New Results

Atoh1 is required for the formation of lateral line electroreceptors and hair cells, whereas Foxg1 represses an electrosensory fate

Martin Minařík, Alexander S. Campbell, Roman Franěk, Michaela Vazačová, Miloš Havelka, David Gela, Martin Pšenička, Clare V. H. Baker
doi: https://doi.org/10.1101/2023.04.15.537030

Abstract

In electroreceptive jawed fishes and amphibians, individual lateral line placodes form lines of neuromasts on the head containing mechanosensory hair cells, flanked by fields of ampullary organs containing electroreceptors - modified hair cells that respond to weak electric fields. Extensively shared gene expression between neuromasts and ampullary organs suggests that conserved molecular mechanisms are involved in their development, but a few transcription factor genes are restricted either to the developing electrosensory or mechanosensory lateral line. Here, we used CRISPR/Cas9-mediated mutagenesis in F0-injected sterlet embryos (Acipenser ruthenus, a sturgeon) to test the function of three such genes. We found that the ‘hair cell’ transcription factor gene Atoh1 is required for both hair cell and electroreceptor differentiation in sterlet, and for Pou4f3 and Gfi1 expression in both neuromasts and ampullary organs. These data support the conservation of developmental mechanisms between hair cells and electroreceptors. Targeting ampullary organ-restricted Neurod4 did not yield any phenotype, potentially owing to redundancy with other Neurod genes that we found to be expressed in sterlet ampullary organs. After targeting mechanosensory-restricted Foxg1, ampullary organs formed within neuromast lines, suggesting that Foxg1 normally represses their development. We speculate that electrosensory organs may be the ‘default’ fate of lateral line primordia in electroreceptive vertebrates.

Introduction

Mechanosensory hair cells in different compartments of the inner ear transduce fluid movements for hearing and balance (Moser et al., 2020; Caprara and Peng, 2022; Mukhopadhyay and Pangrsic, 2022). In fishes and aquatic-stage amphibians, hair cells are also found in lateral line neuromasts in the skin, which are stimulated by local water movement (Mogdans, 2019; Webb, 2021). Supporting cells in neuromasts differentiate into hair cells for homeostasis and repair (Kniss et al., 2016; Lush et al., 2019) and neuromasts are easily accessible in lines over the head and trunk, making the zebrafish lateral line an excellent model for hair cell development and regeneration (Kniss et al., 2016; Nicolson, 2017; Pickett and Raible, 2019).

The lateral line system of zebrafish (a cyprinid teleost) is purely mechanosensory, as is the lateral line system of the other main anamniote lab model, the frog Xenopus. However, in many other vertebrates, the lateral line system also has an electrosensory division (Bullock et al., 1983; Baker et al., 2013; Crampton, 2019). In electroreceptive non-teleost jawed vertebrates, some or all of the neuromast lines on the head are flanked by fields of ampullary organs containing electroreceptors, which respond to weak cathodal stimuli such as the electric fields surrounding other animals in water (Bodznick and Montgomery, 2005; Crampton, 2019; Leitch and Julius, 2019; Chagnaud et al., 2021). Electroreception is mediated by voltage-gated calcium channels in the apical membrane (Bodznick and Montgomery, 2005; Leitch and Julius, 2019). The voltage sensor was recently identified in cartilaginous fishes as the L-type voltage-gated calcium channel Cav1.3 (Bellono et al., 2017; Bellono et al., 2018), whose pore-forming alpha subunit is encoded by Cacna1d. Cav1.3 is also required for synaptic transmission at hair-cell ribbon synapses (Moser et al., 2020; Mukhopadhyay and Pangrsic, 2022).

Electroreceptors, like hair cells, have an apical primary cilium and basolateral ribbon synapses with lateral line afferents (Jørgensen, 2005; Baker, 2019). However, in contrast to the highly ordered, stepped array of apical microvilli (’stereocilia’) that forms the ‘hair bundle’ critical for hair-cell mechanotransduction (Caprara and Peng, 2022), electroreceptors in many species (e.g., cartilaginous fishes; ray-finned paddlefishes and sturgeons) lack apical microvilli altogether (Jørgensen, 2005; Baker, 2019). Electroreceptors in other species have a few apical microvilli, while the electroreceptors of the amphibian axolotl have around 200 microvilli surrounding an eccentrically positioned primary cilium (Jørgensen, 2005; Baker, 2019). Indeed, axolotl electroreceptors were described as "remarkably similar to immature hair cells" (Northcutt et al., 1994). Thus, despite their shared function, the apical surface of electroreceptors (where voltage-sensing occurs; Bodznick and Montgomery, 2005; Leitch and Julius, 2019) varies considerably across different vertebrate groups.

Fate-mapping experiments have shown that neuromasts, ampullary organs (where present) and their afferent neurons all develop from a series of pre-otic and post-otic lateral line placodes on the embryonic head (Northcutt, 1997; Piotrowski and Baker, 2014; Baker, 2019). In electroreceptive jawed vertebrates, lateral line placodes elongate to form sensory ridges that eventually fragment: neuromasts differentiate first, in a line along the centre of each ridge, and ampullary organs (if present) form later, in fields on the flanks of the ridge (Northcutt, 1997; Piotrowski and Baker, 2014; Baker, 2019). The lateral line primordia of electroreceptive vertebrates therefore provide a fascinating model for studying the formation of different sensory cell types and organs. What molecular mechanisms control the formation within the same primordium of mechanosensory neuromasts containing hair cells, versus electrosensory ampullary organs containing electroreceptors?

To gain molecular insight into electroreceptor development, we originally took a candidate-gene approach, based on genes known to be important for neuromast and/or hair cell development. This enabled us to identify a variety of genes expressed in developing ampullary organs as well as neuromasts, in embryos from the three major jawed-vertebrate groups, i.e., cartilaginous fishes (lesser-spotted catshark, Scyliorhinus canicula, and little skate, Leucoraja erinacea; O’Neill et al., 2007; Gillis et al., 2012); lobe-finned bony fishes/tetrapods (a urodele amphibian, the axolotl, Ambystoma mexicanum; Modrell and Baker, 2012); and ray-finned bony fishes (a chondrostean, the Mississippi paddlefish, Polyodon spathula; Modrell et al., 2011a; Modrell et al., 2011b; Modrell et al., 2017b). We also took an unbiased discovery approach using differential bulk RNA-seq in late-larval paddlefish, which yielded a dataset of almost 500 genes that were putatively enriched in lateral line organs (Modrell et al., 2017a). Validation by in situ hybridization of a subset of candidates from this dataset suggested that conserved molecular mechanisms were involved in hair cell and electroreceptor development, and that hair cells and electroreceptors were closely related physiologically (Modrell et al., 2017a). For example, developing ampullary organs express the key ‘hair cell’ transcription factor genes Atoh1 and Pou4f3 (see Roccio et al., 2020; Iyer and Groves, 2021), and genes essential for the function of hair cell ribbon synapses, including the voltage-gated calcium channel gene Cacna1d, encoding Cav1.3 (Modrell et al., 2017a). We also identified a handful of genes expressed in developing ampullary organs but not neuromasts, including two electroreceptor-specific voltage-gated potassium channel subunit genes (Kcna5 and Kcnab3) and a single transcription factor gene, Neurod4 (Modrell et al., 2017a).

