecular pathways that facilitate certain strains within a species to emerge as pathogens remain largely unknown4–8.

Vibrio cholerae O1 is the etiological agent of the severe diarrheal disease cholera and remains a major scourge in places with limited access to clean drinking water and proper sanitation practices9,10. Following ingestion in the form of planktonic cells or as part of a biofilm, V. cholerae must survive adverse conditions such as stomach acidity, bile, or host antimicrobial peptides to colonize the small intestine11–14. Successful colonization requires stringent downregulation of biofilm formation, as it triggers a strong immune response, and upregulation of flagella-mediated motility to swim through the mucus layer towards the epithelium15–17. A complex regulatory cascade mediated by the virulence regulator ToxR facilitates adaptation to the harsh conditions within the host and, along with other regulators, the timely expression of virulence genes18–21.

ToxR is a transmembrane protein with a cytoplasmic DNA-binding domain that controls the expression of hundreds of genes19, 22–24. Among them, ToxR directly regulates the expression of the cholera toxin (CT), the source of the watery diarrhea associated with cholera, and, together with TcpP, the expression of ToxT, a master virulence regulator22, 25. ToxR also reciprocally modulates the expression of two outer membrane porins: OmpU and OmpT. Specifically, ToxR activates transcription of ompU whereas it represses ompT expression23, 26, 27. OmpU is highly expressed during the infection process of V. cholerae, making up to 60% of the outer membrane and is essential for host survival, virulence, and intestinal colonization23, 28, 29. The porin OmpU is associated with numerous virulence-related phenotypes and confers bile and anionic detergent resistance, and tolerance to organic acids and cationic peptides, such as the host derived peptide P2 and the antibiotic polymyxin B11, 12, 23, 29, 30. Beyond resistance to cell damaging agents, OmpU has also been associated with several more complex phenotypes. For instance, OmpU exerts immunomodulatory effects such as induction of host tolerance to LPS and suppression of the host immune response by inducing M1 polarization of macrophages31, 32. Furthermore, Provenzano et al. showed that a ΔompU mutant exhibits altered production of CT and TCP29. However, the mechanisms by which an outer membrane porin like OmpU can be involved in and modulate such diverse virulence-related phenotypes remain poorly understood.

Despite the presence of over 200 serogroups, only V. cholerae strains from serogroups O1 and the now extinct O139 can cause cholera in humans33–35. Strains from these two serogroups are phylogenetically related and confined to a single clade containing all toxigenic V. cholerae called the pandemic cholera group36. We previously developed a comparative genomics framework to elucidate the evolutionary origins and emergence of toxigenic V. cholerae strains37. Our analyses of environmental and clinical strains of V. cholerae identified the presence of allelic variations in core genes that circulate in non-toxigenic environmental populations and confer preadaptations to host colonization, enhancing their pandemic potential. The presence of these virulence adaptive polymorphisms (VAPs) is associated with the emergence of toxigenic strains of V. cholerae, explaining their limited distribution to specific clades37. Interestingly, we determined that ompU in toxigenic V. cholerae strains encode VAPs and some of the virulence traits associated with the porin are allelic-dependent37, 38. Furthermore, VAP-encoding environmental alleles of ompU confer phenotypes associated with clinical outcomes such as antimicrobial resistance37, 38. These phenotypes are absent from mutant strains with ompU alleles that do not encode VAPs, indicating that these adaptations to virulence are present in their genomic background prior to host colonization37, 38. Overall, our data indicates that OmpU-associated traits are dependent on the specific allele encoded by a given strain and is directly associated with the emergence of toxigenic V. cholerae. To date, the molecular mechanisms controlling these allelic-dependent phenotypes remain unaddressed.

In this study, we determined that the toxigenic allele of OmpU stringently represses biofilm formation and modulates the transcriptome of V. cholerae. We identified a novel sRNA encoded overlapping the 3’ terminus and downstream region of the ompU ORF that is responsible for this behavior, which we termed ompU-encoded sRNA (OueS). We demonstrate that OueS represses biofilm formation in toxigenic V. cholerae by repressing iron uptake mechanisms. Transcriptome analysis reveals that OueS modulates 84.85% of the ToxR virulence regulon, suggesting an integral role of OueS in V. cholerae pathogenesis. Finally, we show that OueS is critical for intestinal colonization and the modular nature of the sRNA among V. cholerae strains dictates the virulence potential of the bacterium. These findings provide major insights into the emergence of pandemic V. cholerae and reveals specific molecular mechanisms that lead to the emergence of pathogenic traits in bacteria.

RESULTS

OmpU represses biofilm formation in V. cholerae and modulates its transcriptome

OmpU plays a major role in V. cholerae pathogenesis15, 16–19, 23, nonetheless, it remains unclear how an outer membrane porin can modulate disparate critical virulence-related phenotypes. For instance, we previously demonstrated that an ompU deletion mutant in V. cholerae exhibits a 3-fold increase in biofilm formation37. To dissect this phenotype, we ectopically expressed ompU from an inducible plasmid in an in-frame isogenic ompU deletion mutant in V. cholerae C6706, an El Tor strain from the seventh cholera pandemic. Expression of ompU decreases biofilm formation in the ΔompU mutant back to wild-type (WT) levels, indicating that OmpU represses biofilm formation in V. cholerae (Fig. 1A). On the other hand, expression of an environmental ompU allele from a strain isolated from the Great Bay Estuary in New Hampshire, V. cholerae GBE111439, either ectopically or through allelic exchange in the isogenic C6706 background, does not repress biofilm formation, suggesting this phenotype is allelic-dependent (Fig. 1A)37. Interestingly, biofilm suppression is critical in the early stages of intestinal colonization as biofilm components elicit a strong immune response leading to clearance of V. cholerae strains that do not timely repress the process40. Thus, we found it fascinating and quite puzzling that expression of a porin localized in the outer membrane can suppress a phenotype that is central to the infection process.

Figure 1.
Figure 1. OmpU represses biofilm formation and modulates gene expression.

(A) Biofilm formation of V. cholerae C6706 WT, ΔompU and ΔompU strains expressing OmpUC6706 or OmpUGBE1114, either in cis or trans. n > 6. Two-tailed T-test p-value **** < 0.0001. (B) Transcriptomes of biofilm-derived cells were visualized by principal component analysis and reveal an OmpU-mediated shift in the datasets. (C) Total number of differentially regulated genes (absolute fold change 2.0; FDR p ≤ 0.01) from the transcriptomes of the wild-type C6706 were compared against mutant strains of ompU and the alternative sigma factor-encoding gene rpoE from biofilm-grown cells. Functional enrichment of the OmpU-regulated genes was performed by the Panther Overrepresentation test (GO Biological process)85, 86 to classify the OmpU-repressed (D) and activated (E) datasets.

To gain insights into the mechanisms behind this marked phenotype, we examined the transcriptional changes associated with OmpU-mediated biofilm repression. We performed RNA-Seq analyses of V. cholerae biofilms produced by WT, ΔompU and ΔompU-pOmpUC6706 strains. Our data reveals a drastic shift in the transcriptome of the ΔompU mutant strain compared to WT, with differential regulation of 270 genes of which 181 genes are repressed by OmpU and 89 are activated (absolute FC ≥ 2.0, FDR p ≤ 0.01) (Fig 1B; Table S1). Ectopic expression of ompUC6706 in the ΔompU background results in a shift of the transcriptome, closer to WT, and the recovery in expression of the dysregulated genes (Table S1). GO enrichment analysis reveals that OmpU primarily represses genes involved in iron metabolism and acquisition, specifically in vibriobactin metabolism, siderophore transport, and iron ion homeostasis (FDR p ≤ 0.05) (Fig 1D; Table S1). On the other hand, OmpU activates genes involved in the defense response mechanisms to phages and symbionts, as well as those involved in heat response and protein folding (Fig 1E).

Upon misfolding, OmpU activates the cell envelope stress response via the release of sigma factor RpoE in the cytosol41. To address the potential role of RpoE in the transcriptomic changes associated with OmpU, we examined the biofilm transcriptome of a ΔrpoE mutant strain (Fig 1C). Comparison of the transcriptome datasets of ΔompU and ΔrpoE strains, relative to WT, demonstrates that although there is overlap between the two datasets, a large percentage of the transcriptomic changes associated with ompU expression appear to be independent of RpoE activation (Fig 1C; Table S2). Specifically, OmpU modulates the expression of 270 genes during biofilm formation and 144 of those genes (53.3%) are not associated with RpoE (Fig 1C; Table S2). Overall, our data indicates that OmpU represses biofilm formation in an allele-dependent manner and has a significant impact on the V. cholerae transcriptome.

The ompU ORF encodes a small RNA

Given the large transcriptomic changes associated with OmpU extending beyond the activation of RpoE, we considered the possibility of the ompU gene coding for regulatory sequences within its ORF besides the porin. A genome-wide sRNA screening in V. cholerae indicated, among thousands of other sRNAs, potential sRNAs within the 3’ end of ompU42. To examine whether the ompU ORF encodes an internal sRNA, we performed northern blot analysis with probes targeting the 3’ termini of ompU and the 5’ termini as a control. We reasoned that a probe targeting the sRNA locus within ompU should result in two bands corresponding to both the ompU mRNA and the potential sRNA. The northern blot data shows that a probe specific for the 5’ end of the ompU ORF (674,890–675,054 ntd) results in a ∼1100 ntd band corresponding to the expected size of the mRNA transcript (Fig 2A). On the other hand, in addition to the ∼1.1 kb mRNA band, a smaller size band appears with a probe targeting the 3’ end of the ompU ORF (674,837–674,876 ntd) potentially corresponding to a sRNA (∼160 ntd) (Fig 2A).