Up to that point, we had reported the shared expression of fifteen transcription factor genes in both ampullary organs and neuromasts, but only one transcription factor gene with restricted expression, namely, electrosensory-restricted Neurod4 (Modrell et al., 2011a; Modrell et al., 2011b; Modrell et al., 2017b). More recently (preprint: Minařík et al., 2023), we used the late-larval paddlefish lateral line organ-enriched dataset (Modrell et al., 2017b), as well as a candidate gene approach, to identify 23 more transcription factor genes expressed within developing lateral line organs in paddlefish and/or in a related, more experimentally tractable chondrostean, the sterlet (Acipenser ruthenus, a small sturgeon; e.g., Chen et al., 2018; Baloch et al., 2019; Stundl et al., 2022). Twelve of these transcription factor genes - including Gfi1 - were expressed in both ampullary organs and neuromasts (preprint: Minařík et al., 2023). Thus, developing ampullary organs, as well as neuromasts, express the three ‘hair cell’ transcription factor genes - Atoh1, Pou4f3 and Gfi1 - whose co-expression is sufficient to drive postnatal mouse cochlear supporting cells to adopt a ‘hair cell-like’ fate, albeit not to form fully mature hair cells (Roccio et al., 2020; Iyer and Groves, 2021; Chen et al., 2021; Iyer et al., 2022). We also identified six novel ampullary organ-restricted transcription factor genes and the first-reported mechanosensory-restricted transcription factor genes (preprint: Minařík et al., 2023). One of the five mechanosensory-restricted transcription factor genes was Foxg1, which was expressed and maintained in the central region of sensory ridges where lines of neuromasts form, although excluded from hair cells (preprint: Minařík et al., 2023).

Here, we used CRISPR/Cas9-mediated mutagenesis in F0-injected sterlet embryos to investigate the function in lateral line organ development of Atoh1, electrosensory-restricted Neurod4 and mechanosensory-restricted Foxg1 (for reference, Supplementary Figure S1 shows the normal expression patterns of these genes). We report that Atoh1 is required for the formation of electroreceptors, as well as hair cells. We did not see any phenotype after targeting ampullary organ-restricted Neurod4, potentially owing to redundancy with other Neurod family members that we found to be expressed in sterlet ampullary organs (and neuromasts). Targeting mechanosensory-restricted Foxg1 resulted in a striking phenotype: the ectopic formation of ampullary organs within neuromast lines, and in some cases the fusion of ampullary organ fields that normally develop either side of a line of neuromasts. This suggests the unexpected but intriguing hypothesis that ampullary organs may be the ‘default’ fate for lateral line sensory ridges, and that this is repressed by Foxg1, allowing neuromasts to form instead.

Results

CRISPR/Cas9-mediated mutagenesis in F0-injected sterlet embryos

To test gene function during lateral line organ development, we optimised CRISPR/Cas9-mediated mutagenesis in F0-injected sterlet embryos, building on established protocols for axolotl (Ambystoma mexicanum; Flowers et al., 2014; Fei et al., 2018), newt (Pleurodeles waltl; Elewa et al., 2017), and sea lamprey (Petromyzon marinus; Square et al., 2015; York et al., 2019; Square et al., 2020), whose eggs are all large (1-2 mm in diameter) and easy to microinject at the 1-2 cell stage. Ovulated sterlet eggs are very large: roughly 2.5 mm in diameter (Lenhardt et al., 2005). (Since this project started, CRISPR/Cas9-mediated mutagenesis in F0-injected sterlet embryos has been reported, including by two of us, R.F. and M.P.; Chen et al., 2018; Baloch et al., 2019; Stundl et al., 2022.) Analysis of microsatellite data had originally suggested that although a whole-genome duplication had occurred in the sterlet lineage, the sterlet was likely to be a functional diploid (Ludwig et al., 2001). Our sgRNAs were designed before the first chromosome-level sterlet genome was published (Du et al., 2020). Analysis of this genome showed that approximately 70% of ohnologs (i.e., gene paralogs originating from the whole-genome duplication) had in fact been retained, suggesting functional tetraploidy (Du et al., 2020). We comment on this in relation to our experiments at the relevant points below.

We targeted the melanin-producing enzyme tyrosinase (Tyr) as a positive control, using eight different single-guide (sg) RNAs. Table 1 shows the sgRNA target sequences (including two that were designed and recently published by Stundl et al., 2022) and the various combinations in which they were injected. Supplementary Figure S2A shows the position of each sgRNA relative to the exon structure of the tyrosinase gene. Our sgRNAs were designed before chromosome-level sterlet genomes were available (Du et al., 2020 and the 2022 reference genome: https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1). Searching the reference genome for Tyr showed that both Tyr ohnologs have been retained, on chromosomes 8 and 9, with 99.11% nucleotide identity in the coding sequence (98.81% amino acid identity). Our sgRNAs target both Tyr ohnologs equally.

View this table:
Table 1. sgRNAs used in this study.

List of the genes targeted for CRISPR/Cas9-mediated mutagenesis, together with the target sequences and combinations of sgRNAs reported in this study. Note: Tyr sgRNAs 7 and 8 (marked with an asterisk) were designed and recently published by Stundl et al. (2022) as their tyr sgRNA 3 and tyr sgRNA 4, respectively.

Three different combinations of six of the eight Tyr sgRNAs, when injected at the 1-2- cell stage (2-4 sgRNAs pre-complexed with Cas9), each generated at least four embryos (hereafter ‘crispants’) with altered pigmentation phenotypes evaluated at stage 45 (Dettlaff et al., 1993), the onset of the transition to independent feeding. The other two Tyr sgRNAs failed to generate any phenotypes (Supplementary Table 1). Excluding the Tyr sgRNAs that failed, at least some degree of pigment loss was seen in 63/111 Tyr crispants (56.8%) across nine independent batches. Examples of Tyr crispants with pigmentation phenotypes, plus a control, are shown in Supplementary Figure S2B-D. The most efficient results were obtained by injecting 1-cell embryos with a preassembled mix of Cas9 protein plus two chemically modified sgRNAs (purchased from Synthego) against the target gene, and subsequently maintaining the embryos at room temperature for around 6 hours. The time from fertilization to completion of the first cleavage is around 2-3 hours at room temperature, giving plenty of time for the Cas9/sgRNA complex to act before returning the embryos to colder temperatures for subsequent development. (Sterlet are cold-water fish and the optimum temperature for maintaining embryos for normal development is 16 °C.)

Following embryo injection at the 1-2-cell stage with pre-complexed sgRNAs/Cas9 and fixation at stage 45, genomic DNA was extracted from the trunk/tail prior to analysis of the heads by in situ hybridization (ISH). The sgRNA-targeted region from trunk/tail genomic DNA was amplified by PCR for direct Sanger sequencing and in silico analysis using Synthego’s online ‘Inference of CRISPR Edits’ (ICE) tool (Conant et al., 2022) (also see e.g., Uribe-Salazar et al., 2022) to analyse the identity and frequency of edits of the target gene. Although our genotyping primers were designed before chromosome-level sterlet genomes were available, comparison with the reference genome showed no mismatches against either of the two ohnologs. Genotyping and ICE analysis (Conant et al., 2022) of tails from individual Tyr crispants showed successful disruption of the Tyr gene (Supplementary Figure S2E-I show examples of successful disruption of Tyr; the genotyping data were consistent with the primers amplifying both ohnologs).

We note that our genotyping results have shown that most crispants analysed, across all genes targeted, have shown some degree of targeted mutagenesis in the trunk/tail, with a range of deletion sizes. Although phenotypes from the initial spawning seasons were almost always highly mosaic, suggesting mutations occurred later in development, following optimization a proportion of embryos showed complete unilateral and occasionally bilateral phenotypes. Such phenotypes suggest that mutation occurred in one cell at the 2-cell stage (unilateral phenotype) or even as early as the 1-cell stage (bilateral phenotype). Some degree of mosaicism can be useful, however, as the unaffected tissue provides an internal control for the normal expression of the gene being examined by ISH.

Targeting Atoh1 resulted in the loss of hair cells and electroreceptors

We targeted Atoh1 for CRISPR/Cas9-mediated mutagenesis by injecting sterlet embryos at the 1-2 cell stage with Cas9 protein pre-complexed with two sgRNAs targeting Atoh1 (Table 1; Supplementary Figure S2A). Our sgRNAs were designed before chromosome-level sterlet genomes were available (Du et al., 2020 and the 2022 reference genome: https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Searching the reference genome for Atoh1 showed that both Atoh1 ohnologs have been retained, on chromosomes 1 and 2, with 91.41% nucleotide identity (and 84.02% amino acid identity) in the coding sequence. The copy on chromosome 2 encodes a shorter version of the protein with a four amino acid deletion near the N-terminus (E14_G17del). Our Atoh1 sgRNA 1 (Table 1; Supplementary Figure S3A) has a one-base mismatch to the shorter Atoh1 gene on chromosome 2, in position 3 of the target sequence (PAM-distal), which is unlikely to prevent successful targeting (Wu et al., 2014). Our Atoh1 sgRNA 2 (Table 1; Supplementary Figure S3A) has a two-base mismatch to the longer Atoh1 gene on chromosome 1, in positions 1 and 2 of the target sequence (PAM-distal), which is also unlikely to prevent successful targeting. Thus, we expect our sgRNAs to target both Atoh1 ohnologs.

The Atoh1 crispants were raised to stage 45 (the onset of independent feeding, around 14 days post-fertilization), together with Tyr-targeted siblings/half-siblings as controls (eggs were fertilized in vitro with a mix of sperm from three different males). ISH for the hair cell and electroreceptor marker Cacna1d (Modrell et al., 2017a) (also see preprint: Minařík et al., 2023), which was recently shown to be a direct Atoh1 target gene in mouse cochlear hair cells (Jen et al., 2022), revealed no obvious lateral line organ phenotype in Tyr control crispants (Figure 1A-D; n=0/17 across four independent batches; Supplementary Table 1). Even in wildtype larvae, the number of ampullary organs in individual fields varies considerably at stage 45, so ampullary organ number was not in itself scored as a phenotype. However, Cacna1d expression was absent mosaically in neuromast lines and ampullary organ fields in Atoh1 crispants (Figure 1E-J; n=13/22, i.e., 59%, across five independent batches; Supplementary Table 1). This suggested that disruption of the Atoh1 gene in sterlet resulted in the failure of hair cell differentiation (as expected from zebrafish; Millimaki et al., 2007) and also electroreceptors. Post-ISH immunostaining for the supporting-cell marker Sox2 (Hernández et al., 2007; Modrell et al., 2017a) (also see preprint: Minařík et al., 2023) confirmed that neuromasts had formed (Figure 1E1,F1), so the phenotype was specific to receptor cells. Ampullary organs were not reliably detected because Sox2 immunostaining labels neuromasts much more strongly than ampullary organs in sterlet (Supplementary Figure S1A,B; also preprint: Minařík et al., 2023), as it does in paddlefish (Modrell et al., 2017a). ISH for electroreceptor-specific Kcnab3 (Modrell et al., 2017a) (also see preprint: Minařík et al., 2023) similarly showed no effect in Tyr control crispants (Figure 1K-N; n=0/27 across six independent batches; Supplementary Table 1), but the mosaic absence of Kcnab3 expression in ampullary organ fields in Atoh1 crispants (Figure 1O-T; n=8/13, i.e., 62%, across two independent batches; Supplementary Table 1). Post-Kcnab3 ISH immunostaining for Sox2 confirmed that ampullary organs were still present, as well as neuromasts (Figure 1O1,P1).

Figure 1.
Figure 1. Atoh1 is required for the differentiation of lateral line hair cells and electroreceptors.