Figure 2.
Figure 2. OmpU encodes a small RNA in its 3’ terminus.

(A) Northern blot analyses. Total RNA was obtained at the early stationary phase (OD600 ∼2.0) from the WT cells and subjected to northern blot analysis using probes specific for the 5’ and 3’ ends of the ompU ORF. 5S rRNA-specific probes were used as a loading control. (B) Schematic representation of the genomic location, coordinates, and termini of the newly identified ompU-encoded sRNA, OueS. (C) Predicted secondary structure of OueS from toxigenic strains. The 5’ region of OueS that overlaps with the ompU ORF and the 3’ region that lies immediately downstream are indicated. The stop codon of the ompU ORF is highlighted in red (D) Expression of OueS from toxigenic strain V. cholerae C6706 specifically suppresses biofilm formation. n ≥ 5. (E) Expression of OueS, visualized as a PCA plot, reveals a shift in the transcriptome similar to ectopic OmpU expression during biofilm formation. Functional gene ontology (GO) categorization of the genes (F) repressed and (G) activated by OueS during biofilm formation was performed by the Panther Overrepresentation Test85, 86. OueS represses iron uptake-related categories and activates genes involved in viral and symbiont defense. (H) Biofilm formation of strains ectopically expressing either the WT or mutant versions of OueS was examined under iron-replete (dark grey bars) and iron-depleted (white bars) conditions by exogenous addition of 100 µM FeCl3 or 100 µM 2,2’-bipyridyl, respectively, compared to normal iron conditions (light grey bars). Two-tailed T-test p values for D and H: ** < 0.001, *** < 0.0001, **** < 0.00001.

To define the 5’ and 3’ termini of the potential sRNA encoded within the ompU ORF, we performed rapid amplification of cDNA ends (RACE) assays. Given the overabundance of the ompU transcript and the overlapping nature of the mRNA and the potential sRNA, our initial 5’ RACE studies yielded only the termini of ∼1100 bp ompU mRNA transcript. To circumvent this, total RNA from LB-grown wild-type strain was size fractionated on a MOPS agarose gel and the 100-500 ntd fraction, encompassing the potential sRNA region was extracted and used as template for RACE studies. Assays on this size-fractionated RNA led to the identification of a sRNA corresponding to 166 ntds that we termed ompU-encoded small RNA (OueS) (Fig 2B). Surprisingly, 112 ntds of the sRNA lies within the 3’ terminus of the ompU ORF and 54 ntds lie downstream of the stop codon (674,939 – 674,774 on chromosome I). In silico secondary structure prediction reveal a four stem-loop structure, with the terminal stem-loop ending in a poly-U tail typical of a Rho-independent terminator43, 44 (Fig 2C). Interestingly, the ompU allele GBE1114, which does not lead to biofilm suppression, encodes a distinct allele of OueS (Fig S1). Even though the length of both alleles is 166 ntds, their predicted secondary structures drastically differ in the 5’ region encoded within the ompU ORF but is identical in the OueS region downstream of ompU suggesting a modular structure of OueS (Fig S1B, F). Overall, our results indicate that the ompU ORF in V. cholerae encodes both the OmpU porin and the 5’ terminus of a modular 166 ntd sRNA that we termed OueS.

OueS represses biofilm formation in V. cholerae

Next, we examined whether the ompU-mediated biofilm repression seen in Fig 1A is mediated by OueS. We ectopically expressed OueS in the ΔompU mutant (ΔompU-pOueS) and determined that the strain recovers the WT phenotype and displays reduced biofilm formation when compared to ΔompU (Fig 2D). This finding indicates that OueS is responsible for the ompU-mediated biofilm repression in V. cholerae (Fig 2D). To test the specificity of OueS-mediated biofilm repression, first we ectopically expressed a non-specific (NS) region outside of the OueS locus located towards the 5’ end of the ompU ORF (675,307–675,521). The NS region had no effect on biofilm formation compared to the ΔompU strain (Fig 2D). Subsequently, we planned on generating mutations within OueS to potentially nullify its effect. However, the 5’ end of OueS is encoded within the ompU ORF and thus, mutations affecting OueS could also affect the OmpU coding region. To ensure that the mutations within the sRNA do not disrupt the protein coding sequence, we took advantage of the codon wobble and mutated every third base in the OueS locus, disrupting the sRNA while preserving the OmpU amino acid sequence. Three different OueS mutants were generated: OueS 5’-mut harboring mutations exclusively in the OueS region that lies within the ompU ORF, OueS 3’-mut, with mutations only in the OueS region downstream of ompU, and OueS containing mutations across the full length of OueS, FL-mut. The mutations within OueS in all three cases disrupted their predicted secondary structures while retaining the OmpU protein coding sequence (Fig S1). Ectopic expression of either of the three OueS mutant sRNAs (OueS 5’-mut, 3’-mut and FL-mut) in the ΔompU strain do not lead to suppression of biofilm formation (Fig 2D). Furthermore, unlike the OueS allele from clinical strain C6706, ectopic expression of OueSGBE1114 does not lead to biofilm suppression either (Fig 2D). Overall, our results demonstrate that a) OueS is responsible for biofilm repression in V. cholerae, b) this phenotype is dependent on the OueS allele and c) the sRNA has a modular structure that divides its ompU-encoded 5’ end from its 3’ terminus.

OueS is responsible for ompU-dependent transcriptomic changes during biofilm formation

OmpU modifies the transcriptome of V. cholerae during biofilm formation (Fig 1B and C). We hypothesized that expression of OueS would be responsible for this altered transcriptional profile. To address this, we examined the transcriptomes of ΔompU-pOueS cells harvested from biofilms. Comparison of the biofilm transcriptomes of ΔompU-pOueS to those of the WT and ΔompU strains reveal that OueS expression restores the shift in the transcriptome similar to ectopic ompU expression (Fig 2E). We compared the differentially regulated genes (absolute FC > 2.0, FDR p ≤ 0.01) of two pairwise comparisons: WT Vs ΔompU (270 genes) and ΔompU-pOueS Vs ΔompU (267 genes). There are 132 genes (48.89%) in the overlap region whose expression is modulated by OueS, 101 of which are repressed and 31 activated (Table S3). Analysis of the expression values of these 132 genes between the two pair-wise comparisons reveals that the direction of the fold change (activation Vs repression) as well as the expression levels are identical in 131 of the 132 genes between the two groups (Pearson Correlation Coefficient = 0.9998; Table S3). GO enrichment analysis on the genes activated and repressed by OueS reveal that 63 of the 101 OueS repressed genes are enriched in the GO Biological process database and 17 of the 31 activated ones are enriched. Similar to the OmpU transcriptome, among the OueS-repressed genes there was a significant positive enrichment (FDR p < 0.05) of genes belonging to the vibriobactin biosynthetic processes and siderophore transmembrane transport (Fig 2F). Furthermore, the OueS activated genes are primarily involved in the ‘defense response to virus’ and ‘defense response to symbionts’ categories (Fig 2G). Overall, our data indicates that OueS is responsible for RpoE-independent changes in the biofilm transcriptome by OmpU.

OueS suppresses biofilm formation by repressing iron uptake

We analyzed the OueS-regulated genes for insights into the molecular basis behind the stringent biofilm repression associated with the sRNA. Iron is important for biofilm formation and OueS downregulates the expression of numerous iron uptake genes45, 46 (Fig 2F; Table S3). Next, we examined the interplay between iron availability and biofilm formation and their association with OueS. Addition of exogenous iron to the media results in increased biofilm formation across all the strains virtually negating the role of OueS in biofilm repression (Fig 2H). On the other hand, depletion of the native iron in the media using the iron chelator 2,2’-bipyridyl (100 µM), results in drastically reduced biofilm formation in all strains, closely resembling the phenotype associated with OueS production (Fig 2H). Furthermore, expression of OueS during planktonic growth does not affect growth patterns irrespective of iron levels in the media (Fig S2). Overall, our data strongly indicates that OueS suppresses biofilm formation by repressing iron uptake in V. cholerae.

OueS is associated with ToxR-mediated phenotypes

ToxR directly regulates the expression of ompU47. Consequently, next, we investigated the potential regulatory relationships between ToxR and OueS. Deletion of ToxR leads to an increase in biofilm production similar to a ΔompU mutant (Fig 3A). Ectopic expression of either the ompU ORF or OueS in the ΔtoxR strain restores biofilm repression to WT levels (Fig 3A). This OueS-mediated repression is specific as the WT phenotype could not be rescued by ectopic expression of neither the OueS 5’-, 3’- or FL-mut alleles nor the NS region within the ompU ORF (Fig 3A). Furthermore, pairwise comparisons of WT and ΔtoxR-pOueS relative to ΔtoxR reveal that 42.69% of the ToxR regulated genes in biofilms overlap with the OueS transcriptome (155 of 363 genes; FC + 2.0, FDR p ≤ 0.01; Table S6). The directionality of expression (activation Vs repression) in 149 of these 155 OueS-regulated genes (96%) is identical between the WT and ΔtoxR-pOueS strains, strongly suggesting that OueS restores a significant portion of the regulatory changes observed with the loss of ToxR function in biofilms (Table S6). Overall, these findings indicate that the ToxR-mediated biofilm repression is due to downstream OueS expression and highlight a connection between the sRNA and ToxR regulome.