Sterlet crispants at stage 45 after in situ hybridization (ISH) for the hair cell and electroreceptor marker Cacna1d, or the electroreceptor-specific marker Kcnab3. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A-D) In a control Tyr crispant, Cacna1d expression shows the normal distribution of hair cells in lines of neuromasts, and electroreceptors in fields of ampullary organs flanking the neuromast lines (lateral view: A,B; ventral view: C,D). (E-J) In an Atoh1 crispant (from a different batch to the Tyr crispant shown in A-D), Cacna1d expression is absent on the left side of the head (E,F), except for a few isolated organs in the otic region and on the operculum. Post-ISH Sox2 immunostaining (E1,F1) shows that neuromast supporting cells are still present. A ventral view (G,H) and a lateral view of the right side of the head (I,J; image flipped horizontally for ease of comparison) reveal a unilateral phenotype, with Cacna1d-expressing hair cells and electroreceptors mostly absent from the left side only of the ventral rostrum (asterisk in G,H) and present on the right side of the head (I,J). (K,L) Lateral view of a control Tyr crispant after ISH for Kcnab3, showing the position of electroreceptors in ampullary organs. (M,N) Ventral view of another Tyr crispant showing Kcnab3 expression in ampullary organs. (O-P1) Lateral view of an Atoh1 crispant in which Kcnab3 expression is absent from ampullary organs. Post-ISH Sox2 immunostaining (O1,P1) shows that supporting cells are still present in neuromasts (strong staining) and can also be detected in ampullary organs (much weaker staining). (Q-T) A different Atoh1 crispant after ISH for Kcnab3, shown in ventral view (Q,R: compare with M,N) and lateral view (S,T). Kcnab3 expression reveals a unilateral phenotype: Kcnab3-expressing electroreceptors are mostly absent from the right side (asterisk) but present on the left side. Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; e, eye; m, mouth; n, naris; S, stage; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.

In mouse cochlear hair cells, the ‘hair cell’ transcription factor genes Pou4f3 and Gfi1 are direct Atoh1 targets (Yu et al., 2021; Jen et al., 2022). ISH for Pou4f3 showed no phenotype in Tyr controls (Figure 2A,B; n=0/9 across three batches; Supplementary Table 1) but the mosaic absence of Pou4f3 in ampullary organ fields and neuromast lines of Atoh1 crispants (Figure 2C-D1; n=13/15 embryos, i.e., 87%, across three batches; Supplementary Table 1). Similarly, ISH for Gfi1 showed no phenotype in Tyr controls (Figure 2E,F; n=0/17 across five batches; Supplementary Table 1), but mosaic absence of Gfi1 in ampullary organ fields and neuromast lines of Atoh1 crispants (Figure 2G-H1; n=9/14 embryos, i.e., 64%, across four batches; Supplementary Table 1). Post-ISH immunostaining for Sox2 confirmed that neuromasts and ampullary organs were still present in Atoh1 crispants (Figure 2C1,D1,G1,H1).

Figure 2.
Figure 2. Atoh1 is required for Pou4f3 and Gfi1 expression in ampullary organs and neuromasts.

Sterlet crispants at stage 45 after in situ hybridization for transcription factor genes expressed by developing hair cells. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A,B) In a control Tyr crispant, Pou4f3 expression is detected in both neuromasts and ampullary organs. (C-D1) In an Atoh1 crispant, Pou4f3 expression is absent from both neuromasts and ampullary organs, except for a few isolated organs in the postorbital region. Post-ISH Sox2 immunostaining (C1,D1) shows that neuromast supporting cells are still present. Most ampullary organs are not visible as Sox2 expression in ampullary organs is significantly weaker than in neuromasts (Supplementary Figure S1A,B) and often not detectable after post-ISH immunostaining. (E,F) In a control Tyr crispant, Gfi1 expression is detected in both neuromasts and ampullary organs. (G-H1) In an Atoh1 crispant, Gfi1 expression is absent from both neuromasts and ampullary organs, except for a few isolated organs in the supra- and infraorbital region. Post-ISH Sox2 immunostaining (G1,H1) shows that neuromast supporting cells are still present. (Most ampullary organs are not visible due to weaker Sox2 immunostaining.) Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; e, eye; n, naris; S, stage; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.

We performed genotyping and ICE analysis (Conant et al., 2022) of tails from individual Atoh1 crispants targeted with this pair of sgRNAs (Supplementary Figure S3 shows examples). Our genotyping primers were designed before chromosome-level sterlet genomes were available; comparison with the reference genome showed two mismatches in the forward primer against the ohnolog on chromosome 2, and the genotyping data were consistent with the primers amplifying the chromosome 1 ohnolog only. Thus, we could not determine whether the chromosome 2 ohnolog was disrupted. However, the genotyping data showed successful disruption of the Atoh1 gene on chromosome 1 (Supplementary Figure S3).

Taken together, these data suggest that Atoh1 lies upstream of Pou4f3 and Gfi1 in ampullary organs as well as neuromasts, and is required for the differentiation of electroreceptors as well as hair cells.

Targeting electrosensory-restricted Neurod4 had no obvious effect on lateral line development

We previously identified Neurod4 in paddlefish as the first-reported ampullary organ-restricted transcription factor in the developing lateral line system (Modrell et al., 2017a). We confirmed that sterlet Neurod4 is similarly expressed by ampullary organs but not neuromasts (Supplementary Figure S1I,J). We targeted Neurod4 in sterlet embryos using nine different sgRNAs (Table 1; Supplementary Figure S4A), injected in eight different combinations of 1-4 different sgRNAs across 10 independent batches of 1-2 cell-stage embryos (Supplementary Table 1). This had no detectable effect on expression of electroreceptor-specific Kcnab3 (n=0/44 across nine batches, Supplementary Table 1) or the hair cell/electroreceptor marker Cacna1d (n=0/4 across two batches, Supplementary Table 1). Examples of Neurod4 crispants after ISH for Kcnab3, plus a Tyr control crispant for comparison, are shown in Supplementary Figure S4B-D. Our sgRNAs were designed before chromosome-level sterlet genomes were available (Du et al., 2020 and the 2022 reference genome: https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Searching the reference genome for Neurod4 showed that both ohnologs have been retained: one on chromosome 45 and the other annotated on an unplaced genomic scaffold, with 99.45% nucleotide identity (and 99.46% amino acid identity) in the coding sequence. Our sgRNAs target both Neurod4 ohnologues without mismatches. Our genotyping primers were designed before chromosome-level sterlet genomes were available; comparison with the reference genome showed five mismatches in the forward primer used for genotyping larvae targeted with sgRNAs 1 and 2 against the chromosome 45 ohnolog (Supplementary Table 1). It was not possible to tell from our genotyping data whether the primers amplified both ohnologs or only one, however, as the remaining sequence targeted by the primers is identical between the two ohnologs. Genotyping and ICE analysis (Conant et al., 2022) showed successful disruption of the Neurod4 gene arising from six different combinations of the sgRNAs (Supplementary Table 1; examples are shown in Supplementary Figure S4E-I). Not all sgRNA combinations were genotyped, but all Neurod4 crispants counted (n=44) included at least one sgRNA confirmed to disrupt the Neurod4 gene via genotyping of other embryos (Supplementary Table 1).