Figure 3.
Figure 3. OueS acts as a functional surrogate of ToxR.

(A) Ectopic expression of OueS represses biofilm formation in a ΔtoxR mutant. n > 6. Two-tailed T-test p-value **** < 0.0001. (B-E) OueS modulates the ToxR transcriptome under virulence-inducing conditions (AKI)48, 80. (B) A ΔtoxR strain ectopically expressing OueS exhibit a similar expression profile to the WT as visualized by PCA plot. (C) Analysis of the significantly regulated genes (absolute FC 2.0; FDR p ≤ 0.01) between the datasets reveals that OueS (blue slice) modulates the expression of 84.85% (493 genes) of the ToxR virulence regulon (581 genes). These do not include ctxAB or the TCP operon. Functional enrichment analysis85, 86 of the ToxR regulome under AKI conditions reveals that several of the functional categories that are (D) repressed (red) and (E) activated (green) by ToxR are primarily modulated by OueS (dark red, D, and dark green, E).

OueS acts as a functional surrogate of ToxR

OmpU is highly expressed during the infection process and is critical for colonization11, 23, 27. Next, we examined the role of OmpU and OueS in the context of virulence-associated conditions. In order to do that, first, we analyzed the transcriptomes of the WT, ΔompU and ΔompU-pOmpU strains under virulence-inducing (AKI) conditions 48. Our analyses reveal that OmpU regulates a much larger proportion of genes under AKI conditions that during biofilm formation modulating the expression of 947 genes (560 activated and 379 repressed), compared to 270 genes (181 repressed, 89 activated) in biofilms (Table S4). Ectopic expression of OmpU in ΔompU decreases the number of differentially expressed genes to 170 from the 947 genes in ΔompU (82.04% recovery of the ΔompU transcriptome to WT levels) (Table S4). Furthermore, most of the OmpU-modulated genes under AKI conditions are RpoE-independent as only 158 of the 947 (16.68%) are shared with the RpoE regulon under AKI conditions, suggesting a much lesser role of the envelope stress response during infection (Table S4). Additionally, OueS modulates the expression of 455 of the 947 genes (48%) of the OmpU transcriptome under AKI conditions suggesting an integral role of OueS in this process (Table S5).

Subsequently, we investigated the potential relationship of OueS and ToxR under AKI conditions. Principal component analysis (PCA) of the RNA-Seq based transcriptomic data shows a change in the transcriptome of the ΔtoxR strain compared to WT (Fig 3B). Strikingly, ectopic expression of OueS in the ΔtoxR mutant (ΔtoxR-pOueS) under AKI conditions results in a drastic shift in the transcriptome closely resembling the WT (Fig 3B). To examine the extent of OueS complementation, we determined the ratio of the fold change between the ToxR and OueS regulons [(toxR/WT) / (toxR-pOueS/WT)]. Our analysis reveals that OueS modulates the expression of at least 493 of the 581 genes within the ToxR regulon (84.85%) under AKI conditions (Fig 3C; Table S7). Importantly, OueS does not modulate expression of ctxAB or the TCP operon (Fig 3C; Table S7). Finally, we performed a functional enrichment analysis of the 581 genes of the ToxR regulon to determine the specific genes that OueS regulates based on functional categories. OueS is responsible for the control of most of the ToxR-downregulated genes involved in glycolysis and translation (Fig 3D; Table S7). On the other hand, the ToxR upregulation of genes associated with chemotaxis, phosphorelay signaling as well as genes involved in nitrogen metabolism appear to be OueS-dependent (Fig 3E; Table S7). Overall, OueS acts as a functional surrogate of ToxR under virulence-inducing conditions controlling at least 84.85% of the ToxR-regulated genes.

OueS is expressed from the ompU promoter

To explore the regulation of OueS expression, first we generated mutant strains where we cloned OueS together with varying lengths of its upstream region to identify a potential promoter within ompU. We did so in 10 bp increments (P0, P10, P20, … P100) from zero bp upstream of OueS (P0) to 100 bp upstream (P100) (Fig S3). We monitored biofilm formation of these strains and found that all repress biofilm formation similar to WT, indicating that OueS does not have a native promoter within ompU but appears to be driven by the ompU promoter (PompU) (Fig S3). To verify this, we generated an ompU promoter deletion mutant. We deleted the 300 bp region immediately upstream of the ompU start codon, which encodes both the promoter and transcription start site49, generating the strain ΔPompU, which retains an intact ompU and OueS coding region. Biofilm formation in ΔPompU is similar to a ΔompU strain indicating lack of OueS expression (Fig S3). Thus, the expression of OueS is driven from PompU and not from an internal promoter, suggesting it is controlled by ToxR.

OueS is required for intestinal colonization

OueS is essential for phenotypes associated with successful host colonization such as biofilm repression and controls a large percentage of the ToxR regulon. In order to examine whether OueS plays a direct role in intestinal colonization, we performed competition assays using the infant mouse model of infection50, 51. Inducer-dependent ectopic expression of the sRNA is not feasible in animal models. However, our data demonstrates that the strain expressing OueS directly from PompU in the ΔompU background (ΔompU-PompUOueS) exhibits an identical phenotype as the strain ectopically expressing the sRNA making it suitable for in vivo intestinal colonization assays (Fig S3). We also generated isogenic mutant strains encoding the OueS variants (5’-, 3’- and FL-mut) directly driven by the ompU promoter in the ΔompU background. The competitive fitness during intestinal colonization of these strains was determined against a ΔlacZ strain37, 51, 52. Further, to determine potential differences in spatial colonization dynamics of the strains, the small intestine was separated into proximal (P), medial (M), and distal (D) sections from each infected animal51. The ability of the various mutants to colonize the intestine relative to the WT strain was calculated by determining their competitive indices (CI). As expected, ΔompU demonstrates a ∼1-log decrease in the CI across the entire length of the small intestine (CI 0.08 - 0.14; Fig 4A). Interestingly, the strain expressing OueS exhibits a CI similar to WT across the length of the intestine (CI 0.98 - 1.47) (Fig 4A). These changes in colonization are specific to OueS as strains expressing either OueS 5’-mut (CI 0.12 - 0.43), 3’-mut (CI 0.26 - 0.33) or FL-mut (P 0.16 - 0.24) are not capable of restoring WT CI (Fig 4A). Finally, the mutant with a deletion in the ompU promoter (ΔPompU) shows a decrease in CI across the different sections of the small intestine similar to the ΔompU strain (CI 0.08 - 0.11; Fig 4A). Taken together, our results reveal that OueS is essential for intestinal colonization of toxigenic V. cholerae.

Figure 4.
Figure 4. OueS is essential for intestinal colonization and the emergence of toxigenic V. cholerae.

V. cholerae strains were orogastrically inoculated in 3-5-day old CD-1 mice to perform competition assays. Strains were monitored for intestinal colonization across the proximal (P), medial (M) and distal (D) sections of the small intestine. The data is represented as competitive indices (CI). (A) Expression of the toxigenic allele of OueS is required for intestinal colonization of V. cholerae. (B) OueS alleles from environmental strains lead to differential intestinal colonization of V. cholerae isogenic mutants. n ≥ 6 per strain. p-values indicate significance compared to the WT strain, unless otherwise specified, and are calculated by 2way ANOVA in Šidák’s multiple comparisons test; * <0.01, ** < 0.001, *** < 0.0001, **** < 0.00001.

Modular heterogeneity in OueS drives emergence of toxigenic strains

Our data demonstrates that specific allelic variations of OueS are essential for virulence-associated phenotypes such as biofilm repression to emerge (Fig 2D). Recently, we examined the natural genetic variability of ompU and identified 41 alleles of the gene in over 1600 sequences analyzed38. We modeled the secondary structures of OueS from several of those representative clades and identified a diverse set of conserved OueS structures, including the one from toxigenic strains (Fig S4A). The 3’ region downstream of ompU is remarkably conserved, further corroborating the modular nature of this sRNA (Fig S4B). We constructed six isogenic mutant strains encoding different OueS alleles based on their structural diversity and examined their ability for intestinal colonization. Competition assays reveal a heterogenous colonization landscape mediated by the various OueS alleles. For instance, mutants expressing the OueS allele from the environmental strains GBE1194 and IRL0074 colonize the small intestine similar to WT (CI 1.05 – 1.61; Fig 4B). On the other hand, isogenic mutants encoding OueS from strains GBE1114, GBE0428, IRL0081, and GBE1116 exhibit a decrease in colonization (CI 0.36 – 0.54; Fig 4B). Overall, our data indicates that a) the OueS allele encoded by toxigenic strains evolved as a preadaptation to virulence since some environmental strains (e.g., GBE1194) encode alleles that also lead to successful colonization, and b) OueS is critical for the emergence of pathogenic potential in V. cholerae, as strains like GBE1114 encode alleles that lead to impaired intestinal colonization. Small RNAs modulate gene expression by direct binding to their target mRNAs53, 54. However, we did not find a direct correlation between the CI associated with a specific OueS allele and either its length (166-196 ntds) or its predicted secondary structures (Fig S4). Nonetheless, sequence variation analysis unequivocally reveals that OueS is bimodular, comprising variable ompU-encoded 5’ modules and a conserved 3’ one, the former directly contributing to the emergence of pathogenic V. cholerae from environmental populations.

DISCUSSION

Emerging and re-emerging infectious diseases pose immense health and economic risks55. To date, the evolutionary drivers that facilitate certain strains within a population to emerge as pathogens remain largely unknown. This critically hinders our ability to develop effective strategies (e.g., policies, therapeutics, vaccines, etc.) against facultative pathogens in a timely fashion. For numerous bacterial pathogens, only strains confined to a single clade have emerged as pathogens, a pattern termed clonal offshoot. Pathogens that exhibit this pattern include Vibrio parahaemolyticus, Yersinia enterocolitica, Hemophilus influenzae and Enterococcus faecalis56–59, among others. The Pandemic Cholera Group in V. cholerae represents a quintessential example of clonal offshoot36, 37, 60–63. Recently, we proposed that the presence of allelic variations in their core genome might explain the confined nature of numerous facultative bacterial pathogens, including toxigenic V. cholerae isolates37.

The gene coding for the major outer membrane protein OmpU encodes these allelic variations in the form of virulence adaptive polymorphisms and plays a critical role in pathogen emergence6. Porins are known to harbor moonlighting functions in various bacteria, including adhesion and signaling64, 65, activating host signal transduction pathways66, or modulating immune responses67. Nonetheless, there is a gap in the mechanistic understanding of how porins facilitate such diverse and complex phenotypes. In this study, we discovered that OmpU encodes a sRNA in its 3’ terminus, called OueS, that explains the disparate phenotypes associated with the porin and sheds light on its association with pathogen emergence. OueS suppresses biofilm formation by limiting iron uptake and acts as a functional surrogate of the virulence regulator ToxR (Fig 5A). sRNAs have been previously associated with diverse processes in V. cholerae including virulence regulation68–72. Interestingly, allelic variability dictates the phenotypes associated with OueS and its role during the infection process. We propose a scenario where OueS variants circulate in environmental V. cholerae populations with some determining the emergence of virulence potential. The ecological drivers affecting the selection and distribution of the ompU alleles encoding the diverse OueS variants within V. cholerae environmental gene pools remain enigmatic. Defining these will shed critical light on the fundamental forces that drive the assembly and emergence of strains with pathogenic potential in a bacterial population. Furthermore, despite the vast sequence and structural divergences between the OueS alleles, two convergent colonization phenotypes emerge from them (Fig 5B). Determining the specific mechanisms resulting in this functional convergence will provide critical insights into the molecular drivers controlling the emergence of virulence-adaptive traits in human pathogens.

Figure 5.
Figure 5. The ompU ORF encodes a modular porin and sRNA.

(A) The virulence regulator ToxR transcriptionally modulates hundreds of genes including activating the expression of the ompU ORF via PompU. The ompU ORF codes for the OmpU porin (blue) as well as the OueS sRNA (red) overlapping its 3’ terminus. OueS acts as a functional surrogate of ToxR by modulating the expression of 63% of its regulon. (B) V. cholerae encodes several alleles of ompU, which code for structurally and functionally distinct modular versions of OmpU and OueS. Modularity in the porin and sRNA dictates the emergence of differential virulence-associated phenotypes and, ultimately, host intestinal colonization.

Modularity has become a central concept in biology, stemming from the idea that biological systems are intricately linked networks that are typically divided into sets of strongly interacting modular subsystems73. Modularity spans many scales in biological systems from genes, to cells, to ecosystems and provides a cohesive mechanistic framework to explain biological complexity74–77. Recently, we determined that the porin OmpU contains modular protein domains that uniquely contribute to the emergence of antimicrobial resistance in certain alleles38. Here, we unveil a new layer in the complex modular nature of the ompU ORF and demonstrate that OueS also displays modular characteristics. OueS is a bimodular sRNA comprising of a) a variable 5’ module encoded within ompU that contributes to diversity and emergence potential and b) a highly conserved 3’ module immediately downstream from the ompU ORF with unknown specific function but critical for colonization (Fig 5B). Taken together, our results indicate that the ompU ORF encodes both a porin and a sRNA, and their modular nature enables the emergence of phenotypes essential for host colonization such as antimicrobial resistance or stringent biofilm regulation.

The wealth of information embedded within this ∼1 kb region of DNA is astonishing and suggests the presence of what we term “nested fractal compression” (NFC) of genetic information, which might be critical for the emergence of complex phenotypes. We contend this information is a) nested and fractal, as increasing the resolution within the unit ORF (nested) unveils successive layers of complexity (fractal), and b) compressed, as the overlapping of the coregulated modular porin gene with that of the modular sRNA confers a non-linear, finetuned regulation that is greater than the individual contributions of either of the two. It is tempting to think that the intricate arrangement of components within this ORF might have evolved as a modular recombinational unit that allows for the precise acquisition of different traits encoded within one quantum-like element. We propose a conceptual framework where the interactions between modular ORFs functioning as recombinational units of NFC information form hubs of robust regulatory networks driving the emergence of complex phenotypes. Overall, our findings provide mechanistic insights into the emergence of pathogenic traits in bacteria unraveling the hidden genetics associated with this process and suggest a scenario in which a limited number of modular units could explain the emergence of novel phenotypic traits and complexity in biological systems.

MATERIALS AND METHODS

Bacterial strains, media, and growth conditions

All V. cholerae strains used in this study are derivatives of the seventh pandemic El Tor biotype strain C6706, first isolated from a patient in Peru in 196178. E. coli S17 λ-pir strains harboring a chromosomally integrated RP4 plasmid and tra genes79 were used for conjugation of the deletion constructs into V. cholerae as well as for routine cloning purposes.

The following media were used for bacterial cultivation: Luria Bertani (LB) broth (10 g l-1 tryptone, 5 g l-1 yeast extract, 5 g l-1 NaCl). Biofilm assays were performed in tryptone broth (tryptone 10 g l-1, NaCl 5 g l-1). AKI broth was used for virulence-inducing conditions 48, 80 (15 g l-1 BactoTM peptone, 4 g l-1 yeast extract, 5 g l-1 NaCl, 0.03% w/v sodium bicarbonate). Plates were used at a final concentration of 1.5% agar. Where necessary, the following antibiotics or supplements were used: streptomycin 1000 µg ml-1, carbenicillin 50 µg ml-1, 2,2’-bipyridyl 100 µg ml-1, FeCl3 100 µg ml-1, 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-gal) 40 µg ml-1, and arabinose (0.01%). Reagents were procured from Sigma.

For routine culture, E. coli and V. cholerae were grown in LB broth at 37 °C with aeration (200 rpm) in a rotary shaker. Biofilm and growth curve assays were performed in 96-well flat bottom, tissue culture-treated plates (CytoOne) incubated at 37 °C.

Cloning, vectors, and strain construction

(a) In-frame deletion mutants of ompU, toxR and lacZ were constructed via homologous recombination81. Briefly, about 500 bp fragments flanking the gene of interest to be deleted were PCR amplified, cloned as BglII-NotI (upstream fragment) or NotI-EcoRI (downstream fragment) in tandem into the V. cholerae suicide vector pKAS15481, and electroporated into E. coli S17λ-pir79. E. coli strains harboring the deletion constructs were then conjugated with V. cholerae C6706, and allelic exchange was carried out with appropriate antibiotic selection, as described81. Positive clones were first screened by colony PCR and then confirmed by sequencing the deletion loci from genomic DNA using flanking primers. The ompU promoter mutant ΔPompU, was generated in a similar manner by amplifying the regions immediately flanking the 300 bp locus right before the ompU start codon, generating a deletion construct in pKAS154, followed by allelic exchange into C6706, as described above.

(b) Ectopic OueS-expressing clones and non-specific ompU locus clones were generated by PCR amplification from the appropriate genomic DNA template using specific primers listed in Table S8. The amplicons were then cloned as EcoRI-HindIII fragments into pBAD22. The OueS modular mutants were synthesized commercially (Twist Biosciences) and then cloned into pBAD22 as above. After introduction into E. coli by electroporation and sequence confirmation of the inserts, the plasmids were electroporated into the appropriate V. cholerae strains, followed by selection on carbenicillin-containing LB plates. For strains harboring the empty vector, plasmid pBAD22 was electroporated into the appropriate V. cholerae strain and selected as above. Ectopic ompU-expressing clones were generated in a similar manner.

(c) Chromosomal promoter fusions were constructed as described above for the deletion constructs. The ∼500 bp regions upstream of the ompU ORF including PompU was first cloned as a XbaI-SacI fragment into pKAS154 to generate plasmid pDBS467. Subsequently, the various OueS constructs: OueS 5’-mut, 3’-mut, FL-mut fragments (commercially synthesized; Twist Biosciences), and the various OueS alleles (amplified from the respective genomic DNA) were cloned into pDBS467 downstream of PompU as a SacI-EcoRI fragment. Allelic exchange to replace the ompU ORF was then performed as described above.

All deletion and complementation constructs in E. coli were Sanger sequenced before introduction into V. cholerae. Genomic DNA was isolated from all V. cholerae deletion and chromosomal fusion strains, and the region(s) of interest amplified using flaking primers for confirmation by Sanger sequencing.