The lack of phenotype in Neurod4 crispants, despite successful disruption of the Neurod4 gene, suggested either that Neurod4 is not required for electroreceptor differentiation, despite its restriction to ampullary organs in both paddlefish and sterlet (Modrell et al., 2017a; this paper), or that it acts redundantly with other transcription factors. In paddlefish, Neurod1 expression was restricted to developing lateral line ganglia (Modrell et al., 2011b). We cloned sterlet Neurod1, Neurod2 and Neurod6. (Unlike Neurod4, these three Neurod family members are all direct Atoh1 targets in mouse hair cells; Jen et al., 2022.) These three genes all proved to be expressed in sterlet ampullary organs, as well as neuromasts (Supplementary Figure S5). Thus, it seems likely that the lack of effect of CRISPR/Cas9-mediated targeting of sterlet Neurod4 is due to redundancy with other Neurod family transcription factors co-expressed in ampullary organs. (Our results also show there is at least some variation in Neurod family gene expression within the developing lateral line systems of paddlefish and sterlet.)

Targeting mechanosensory-restricted Foxg1 led to the formation of ectopic ampullary organs within neuromast lines

We recently identified Foxg1 as a mechanosensory lateral line-restricted transcription factor gene in paddlefish and sterlet (preprint: Minařík et al., 2023). Foxg1 is expressed in the central zones of lateral line sensory ridges where neuromasts form, though excluded from hair cells themselves (preprint: Minařík et al., 2023). Our sgRNAs against Foxg1 (Table 1; Supplementary Figure S6A) were designed before chromosome-level sterlet genomes were available (Du et al., 2020 and the 2022 reference genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Searching the reference genome for Foxg1 showed that both Foxg1 ohnologs have been retained, on chromosomes 15 and 18, with 96.43% nucleotide identity in the coding sequence (99.51% amino acid identity). Our sgRNAs target both Foxg1 ohnologs without mismatches.

When compared with Tyr control crispants (Figure 3A-D), a striking phenotype was seen mosaically after targeting mechanosensory-restricted Foxg1 with sgRNAs 1 and 2 (Table 1; Supplementary Figure S6A): neuromast lines were often interrupted by ectopic ampullary organs. These were defined as Cacna1d-expressing cells present within neuromast lines in larger clusters than expected for neuromasts, resembling ampullary organs (Figure 3E-L; n=9/18, i.e., 50%, across two independent batches; Supplementary Table 1), or by expression of electroreceptor-specific Kcnab3 within neuromast lines, not seen in Tyr control crispants (Figure 3M-V; n=7/24, i.e., 29%, across both batches; Supplementary Table 1). This sometimes led to the apparent fusion of ampullary organ fields across a missing neuromast line (e.g., Figure 3E-H,S-V). Post-Kcnab3 ISH immunostaining for Sox2, to reveal neuromasts, also confirmed that the ectopic electroreceptors in Foxg1 crispants were within neuromast lines (Figure 3Q1,R1). Targeting Foxg1 with a different pair of sgRNAs (Table 1; Supplementary Figure S6A) in a different batch of embryos generated similar phenotypes in 3/21 embryos (14%) overall (Cacna1d: n=1/6, i.e., 17%; Kcnab3: n=2/15, i.e., 13%; Supplementary Table 1).

Figure 3.
Figure 3. Foxg1 represses ampullary organ and electroreceptor formation within neuromast lines.

Sterlet crispants at stage 45 after in situ hybridization (ISH) for the hair cell and electroreceptor marker Cacna1d, or the electroreceptor-specific marker Kcnab3. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A,B) Lateral view of a control Tyr crispant. Cacna1d expression shows the normal distribution of hair cells and electroreceptors. Note that ampullary organs have significantly more Cacna1d-expressing receptor cells than neuromasts. (C,D) Ventral view of a second control Tyr crispant. Cacna1d expression reveals the infraorbital neuromast line on both sides of the ventral rostrum, flanked by the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields. (E,F) Lateral view of a Foxg1 crispant. Cacna1d expression reveals that distinct neuromast lines are missing and the corresponding space is filled by putative ectopic ampullary organs, based on the large, ampullary organ-like clusters of Cacna1d-expressing cells. The dorsal and ventral infraorbital ampullary organ fields seem to have fused across the missing neuromast line (compare with A,B). (G,H) Ventral view of a second Foxg1 crispant. Cacna1d expression reveals an apparent fusion of the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields across the missing infraorbital neuromast lines on both sides (compare with C,D). (I-K) In a third Foxg1 crispant, Cacna1d expression on the left side (I,J) shows that distinct supraorbital and infraorbital neuromast lines are still present. However, some organs within the supraorbital line and most organs within the infraorbital line have large clusters of Cacna1d-expressing cells, suggesting they are ectopic ampullary organs (green arrowheads in J show examples). On the right side (K,L; image flipped horizontally for ease of comparison), this phenotype is not seen. (M,N) Lateral view of a third control Tyr crispant. Electroreceptor-specific Kcnab3 expression shows the distribution of ampullary organs only. (O,P) Ventral view of a fourth control Tyr crispant. Kcnab3 expression shows the distribution of ampullary organ fields. Note the lack of staining where the infraorbital neuromast lines run on either side of the ventral rostrum, flanked by the dorsal infraorbital (di) and ventral infraorbital (vi) ampullary organ fields (compare with Cacna1d expression in C,D). (Q-R1) Lateral view of a fourth Foxg1 crispant. Kcnab3 expression shows two ectopic ampullary organs (green arrowheads) within the infraorbital neuromast line (compare with M,N). Post-ISH Sox2 immunostaining for supporting cells (Q1,R1) confirms the position of the neuromast lines. (S,T) Ventral view of a fifth Foxg1 crispant. On the left side, ectopic Kcnab3-expressing electroreceptors fill the space where the left infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with O,P). On the right side, a single ectopic Kcnab3-expressing ampullary organ is visible (green arrowhead) where the right infraorbital neuromast line runs (compare with O,P). (U,V) Lateral view of a sixth Foxg1 crispant. Kcnab3 expression shows fusion of the dorsal infraorbital ampullary organ field with the dorsal part of the ventral infraorbital ampullary organ field (compare with M,N). Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; e, eye; m, mouth; n, naris; S, stage; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.