RNA isolation and transcriptome studies

For Northern blots and RACE studies, RNA was isolated using the hot-phenol extraction method82–84. Briefly, the cell pellets harvested under appropriate growth conditions were resuspended in Solution A (0.5% SDS, 20 mM sodium acetate, 10 mM EDTA), followed immediately by the addition of 500 µL of acid-phenol:chloroform (Ambion) preheated to 65 °C and vortexed. After incubation at 65 °C for 10 minutes, the samples were centrifuged at 21,000 x g for 10 minutes and the aqueous layer reextracted twice with acid-phenol:chloroform. The aqueous phase was then extracted twice with chloroform and precipitated overnight at -80 °C with 2.5 volumes of ice-cold absolute ethanol. The total RNA was then pelleted and washed with cold 70% ethanol, pellets dried and resuspended in 100 µL RNase-free water containing 40 U murine RNase inhibitor (NEB). Following quantification by Nanodrop, 50 µg of the total RNA was DNase-treated (Ambion RNase-free DNase) following manufacturer protocols. The RNA was reextracted as above and precipitated with 1/10th volume 3M sodium acetate and absolute ethanol followed by a 70% ethanol wash. Final resuspension of the dried RNA pellets was in 50 µL of RNase-free water containing RNase inhibitor. Size fractionation for RACE studies was performed by running 10 µg of hot phenol-isolated RNA on a 1.25% MOPS agarose gel (Lonza) in 1x MOPS buffer with the Riboruler low range RNA ladder (Thermo) for size determination. Gel extraction was performed using the Zymoclean gel RNA recovery kit (Zymoresearch).

For transcriptome studies, RNA was isolated using a commercial kit (DirectZol RNA Miniprep kit, Zymo Research) following manufacturer instructions. DNase treatment, rRNA depletion, library preparation and Illumina Hi-Seq sequencing was performed at SeqCenter, LLC (Pittsburgh, PA). CLC Genomics Workbench (Qiagen) was used for transcriptome data processing. Briefly, paired Illumina reads were mapped to the El Tor reference genome (GenBank AE003852.1- Chromosome I; AE003853.1- chromosome II) using the following settings to generate the transcripts per million bases (TPM) values : mismatch cost 2, insertion / deletion cost 3, length / similarity fraction 0.8, global strand specific alignment. Subsequent pairwise analysis between two datasets of interest (absolute fold change ≥ 2.0 filtered on average expression for FDR correction ≤ 0.01) were used for downstream analysis. Functional enrichment analysis of the transcriptome data was performed by the Panther Overrepresentation Test against the Biological processes dataset of the GO Ontology Database (Released 07-01-2022)85, 86.

Biofilm assays

The ability of the strains to form biofilms on surfaces was determined using the crystal violet-based assays in 96-well polystyrene plates, optimized from published protocols87. Briefly, the strains from LB plates were grown in tryptone broth with carbenicillin for 14-16 hours at 37 °C with aeration. The cultures were then diluted 1:500 in fresh tryptone broth supplemented with carbenicillin and arabinose and 200 µL dispensed in wells of the 96-well plates. Ferric chloride (100 µM) or 2, 2’-bipyridyl (100 µM) were supplemented, as needed, before dispensing the cultures. After static incubation for 24 hours at 37 °C, the cultures were poured off and plates gently washed three times with water to remove unattached cells. The surface attached cells were then stained with 225 µL per well of crystal violet (0.1% in water) for 20 minutes at room temperature and washed thoroughly with water. The attached stain was subsequently eluted with 225 µL per well of 50% acetic acid for 15 minutes and quantified by reading the absorbance in a Tecan Sunrise plate reader at 595 nm.

To examine the effect of iron on biofilm formation, TB media was supplemented with either 100 µM FeCl3 (MP Biomedicals) for iron repletion or 100 µM 2, 2’-bipyridyl (Sigma) to deplete residual iron. Growth and processing of biofilms was performed as described above.

Northern blot assays

For northern blot assays, total RNA isolated from LB-grown cultures (OD ∼2.0) using the hot-phenol method were used. Downstream processing was performed by Tribioscience Inc. (Sunnyvale, CA). Briefly, 8 µg RNA per lane was first resolved on a 1.2% agarose gel (Lonza) and transferred for 20 hours to a nylon membrane by capillary action. Airdried membranes were then UV cross-linked (254 nm; 120mJ/cm2) and hybridized to biotin-conjugated probes using the NorthernMax-Gly system following manufacturer protocols (Invitrogen). The following 5’-biotinylated probes were synthesized commercially (IDT): ompU 5’ end (DB156: tcacttcaccgtaagtgccaccgataccagcgtag), ompU 3’ end (DB246: gtaacgtagaccgatagccagttcgtcttctgatgctact), 5S rRNA gene (DB158: ttcgtttcacttctgagttcgg). Probe detection was performed using the IRDye 800cw Streptavidin (LI-COR, Inc.) and imaged on LI-COR Odyssey digital imager.

Rapid Amplification of cDNA Ends (RACE)

The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA. Kit components were used, unless otherwise mentioned. Briefly, total RNA was separated on a 1% MOPS agarose gel and the 100-500 ntd region was gel extracted (Zymoclean Gel RNA recovery kit). This size fractionated RNA was used as the template for both 5’ and 3’ RACE studies.

For 5’ RACE, first strand cDNA synthesis was performed by random priming followed by annealing the SMARTer IIA oligonucleotide to the 5’ ends of the newly synthesized cDNA fragments. This was followed by PCR amplification using a forward primer specific to the 5’-attached oligonucleotide and a reverse primer within the ompU gene (DB196: 5’ GATTACGCCAAGCTTtcgtaacgtagaccgatagccagttcgtct 3’). The fragments were then cloned non-directionally using the A-overhangs generated during the final PCR step and electroporated into E. coli Stellar Competent cells (Clontech) and selected on carbenicillin plates. Plasmids from positive clones were then sequenced to identify the 5’ terminus of OueS. For 3’ RACE, the size-fractionated total RNA was poly-A-tailed using the E. coli Poly(A) polymerase (New England Biolabs). cDNA was then synthesized using a primer containing a complementary poly-T sequence and a 5’ overhang (DB164). The newly synthesized cDNA was then used as template for a second strand synthesis using an ompU-specific primer that binds inside the 3’ end of the ompU ORF (DB195: 5’ GATTACGCCAAGCTTccgctcttacatctcttaccagttcaatctgctag 3’). The amplicon was then purified, and PCR amplified using the 3’ ompU-specific primer and a primer targeting the 5’ overhang of the poly-T primer (DB164) used in the first step of the process. The resulting amplicons were then cloned non-directionally into vectors with a T-overhang and electroporated into E. coli. Subsequently, plasmids from positive clones were sequenced to define the 3’ terminus of OueS.

Ethics statement

Three-to-five-day-old CD-1 ® IGS mice (Strain code 022; Charles River Laboratories) of both genders were randomly selected from mixed litters for all animal experiments, in accordance with the guidelines and protocols approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Central Florida (#PROTO202000124). Infant mice were housed with the mothers, monitored under the care of full-time staff, and weaned 2 hours prior to infection.

Infant mouse competition assays

Intestinal colonization competition assays in 3-5-day-old infant mice were performed with LB-grown lacZ+ cells of the WT, deletion mutants and OueS alleles competed against an isogenic WT strain harboring a lacZ deletion, essentially as described37, 51, 52. The colonization efficiencies of the different strains in the proximal, medial, and distal portions of the small intestine harvested at ∼22 hours post infection are represented as competitive indices51. Briefly, strains were inoculated from fresh LB plates into LB broth, incubated for 12 hours at 37 °C with aeration, and diluted 1:1000 fold in fresh LB broth. The test (lacZ+) and control (lacZ-) strains were mixed 1:1 to obtain ∼106 CFU/mL. Fifty microliters of the bacterial mixture, corresponding to ∼105 CFUs, were then used to intragastrically inoculate 3-5-day-old infant mice and maintained at 30 °C for 22 hours. The exact input CFU numbers were determined by plating dilutions on LB-Sm-X-Gal plates. Approximately 22 hours post infection, the mice were euthanized, their small intestines divided into the proximal, medial, and distal sections and transferred separately into 4 mL LB-10% glycerol stored on ice. The samples were then processed for CFU by homogenizing the tissues, serially diluting in 1x PBS (pH 7.4) and plating appropriate dilutions on LB-Sm-X-Gal plates. In vitro competition experiments were performed in parallel by inoculating 50 µL of the input CFU in LB-Sm broth and incubating for 22 hours at 37 °C with aeration. Samples were then serially diluted and plated as for the in vivo samples above. Results are presented as the competitive index (CI), which is the ratio of the intestinal lacZ+ CFU (blue colonies) to lacZ- CFU (white colonies) normalized to the input CFU ratio and in vitro competition CFU ratio.

Growth Kinetics Under Iron Limitation

Overnight LB-grown cultures were diluted 1:1000 in LB broth with or without supplementation with FeCl3 (iron-replete) or 2,2’-bipyridyl (iron-deplete). 200 µL aliquots of the cultures dispensed in flat-bottom 96-well plates (tissue culture-treated, CytoOne) were then monitored for A595 every 30 minutes for 24 hours at 37 °C in a Tecan Sunrise plate reader. Each biological replicate had at least six technical replicates and the data for each condition were averaged across technical and biological replicates corrected to the baseline (LB) A595 values.

In silico analyses

The secondary structures of the WT and mutant versions and alleles of OueS were determined using mFold on the UNAFold web server (RNA Folding Form V2.3) using default parameters.

Statistical analyses

All data were analyzed for statistical significance using the two-tailed unpaired T-test on Graphpad Prism 9 (V 9.5.1), except for the transcriptome data that was analyzed within the CLC Genomics Workbench (Qiagen). Unless otherwise indicated, all experiments were performed with at least five independent biological replicates (n > 5) and the aggregate data (mean + s.d.) are shown.

AUTHOR CONTRIBUTIONS

SAM designed research. DB performed research. DB and SAM analyzed data and wrote the manuscript.

COMPETING INTEREST STATEMENT

The authors declare no competing interests.

SUPPLEMENTARY MATERIAL

Supplementary Figure 1: OueS mutants and alleles. (A) Sequence conservation of the ompU ORF encompassing the OueS 5’ locus before (WT) and after codon wobble mutations (OueS-5’ mut, OueS-3’ mut and OueS-FL mut) are shown to demonstrate an unaltered protein coding sequence. The 166 ntd OueS sequence from (B) C6706 (ΔG -40.0), (C) OueS 5’-mut (ΔG -40.7), (D) OueS 3’-mut (ΔG -24.6), and (E) OueS full length-mut (ΔG -26.5) were used to generate their predicted secondary structures on mFold (unafold.org). The structures requiring the least free energy (dG) were selected for comparison. Mutations significantly alter the structures of the OueS variants (C, D, E), compared to the WT OueSC6706 (B) from Fig 2C, shown here for comparison. (F) Predicted secondary structure of OueS from the environmental strain GBE1114 and (G) pairwise alignment with OueSC6706 highlight variations arising from sequence differences in the sRNA region within the ompU ORF, resulting in a bimodular sRNA.

Supplementary Figure 2: OueS regulates iron uptake in biofilms, but not planktonic growth. The planktonic growth patterns of the WT, ΔompU cells ectopically expressing either the unmutated or mutated versions of OueS in (A) tryptone broth and under (B) iron-replete (100 µM FeCl3) or (C) iron-depleted (100 µM 2,2’-bipyridyl) conditions. Growth patterns are similar between the strains in each condition irrespective of iron concentration.

Supplementary Figure 3: OueS is expressed from the ompU promoter. Mutant strains encoding varying lengths of the region upstream of OueS were monitored for biofilm formation. All strains repressed biofilm formation similar to the ectopic OueS expressing clone (Fig 2D), with the exception of a deletion strain for PompU. p-value: *** < 0.0001.

Supplementary Figure 4: Variation within the OueS alleles. ompU alleles were analyzed for sequence variation38 and OueS sequences were extracted from representative clades for secondary structure prediction (www.unafold.org). (A) The alleles match one of the eight predicted secondary structures. (B) Sequence alignment of the OueS loci from representative alleles underlines the variability that contributes to the secondary structure variation seen in A.

Supplementary Tables

Table S1. Differentially regulated genes by OmpU compared to wild-type C6706 and OmpU complementation from biofilm growth.

Table S2. Differentially expressed genes in biofilms in ompU and rpoE mutants compared to WT C6706.

Table S3: OueS-regulated biofilm genes obtained by comparing expression values of WT and ΔompU-pOueS biofilm grown cells to their expression in the ompU mutant.

Table S4: Differentially expressed genes in the ompU and rpoE mutants compared to WT C6706 when grown in virulence inducing AKI conditions.

Table S5: Differentially expressed 453 genes in the ompU mutant whose expression is rescued by OueS compared to WT C6706 when grown in virulence inducing AKI conditions.

Table S6: Gene expression in WT and ΔtoxR-pOueS strains from biofilm growth. Absolute fold changes (> 2.0) are relative to expression in the ΔtoxR strain.

Table S7: Overlap between the ToxR and OueS virulence regulons. Subset of the ToxR AKI regulon that comprises the OueS regulated genes (yellow highlight) identified by an absolute ratio of > 2.0 between the two datasets. Expression values are relative to the WT strain.

Table S8: Strains, vectors and primers used in this study.

ACKNOWLEDGEMENTS

This work was supported by a National Science Foundation (NSF) CAREER award (#2045671) and a Burroughs Wellcome Investigator in the Pathogenesis of Infectious Disease (#1021977) to SAM.