We also investigated this phenotype by performing ISH for two ampullary organ-restricted transcription factor genes, Mafa (preprint: Minařík et al., 2023) and Neurod4 (Modrell et al., 2017a; this study), followed by Sox2 immunostaining in some embryos to reveal the location of neuromasts. Relative to the normal ampullary organ expression of Mafa in uninjected siblings/half-siblings (sufficient Tyr control crispants were not available to test; Figure 4A-D; n=0/6 within one batch), ISH for Mafa showed the mosaic presence of ampullary organs in neuromast lines and/or merging of ampullary organ fields in Foxg1 crispants (Figure 4E-J; n=3/17 embryos i.e., 18%, across two independent batches; Supplementary Table 1). Similarly, relative to the usual ampullary organ expression of Neurod4 in uninjected siblings/half-siblings (sufficient Tyr control crispants were not available to test; Figure 4K-N; n=0/2 embryos within one batch; Supplementary Table 1), ISH for Neurod4 (more weakly expressed than Mafa) revealed the same ectopic ampullary organ phenotype in Foxg1 crispants as seen for Cacna1d, Kcnab3 and Mafa (Figure 4O-T; n=3/6 embryos, i.e., 50%, within one batch; Supplementary Table 1). Although our genotyping primers were designed before chromosome-level sterlet genomes were available, comparison with the reference genome showed no mismatches against either of the two ohnologs. Genotyping and ICE analysis (Conant et al., 2022) of tails from individual Foxg1 crispants showed successful disruption of the Foxg1 gene (Supplementary Figure S6 shows examples; the genotyping data were consistent with the primers amplifying both ohnologs). Overall, these data suggest that mechanosensory-restricted Foxg1 acts to repress the formation of ampullary organs and electroreceptors within neuromast lines.

Figure 4.
Figure 4. Ectopic ampullary organs in Foxg1 crispants express ampullary organ-specific transcription factor genes Mafa and Neurod4.

Sterlet crispants at stage 45 after in situ hybridization (ISH) for ampullary organ-restricted transcription factor genes. Black arrowheads indicate examples of neuromasts; white arrowheads indicate examples of ampullary organs. (A-D) In an uninjected sibling/half-sibling (eggs were fertilized in vitro with a mix of sperm from three different males), Mafa expression is restricted to ampullary organs (lateral view: A,B; ventral view: C,D). (E-J) A Foxg1 crispant. On the left side of the head (E,F), several Mafa-expressing ectopic ampullary organs are present in the space where the infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with A,B). Post-ISH Sox2 immunostaining (E1,F1) shows that neuromasts are still present both proximally and distally to the sites of ampullary organ field fusion. In ventral view (G,H), ectopic ampullary organs (green arrowheads) are seen bilaterally, within the spaces where the infraorbital neuromast lines run on either side of the ventral rostrum (compare with C,D). On the right side in lateral view (I,J; image flipped horizontally for ease of comparison), a single Mafa-expressing ectopic ampullary organ (green arrowhead) is also present in the space where the infraorbital neuromast line runs (compare with A,B). (K-N) In an uninjected sibling/half-sibling, Neurod4 expression is restricted to ampullary organs (lateral view: K,L; ventral view: M,N). (O-T) A Foxg1 crispant. On the left side of the head (O,P), Neurod4-expressing ectopic ampullary organs are present in the space where the infraorbital neuromast line would normally run, such that the dorsal and ventral infraorbital ampullary organ fields seem to have fused (compare with K,L). Post-ISH Sox2 immunostaining (O1,P1) suggests that neuromasts are absent from the site of infraorbital ampullary organ field fusion, although neuromasts can be seen in the preopercular and trunk lines (black arrowheads, compare with O,P). In ventral view (Q,R), ectopic Neurod4-expressing ampullary organs are seen where the right infraorbital neuromast line would normally run on the ventral rostrum (green arrowhead indicates an example), resulting in partial fusion of the dorsal and ventral infraorbital fields on this side (the left side is unaffected). On the right side in lateral view (S,T; image flipped horizontally for ease of comparison), ectopic ampullary organs are also present in the space where the infraorbital neuromast line runs (green arrowhead in T indicates an example), resulting in the apparent partial fusion of the dorsal and ventral infraorbital ampullary organ fields (compare with K,L). Abbreviations: b, barbel; di, dorsal infraorbital ampullary organ field; di/vi, fused dorsal infraorbital and ventral infraorbital ampullary organ fields; e, eye; m, mouth; n, naris; S, stage; vi, ventral infraorbital ampullary organ field. Scale bars: 200 μm.

Discussion

Conserved molecular mechanisms underlie lateral line electroreceptor and hair cell formation

Here, we aimed to test the function in lateral line electroreceptor and/or hair cell formation of three transcription factor genes that we had previously identified as expressed in developing electrosensory ampullary organ and/or mechanosensory lateral line organs in ray-finned chondrostean fishes - paddlefish and sterlet (Butts et al., 2014; Modrell et al., 2017a; preprint: Minařík et al., 2023). The first gene we investigated was Atoh1, which is required for the formation of lateral line hair cells in zebrafish (Millimaki et al., 2007), as well as hair cells in the inner ear (Bermingham et al., 1999; Millimaki et al., 2007). In paddlefish (Butts et al., 2014; Modrell et al., 2017a) and sterlet (preprint: Minařík et al., 2023), Atoh1 is expressed in ampullary organs as well as neuromasts. Targeting Atoh1 for CRISPR/Cas9-mediated mutagenesis in F0 sterlet embryos showed that Atoh1 is required for the formation not only of Cacna1d-expressing neuromast hair cells, as expected from zebrafish (Millimaki et al., 2007), but also of Cacna1d-expressing, Kcnab3-expressing electroreceptors. These experiments also showed that Atoh1 is required for the expression of the ‘hair cell’ transcription factor genes Gfi1 and Pou4f3 in developing ampullary organs, as well as neuromasts. This is consistent with both of these genes being direct Atoh1 targets in mouse cochlear hair cells (Yu et al., 2021; Jen et al., 2022).