REFERENCES

  1. ↵
    Balasubramanian, D., Lopez-Perez, M., Grant, T. A., Ogbunugafor, C. B. & Almagro-Moreno, S. Molecular mechanisms and drivers of pathogen emergence. Trends Microbiol 30, 898–911, doi:10.1016/j.tim.2022.02.003 (2022).
    OpenUrlCrossRefPubMed
  2. Diard, M. & Hardt, W. D. Evolution of bacterial virulence. FEMS Microbiol Rev 41, 679–697, doi:10.1093/femsre/fux023 (2017).
    OpenUrlCrossRef
  3. ↵
    Martinez, J. L. Bacterial pathogens: from natural ecosystems to human hosts. Environ Microbiol 15, 325–333, doi:10.1111/j.1462-2920.2012.02837.x (2013).
    OpenUrlCrossRefWeb of Science
  4. ↵
    Bonneaud, C., Weinert, L. A. & Kuijper, B. Understanding the emergence of bacterial pathogens in novel hosts. Philos Trans R Soc Lond B Biol Sci 374, 20180328, doi:10.1098/rstb.2018.0328 (2019).
    OpenUrlCrossRef
  5. Rodriguez-Beltran, J., DelaFuente, J., Leon-Sampedro, R., MacLean, R. C. & San Millan, A. Beyond horizontal gene transfer: the role of plasmids in bacterial evolution. Nat Rev Microbiol 19, 347–359, doi:10.1038/s41579-020-00497-1 (2021).
    OpenUrlCrossRefPubMed
  6. ↵
    Penades, J. R., Chen, J., Quiles-Puchalt, N., Carpena, N. & Novick, R. P. Bacteriophage-mediated spread of bacterial virulence genes. Curr Opin Microbiol 23, 171–178, doi:10.1016/j.mib.2014.11.019 (2015).
    OpenUrlCrossRefPubMed
  7. Botelho, J. & Schulenburg, H. The Role of Integrative and Conjugative Elements in Antibiotic Resistance Evolution. Trends Microbiol 29, 8–18, doi:10.1016/j.tim.2020.05.011 (2021).
    OpenUrlCrossRef
  8. ↵
    Arnold, B. J., Huang, I. T. & Hanage, W. P. Horizontal gene transfer and adaptive evolution in bacteria. Nat Rev Microbiol 20, 206–218, doi:10.1038/s41579-021-00650-4 (2022).
    OpenUrlCrossRef
  9. ↵
    Kanungo, S., Azman, A. S., Ramamurthy, T., Deen, J. & Dutta, S. Cholera. Lancet 399, 1429–1440, doi:10.1016/S0140-6736(22)00330-0 (2022).
    OpenUrlCrossRefPubMed
  10. ↵
    Balasubramanian, D., Murcia, S., Ogbunugafor, C. B., Gavilan, R. & Almagro-Moreno, S. Cholera dynamics: lessons from an epidemic. J Med Microbiol 70, doi:10.1099/jmm.0.001298 (2021).
    OpenUrlCrossRef
  11. ↵
    Provenzano, D., Schuhmacher, D. A., Barker, J. L. & Klose, K. E. The virulence regulatory protein ToxR mediates enhanced bile resistance in Vibrio cholerae and other pathogenic Vibrio species. Infect Immun 68, 1491–1497, doi:10.1128/IAI.68.3.1491-1497.2000 (2000).
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Mathur, J. & Waldor, M. K. The Vibrio cholerae ToxR-regulated porin OmpU confers resistance to antimicrobial peptides. Infect Immun 72, 3577–3583, doi:10.1128/IAI.72.6.3577-3583.2004 (2004).
    OpenUrlAbstract/FREE Full Text
  13. Nalin, D. R. et al. Cholera, non-vibrio cholera, and stomach acid. Lancet 2, 856–859, doi:10.1016/s0140-6736(78)91568-4 (1978).
    OpenUrlCrossRefPubMedWeb of Science
  14. ↵
    Sack, G. H., Jr. et al. Gastric acidity in cholera and noncholera diarrhoea. Bull World Health Organ 47, 31–36 (1972).
    OpenUrlPubMedWeb of Science
  15. ↵
    Liu, Z. et al. Mucosal penetration primes Vibrio cholerae for host colonization by repressing quorum sensing. Proc Natl Acad Sci U S A 105, 9769–9774, doi:10.1073/pnas.0802241105 (2008).
    OpenUrlAbstract/FREE Full Text
  16. Freter, R., O’Brien, P. C. & Macsai, M. S. Role of chemotaxis in the association of motile bacteria with intestinal mucosa: in vivo studies. Infect Immun 34, 234–240, doi:10.1128/iai.34.1.234-240.1981 (1981).
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Faruque, S. M. et al. Transmissibility of cholera: in vivo-formed biofilms and their relationship to infectivity and persistence in the environment. Proc Natl Acad Sci U S A 103, 6350–6355, doi:10.1073/pnas.0601277103 (2006).
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Brown, R. C. & Taylor, R. K. Organization of tcp, acf, and toxT genes within a ToxT-dependent operon. Mol Microbiol 16, 425–439, doi:10.1111/j.1365-2958.1995.tb02408.x (1995).
    OpenUrlCrossRefPubMedWeb of Science
  19. ↵
    DiRita, V. J., Parsot, C., Jander, G. & Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc Natl Acad Sci U S A 88, 5403–5407, doi:10.1073/pnas.88.12.5403 (1991).
    OpenUrlAbstract/FREE Full Text
  20. Krukonis, E. S., Yu, R. R. & Dirita, V. J. The Vibrio cholerae ToxR/TcpP/ToxT virulence cascade: distinct roles for two membrane-localized transcriptional activators on a single promoter. Mol Microbiol 38, 67–84, doi:10.1046/j.1365-2958.2000.02111.x (2000).
    OpenUrlCrossRefPubMedWeb of Science
  21. ↵
    Murley, Y. M., Carroll, P. A., Skorupski, K., Taylor, R. K. & Calderwood, S. B. Differential transcription of the tcpPH operon confers biotype-specific control of the Vibrio cholerae ToxR virulence regulon. Infect Immun 67, 5117–5123, doi:10.1128/IAI.67.10.5117-5123.1999 (1999).
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Miller, V. L., Taylor, R. K. & Mekalanos, J. J. Cholera toxin transcriptional activator toxR is a transmembrane DNA binding protein. Cell 48, 271–279, doi:10.1016/0092-8674(87)90430-2 (1987).
    OpenUrlCrossRefPubMedWeb of Science
  23. ↵
    Provenzano, D. & Klose, K. E. Altered expression of the ToxR-regulated porins OmpU and OmpT diminishes Vibrio cholerae bile resistance, virulence factor expression, and intestinal colonization. Proc Natl Acad Sci U S A 97, 10220–10224, doi:10.1073/pnas.170219997 (2000).
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Bina, J. et al. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc Natl Acad Sci U S A 100, 2801–2806, doi:10.1073/pnas.2628026100 (2003).
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Miller, V. L. & Mekalanos, J. J. Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR. Proc Natl Acad Sci U S A 81, 3471–3475, doi:10.1073/pnas.81.11.3471 (1984).
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Miller, V. L. & Mekalanos, J. J. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170, 2575–2583, doi:10.1128/jb.170.6.2575-2583.1988 (1988).
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Wibbenmeyer, J. A., Provenzano, D., Landry, C. F., Klose, K. E. & Delcour, A. H. Vibrio cholerae OmpU and OmpT porins are differentially affected by bile. Infect Immun 70, 121–126, doi:10.1128/IAI.70.1.121-126.2002 (2002).
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Chakrabarti, S. R., Chaudhuri, K., Sen, K. & Das, J. Porins of Vibrio cholerae: purification and characterization of OmpU. J Bacteriol 178, 524–530, doi:10.1128/jb.178.2.524-530.1996 (1996).
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Provenzano, D., Lauriano, C. M. & Klose, K. E. Characterization of the role of the ToxR-modulated outer membrane porins OmpU and OmpT in Vibrio cholerae virulence. J Bacteriol 183, 3652–3662, doi:10.1128/JB.183.12.3652-3662.2001 (2001).
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Merrell, D. S., Bailey, C., Kaper, J. B. & Camilli, A. The ToxR-mediated organic acid tolerance response of Vibrio cholerae requires OmpU. J Bacteriol 183, 2746–2754, doi:10.1128/JB.183.9.2746-2754.2001 (2001).
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Sakharwade, S. C. & Mukhopadhaya, A. Vibrio cholerae porin OmpU induces LPS tolerance by attenuating TLR-mediated signaling. Mol Immunol 68, 312–324, doi:10.1016/j.molimm.2015.09.021 (2015).
    OpenUrlCrossRef
  32. ↵
    Khan, J., Sharma, P. K. & Mukhopadhaya, A. Vibrio cholerae porin OmpU mediates M1-polarization of macrophages/monocytes via TLR1/TLR2 activation. Immunobiology 220, 1199–1209, doi:10.1016/j.imbio.2015.06.009 (2015).
    OpenUrlCrossRefPubMed
  33. ↵
    Baine, W. B. et al. Epidemiology of cholera in Italy in 1973. Lancet 2, 1370–1374, doi:10.1016/s0140-6736(74)92233-8 (1974).
    OpenUrlCrossRefPubMedWeb of Science
  34. Cvjetanovic, B. & Barua, D. The seventh pandemic of cholera. Nature 239, 137–138, doi:10.1038/239137a0 (1972).
    OpenUrlCrossRefPubMed
  35. ↵
    Devault, A. M. et al. Second-pandemic strain of Vibrio cholerae from the Philadelphia cholera outbreak of 1849. N Engl J Med 370, 334–340, doi:10.1056/NEJMoa1308663 (2014).
    OpenUrlCrossRefPubMed
  36. ↵
    López-Perez, M., Grant, T. A., Haro-Moreno, J. M., Zaragoza-Solas, A. & Almagro-Moreno, S. Cluster-driven evolution and modularity uncover paths of cholera emergence. BioRxiv, doi:https://doi.org/10.1101/2022.09.26.509565 (2022).
  37. ↵
    Shapiro, B. J., Levade, I., Kovacikova, G., Taylor, R. K. & Almagro-Moreno, S. Origins of pandemic Vibrio cholerae from environmental gene pools. Nat Microbiol 2, 16240, doi:10.1038/nmicrobiol.2016.240 (2016).
    OpenUrlCrossRefPubMed
  38. ↵
    Grant, T. A., López-Pérez, M. & Almagro-Moreno, S. Allelic diversity uncovers protein domains contributing to the emergence of antimicrobial resistance. BioRxiv, doi:https://doi.org/10.1101/2022.10.24.513455 (2022).
  39. ↵
    Schuster, B. M. et al. Ecology and genetic structure of a northern temperate Vibrio cholerae population related to toxigenic isolates. Appl Environ Microbiol 77, 7568–7575, doi:10.1128/AEM.00378-11 (2011).
    OpenUrlAbstract/FREE Full Text
  40. ↵
    Hsiao, A., Liu, Z., Joelsson, A. & Zhu, J. Vibrio cholerae virulence regulator-coordinated evasion of host immunity. Proc Natl Acad Sci U S A 103, 14542–14547, doi:10.1073/pnas.0604650103 (2006).
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Mathur, J., Davis, B. M. & Waldor, M. K. Antimicrobial peptides activate the Vibrio cholerae sigmaE regulon through an OmpU-dependent signalling pathway. Mol Microbiol 63, 848–858, doi:10.1111/j.1365-2958.2006.05544.x (2007).
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Liu, J. M. et al. Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing. Nucleic Acids Res 37, e46, doi:10.1093/nar/gkp080 (2009).
    OpenUrlCrossRefPubMed
  43. ↵
    Updegrove, T. B., Zhang, A. & Storz, G. Hfq: the flexible RNA matchmaker. Curr Opin Microbiol 30, 133–138, doi:10.1016/j.mib.2016.02.003 (2016).
    OpenUrlCrossRefPubMed
  44. ↵
    Sauer, E. & Weichenrieder, O. Structural basis for RNA 3’-end recognition by Hfq. Proc Natl Acad Sci U S A 108, 13065–13070, doi:10.1073/pnas.1103420108 (2011).