In both inner-ear hair cells and Merkel cells (epidermal mechanoreceptors found in all vertebrates; see e.g., Whitear, 1989; Brown et al., 2023), Atoh1 acts with Pou4f3 in a conserved ‘feed-forward circuit’, with Atoh1 directly activating Pou4f3 expression, and Pou4f3 then acting as a pioneer factor to open a significant subset of Atoh1 target enhancers (some shared and some divergent between hair cells and Merkel cells), enabling mechanosensory differentiation (Yu et al., 2021). In hair cells, Gfi1 is one of the Pou4f3-dependent Atoh1 targets (Yu et al., 2021). Together with the striking conservation of transcription factor gene expression between developing ampullary organs and neuromasts (Modrell et al., 2011b; Modrell et al., 2011a; Modrell et al., 2017b; Modrell et al., 2017a) (also preprint: Minařík et al., 2023), the phenotypes seen in Atoh1-targeted F0 sterlet crispant embryos suggest that the molecular mechanisms underlying electroreceptor formation are highly conserved with those underlying hair cell formation. Indeed, the requirement of Atoh1 for Pou4f3 and Gfi1 expression in ampullary organs, as well as neuromasts, suggests that the Atoh1-Pou4f3 ‘feedforward circuit’ in mechanosensory cells - i.e., hair cells and epidermal Merkel cells (Yu et al., 2021) - may also be conserved, at least partly, in developing electroreceptors. Taken together, these data support the hypothesis that electroreceptors evolved as a transcriptionally related "sister cell type" to lateral line hair cells (Arendt et al., 2016; Baker and Modrell, 2018; Baker, 2019).

Electrosensory-restricted Neurod4 is likely redundant with other Neurod family members in sterlet

Paddlefish Neurod4 was the first-reported ampullary organ-restricted transcription factor gene (Modrell et al., 2017a), with conserved expression in sterlet (this study). We were unable to detect a lateral line organ phenotype in Neurod4-targeted sterlet crispants. However, we found that Neurod1, Neurod2 and Neurod6 are all expressed in sterlet ampullary organs (as well as neuromasts), suggesting that Neurod4 may act redundantly with one or more of these factors in developing ampullary organs. (In paddlefish, however, Neurod1 expression is restricted to developing lateral line ganglia; Modrell et al., 2011b.) Targeting multiple Neurod genes for CRISPR/Cas9-mediated mutagenesis in the future may shed light on the role played by this transcription factor family in ampullary organ development.

Foxg1 represses electroreceptor formation in the neuromast-forming central zone of lateral line sensory ridges

We also targeted Foxg1, a mechanosensory-restricted transcription factor gene that we recently identified in the developing lateral line system of paddlefish and sterlet (preprint: Minařík et al., 2023). Foxg1 is expressed in the central zones of lateral line sensory ridges where neuromasts form, though excluded from the central domains of neuromasts where hair cells differentiate (preprint: Minařík et al., 2023). Targeting Foxg1 for CRISPR/Cas9-mediated mutagenesis in F0 sterlet embryos led to a striking phenotype: the formation within neuromast lines of ectopic electroreceptors, often in the large clusters normally seen in ampullary organs. In some cases, ampullary organ fields, which normally flank neuromast lines, effectively ‘merged’ across missing neuromast lines. This phenotype was revealed by examining expression of the electroreceptor-specific marker Kcnab3, and two ampullary organ-restricted transcription factor genes: Mafa (preprint: Minařík et al., 2023) and Neurod4 (Modrell et al., 2017a). Thus, Foxg1 seems to repress an ampullary organ fate within the central domain of lateral line sensory ridges where neuromasts form.

In the mouse inner ear, Foxg1 is expressed in the prospective cochlea and all sensory patches, in hair cell progenitors and supporting cells (Pauley et al., 2006; Tasdemir-Yilmaz et al., 2021), plus a subset of hair cells (Pauley et al., 2006). Knockout leads to a shorter cochlea with extra rows of hair cells, and to loss or reduction of vestibular end organs (Pauley et al., 2006; Hwang et al., 2009). More hair cells and fewer supporting cells were seen after conditional knockdown of Foxg1 in neonatal cochlear supporting cells, possibly via the transdifferentiation of supporting cells (Zhang et al., 2019; Zhang et al., 2020). This suggests the possibility that Foxg1 may act in the central zone of lateral line sensory ridges to maintain a proliferative progenitor state, as it does in the mouse olfactory epithelium (Kawauchi et al., 2009).

Furthermore, Fox family members can act as pioneer factors as well as transcription factors (Golson and Kaestner, 2016; Lukoseviciute et al., 2018). A pioneer factor role has been proposed for Foxi3 in otic placode development (see Singh and Groves, 2016). In the developing neural crest, Foxd3 acts early as a pioneer factor, opening enhancers and repositioning nucleosomes to prime genes controlling neural crest specification and migration and, concurrently, to repress the premature differentiation of, e.g., melanocytes (Lukoseviciute et al., 2018). Later in neural crest development, Foxd3 represses enhancers associated with mesenchymal, neuronal and melanocyte lineages (Lukoseviciute et al., 2018). In cortical progenitors, Foxg1 suppresses the adoption at later stages of an early-born cell fate, namely, Cajal-Retzius cells (Hanashima et al., 2004). In the developing chicken otic placode, Foxg1 represses markers of other lineages, such as the olfactory and lens placodes, and epidermis (Anwar et al., 2017). Hence, it is possible that Foxg1 acts in the central zone of lateral line sensory ridges in electroreceptive fishes as a pioneer factor for neuromast/hair cell formation, and/or that it represses ampullary organ/electroreceptor formation. Such a role would be consistent with lateral line expression of Foxg1 only in electroreceptive fishes: Foxg1 is not expressed in the developing lateral line of zebrafish or Xenopus (e.g., Dirksen and Jamrich, 1995; Papalopulu and Kintner, 1996; Toresson et al., 1998; Eagleson and Dempewolf, 2002; Duggan et al., 2008; Zhao et al., 2009).

Overall, these data lead us to propose the speculative hypothesis that electrosensory organs may be the ‘default’ fate within lateral line sensory ridges in electroreceptive vertebrates, and that Foxg1 represses this fate to enable mechanosensory neuromasts and hair cells to form. To test these hypotheses directly, it will be important in the future to identify global changes in gene expression and chromatin accessibility in the absence of Foxg1.