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Mey, A. R., Craig, S. A. & Payne, S. M. Characterization of Vibrio cholerae RyhB: the RyhB regulon and role of ryhB in biofilm formation. Infect Immun 73, 5706–5719, doi:10.1128/IAI.73.9.5706-5719.2005 (2005).
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Gao, H. et al. Fur Represses Vibrio cholerae Biofilm Formation via Direct Regulation of vieSAB, cdgD, vpsU, and vpsA-K Transcription. Front Microbiol 11, 587159, doi:10.3389/fmicb.2020.587159 (2020).
    OpenUrlCrossRef
  47. ↵
    Crawford, J. A., Kaper, J. B. & DiRita, V. J. Analysis of ToxR-dependent transcription activation of ompU, the gene encoding a major envelope protein in Vibrio cholerae. Mol Microbiol 29, 235–246, doi:10.1046/j.1365-2958.1998.00925.x (1998).
    OpenUrlCrossRefPubMedWeb of Science
  48. ↵
    Iwanaga, M. & Yamamoto, K. New medium for the production of cholera toxin by Vibrio cholerae O1 biotype El Tor. J Clin Microbiol 22, 405–408, doi:10.1128/jcm.22.3.405-408.1985 (1985).
    OpenUrlAbstract/FREE Full Text
  49. ↵
    Sperandio, V. et al. Cloning and characterization of the gene encoding the OmpU outer membrane protein of Vibrio cholerae. Infect Immun 64, 5406–5409, doi:10.1128/iai.64.12.5406-5409.1996 (1996).
    OpenUrlAbstract/FREE Full Text
  50. ↵
    Klose, K. E. The suckling mouse model of cholera. Trends Microbiol 8, 189–191, doi:10.1016/s0966-842x(00)01721-2 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  51. ↵
    Millet, Y. A. et al. Insights into Vibrio cholerae intestinal colonization from monitoring fluorescently labeled bacteria. PLoS Pathog 10, e1004405, doi:10.1371/journal.ppat.1004405 (2014).
    OpenUrlCrossRefPubMed
  52. ↵
    Matson, J. S. Infant Mouse Model of Vibrio cholerae Infection and Colonization. Methods Mol Biol 1839, 147–152, doi:10.1007/978-1-4939-8685-9_13 (2018).
    OpenUrlCrossRef
  53. ↵
    Bardill, J. P. & Hammer, B. K. Non-coding sRNAs regulate virulence in the bacterial pathogen Vibrio cholerae. RNA Biol 9, 392–401, doi:10.4161/rna.19975 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  54. ↵
    Perez-Reytor, D. et al. Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios. Front Microbiol 7, 2160, doi:10.3389/fmicb.2016.02160 (2016).
    OpenUrlCrossRef
  55. ↵
    Bloom, D. E., Black, S. & Rappuoli, R. Emerging infectious diseases: A proactive approach. Proc Natl Acad Sci U S A 114, 4055–4059, doi:10.1073/pnas.1701410114 (2017).
    OpenUrlAbstract/FREE Full Text
  56. ↵
    Delor, I., Kaeckenbeeck, A., Wauters, G. & Cornelis, G. R. Nucleotide sequence of yst, the Yersinia enterocolitica gene encoding the heat-stable enterotoxin, and prevalence of the gene among pathogenic and nonpathogenic yersiniae. Infect Immun 58, 2983–2988, doi:10.1128/IAI.58.9.2983-2988.1990 (1990).
    OpenUrlAbstract/FREE Full Text
  57. Espejo, R. T., Garcia, K. & Plaza, N. Insight Into the origin and evolution of the Vibrio parahaemolyticus pandemic strain. Front Microbiol 8, 1397, doi:10.3389/fmicb.2017.01397 (2017).
    OpenUrlCrossRef
  58. Galloway-Pena, J., Roh, J. H., Latorre, M., Qin, X. & Murray, B. E. Genomic and SNP analyses demonstrate a distant separation of the hospital and community-associated clades of Enterococcus faecium. PLoS One 7, e30187, doi:10.1371/journal.pone.0030187 (2012).
    OpenUrlCrossRefPubMed
  59. ↵
    Meats, E. et al. Characterization of encapsulated and noncapsulated Haemophilus influenzae and determination of phylogenetic relationships by multilocus sequence typing. J Clin Microbiol 41, 1623–1636, doi:10.1128/jcm.41.4.1623-1636.2003 (2003).
    OpenUrlAbstract/FREE Full Text
  60. Domman, D. et al. Integrated view of Vibrio cholerae in the Americas. Science 358, 789–793, doi:10.1126/science.aao2136 (2017).
    OpenUrlAbstract/FREE Full Text
  61. Islam, M. T., Alam, M. & Boucher, Y. Emergence, ecology and dispersal of the pandemic generating Vibrio cholerae lineage. Int Microbiol 20, 106–115, doi:10.2436/20.1501.01.291 (2017).
    OpenUrlCrossRefPubMed
  62. Mutreja, A. et al. Evidence for several waves of global transmission in the seventh cholera pandemic. Nature 477, 462–465, doi:10.1038/nature10392 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  63. ↵
    Orata, F. D., Keim, P. S. & Boucher, Y. The 2010 cholera outbreak in Haiti: how science solved a controversy. PLoS Pathog 10, e1003967, doi:10.1371/journal.ppat.1003967 (2014).
    OpenUrlCrossRefPubMed
  64. ↵
    Bernardini, M. L., Sanna, M. G., Fontaine, A. & Sansonetti, P. J. OmpC is involved in invasion of epithelial cells by Shigella flexneri. Infect Immun 61, 3625–3635, doi:10.1128/iai.61.9.3625-3635.1993 (1993).
    OpenUrlAbstract/FREE Full Text
  65. ↵
    Chevalier, S. et al. Structure, function and regulation of Pseudomonas aeruginosa porins. FEMS Microbiol Rev 41, 698–722, doi:10.1093/femsre/fux020 (2017).
    OpenUrlCrossRefPubMed
  66. ↵
    Galdiero, M. et al. Porins from Salmonella enterica serovar Typhimurium activate the transcription factors activating protein 1 and NF-kappaB through the Raf-1-mitogen-activated protein kinase cascade. Infect Immun 70, 558–568, doi:10.1128/IAI.70.2.558-568.2002 (2002).
    OpenUrlAbstract/FREE Full Text
  67. ↵
    Devoy, A. F., Dyet, K. H. & Martin, D. R. Stability of PorA during a meningococcal disease epidemic. J Clin Microbiol 43, 832–837, doi:10.1128/JCM.43.2.832-837.2005 (2005).
    OpenUrlAbstract/FREE Full Text
  68. ↵
    Papenfort, K., Forstner, K. U., Cong, J. P., Sharma, C. M. & Bassler, B. L. Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation. Proc Natl Acad Sci U S A 112, E766–775, doi:10.1073/pnas.1500203112 (2015).
    OpenUrlAbstract/FREE Full Text
  69. Rutherford, S. T., van Kessel, J. C., Shao, Y. & Bassler, B. L. AphA and LuxR/HapR reciprocally control quorum sensing in vibrios. Genes Dev 25, 397–408, doi:10.1101/gad.2015011 (2011).
    OpenUrlAbstract/FREE Full Text
  70. Shao, Y. & Bassler, B. L. Quorum regulatory small RNAs repress type VI secretion in Vibrio cholerae. Mol Microbiol 92, 921–930, doi:10.1111/mmi.12599 (2014).
    OpenUrlCrossRefPubMed
  71. Davies, B. W., Bogard, R. W., Young, T. S. & Mekalanos, J. J. Coordinated regulation of accessory genetic elements produces cyclic di-nucleotides for V. cholerae virulence. Cell 149, 358–370, doi:10.1016/j.cell.2012.01.053 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  72. ↵
    Weber, G. G., Kortmann, J., Narberhaus, F. & Klose, K. E. RNA thermometer controls temperature-dependent virulence factor expression in Vibrio cholerae. Proc Natl Acad Sci U S A 111, 14241–14246, doi:10.1073/pnas.1411570111 (2014).
    OpenUrlAbstract/FREE Full Text
  73. ↵
    Hatleberg, W. L. & Hinman, V. F. Modularity and hierarchy in biological systems: Using gene regulatory networks to understand evolutionary change. Curr Top Dev Biol 141, 39–73, doi:10.1016/bs.ctdb.2020.11.004 (2021).
    OpenUrlCrossRef
  74. ↵
    Litvin, O., Causton, H. C., Chen, B. J. & Pe’er, D. Modularity and interactions in the genetics of gene expression. Proc Natl Acad Sci U S A 106, 6441–6446, doi:10.1073/pnas.0810208106 (2009).
    OpenUrlAbstract/FREE Full Text
  75. Hartwell, L. H., Hopfield, J. J., Leibler, S. & Murray, A. W. From molecular to modular cell biology. Nature 402, C47–52, doi:10.1038/35011540 (1999).
    OpenUrlCrossRefPubMedWeb of Science
  76. Montoya, J. M., Pimm, S. L. & Sole, R. V. Ecological networks and their fragility. Nature 442, 259–264, doi:10.1038/nature04927 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  77. ↵
    Krause, A. E., Frank, K. A., Mason, D. M., Ulanowicz, R. E. & Taylor, W. W. Compartments revealed in food-web structure. Nature 426, 282–285, doi:10.1038/nature02115 (2003).
    OpenUrlCrossRefPubMedWeb of Science
  78. ↵
    Thelin, K. H. & Taylor, R. K. Toxin-coregulated pilus, but not mannose-sensitive hemagglutinin, is required for colonization by Vibrio cholerae O1 El Tor biotype and O139 strains. Infect Immun 64, 2853–2856, doi:10.1128/iai.64.7.2853-2856.1996 (1996).
    OpenUrlAbstract/FREE Full Text
  79. ↵
    Strand, T. A., Lale, R., Degnes, K. F., Lando, M. & Valla, S. A new and improved host-independent plasmid system for RK2-based conjugal transfer. PLoS One 9, e90372, doi:10.1371/journal.pone.0090372 (2014).
    OpenUrlCrossRefPubMed
  80. ↵
    Iwanaga, M. et al. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol Immunol 30, 1075–1083, doi:10.1111/j.1348-0421.1986.tb03037.x (1986).
    OpenUrlCrossRefPubMedWeb of Science
  81. ↵
    Skorupski, K. & Taylor, R. K. Positive selection vectors for allelic exchange. Gene 169, 47–52, doi:10.1016/0378-1119(95)00793-8 (1996).
    OpenUrlCrossRefPubMedWeb of Science
  82. ↵
    Rio, D. C., Ares, M., Jr., Hannon, G. J. & Nilsen, T. W. Purification of RNA by SDS solubilization and phenol extraction. Cold Spring Harb Protoc 2010, pdb prot5438, doi:10.1101/pdb.prot5438 (2010).
    OpenUrlAbstract/FREE Full Text
  83. Rio, D. C., Ares, M., Jr., Hannon, G. J. & Nilsen, T. W. Removal of DNA from RNA. Cold Spring Harb Protoc 2010, pdb prot5443, doi:10.1101/pdb.prot5443 (2010).
    OpenUrlAbstract/FREE Full Text
  84. ↵
    Rio, D. C., Ares, M., Jr., Hannon, G. J. & Nilsen, T. W. Ethanol precipitation of RNA and the use of carriers. Cold Spring Harb Protoc 2010, pdb prot5440, doi:10.1101/pdb.prot5440 (2010).
    OpenUrlAbstract/FREE Full Text
  85. ↵
    Mi, H. et al. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat Protoc 14, 703–721, doi:10.1038/s41596-019-0128-8 (2019).
    OpenUrlCrossRefPubMed
  86. ↵
    Thomas, P. D. et al. PANTHER: Making genome-scale phylogenetics accessible to all. Protein Sci 31, 8–22, doi:10.1002/pro.4218 (2022).
    OpenUrlCrossRefPubMed
  87. ↵
    O’Toole, G. A. Microtiter dish biofilm formation assay. J Vis Exp, doi:10.3791/2437 (2011).
    OpenUrlCrossRefPubMed
Back to top
Posted March 18, 2023.
Download PDF

Supplementary Material

Email
Modular small RNA drives pathogen emergence
Deepak Balasubramanian, Salvador Almagro-Moreno
bioRxiv 2023.03.17.533193; doi: https://doi.org/10.1101/2023.03.17.533193
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area