Summary and Perspective

Overall, we have found that the ‘hair cell’ transcription factor Atoh1 is required for the formation of lateral line electroreceptors as well as hair cells, consistent with a close developmental relationship between these putative ‘sister cell’ types. Electrosensory-restricted Neurod4 may act redundantly with other Neurod family members expressed in developing ampullary organs. Mechanosensory-restricted Foxg1 represses the formation of electroreceptors within neuromast lines, suggesting the surprising possibility that electroreceptors are the ‘default’ fate within lateral line sensory ridges and raising interesting developmental and evolutionary questions for future investigation.

Materials and Methods

Animals

Fertilized sterlet (Acipenser ruthenus) eggs were obtained from the breeding facility at the Research Institute of Fish Culture and Hydrobiology, Faculty of Fisheries and Protection of Waters, University of South Bohemia in České Budějovice, Vodňany, Czech Republic, and staged according to Dettlaff et al. (1993). For detailed information about sterlet husbandry, in vitro fertilization and the rearing of embryos and yolk-sac larvae, see Stundl et al. (2022). Each fertilization used a mix of sperm from three different males, so each batch was a mix of siblings and half-siblings. Upon reaching the desired developmental stages, embryos and yolk-sac larvae were euthanized by overdose of MS-222 (Sigma-Aldrich) and fixed in modified Carnoy’s fixative (6 volumes 100% ethanol: 3 volumes 37% formaldehyde: 1 volume glacial acetic acid) for 3 hours at room temperature, dehydrated stepwise into 100% ethanol and stored at −20 °C.

All experimental procedures were approved by the Animal Research Committee of the Faculty of Fisheries and Protection of Waters in Vodňany, University of South Bohemia in České Budějovice, Czech Republic, and by the Ministry of Agriculture of the Czech Republic (reference number: MSMT-12550/2016-3). Experimental fish were maintained according to the principles of the European Union (EU) Harmonized Animal Welfare Act of the Czech Republic, and Principles of Laboratory Animal Care and National Laws 246/1992 “Animal Welfare” on the protection of animals.

CRISPR guide RNA design and synthesis

Target gene sequences were identified using the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi; McGinnis and Madden, 2004) to search sterlet transcriptomic data (available at DDBJ/EMBL/GenBank under the accessions GKLU00000000 and GKEF01000000; see preprint: Minařík et al., 2023) or draft genomic sequence data (M.H., unpublished) with the relevant paddlefish sequence (Modrell et al., 2017a). Transcriptomic sequence data were searched for Tyr, Atoh1 and Neurod4; genomic sequence data were searched for Foxg1. Chromosome-level sterlet genomes became available only after the project started: Du et al. (2020) and the 2022 reference genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Open reading frames were identified using the NCBI ORF Finder tool (https://www.ncbi.nlm.nih.gov/orffinder/) and exons annotated by comparison with reference anamniote species (Lepisosteus oculatus, Danio rerio, Xenopus tropicalis) available via Ensembl (https://www.ensembl.org; Cunningham et al., 2022). Conserved domains were identified using NCBI BLASTX (https://blast.ncbi.nlm.nih.gov/Blast.cgi; McGinnis and Madden, 2004). gRNAs were preferentially designed to target 5’ exons, ideally upstream of or within regions encoding known functional domains, to increase the probability of disrupting gene function. gRNAs were designed using the CRISPR Guide RNA Design Tool from Benchling (https://benchling.com) and selected for synthesis based on the following criteria: (1) a high on-target score, ideally no less than 0.5; (2) no off-target matches identified within coding sequences in transcriptome and genome data, unless there were at least two mismatches in the 3’ seed sequence (8-10 bp upstream of the protospacer adjacent motif [PAM], or in the PAM itself); (3) if multiplexing, the gRNA pair were ideally within 50-150 bases of each other to increase the probability of fragment deletion.

DNA templates for CRISPR gRNAs were synthesized using plasmid pX335-U6- Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene, plasmid #42335; Cong et al., 2013) containing the gRNA scaffold. The gRNA scaffold was amplified using a specific forward primer for each gRNA, with an overhang containing the gRNA target sequence and T7 promoter, and a reverse primer that was identical for all reactions. For gRNAs that did not start with G, an additional G was added at the start to ensure efficient transcription. The DNA template was amplified using Q5 polymerase (New England Biolabs, NEB) and purified using the Monarch PCR & DNA Cleanup Kit (NEB). The gRNAs were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB) and stored at −80 °C before use. Alternatively, chemically modified synthetic gRNAs were ordered directly from Synthego (CRISPRevolution sgRNA EZ Kit).

Embryo injection

On the day of injection, 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP) complexes. For gRNA multiplexing, two RNP mixes were combined 1:1 to a final volume of 5 μl, and 0.5 μl of 10% 10,000 MW rhodamine dextran (Invitrogen) added to better visualize the injection mixture and allow selection of properly injected embryos using rhodamine fluorescence. Injection mixtures were kept on ice throughout the injection session. 10 μl glass microcapillaries (Drummond Microcaps) were pulled in a capillary needle puller (PC-10, Narishige) set to 58 °C with two light and one heavy weights, in single-stage pulling mode. Fertilized sterlet eggs were manually dechorionated using Dumont #5 forceps. A 1000 μl pipette tip cut to the same diameter as a dechorionated sterlet egg was used to prepare a series of wells in an agar plate to allow ideal egg positioning during injection using an automatic microinjector (FemtoJet 4x, Eppendorf), set to 100 hPa. Approximately 20 nl of the injection mixture (corresponding to approximately 4.8 ng gRNAs and 9.6 ng Cas9) were injected into fertilized eggs or two-cell stage embryos, targeting the animal pole at a 45° angle. Injected embryos were moved to a clean Petri dish and, for optimum Cas9 efficiency, kept at room temperature until the end of the injecting session or until at least the 32-cell stage, then moved to a 16°C incubator. No more than 30 eggs were kept per 90 mm Petri dish. Unfertilized eggs and dead embryos were removed at the end of the injection day. Petri dishes were checked regularly for dead embryos and the water was changed at least twice a day before gastrulation was completed, and once daily post-gastrulation. Hatched larvae were kept for approximately 16 days post fertilisation until stage 45, then euthanized by MS-222 overdose and fixed with modified Carnoy’s fixative (see above). Fixed larvae were then dehydrated stepwise into 100% ethanol and stored at −20°C.

Gene cloning, in situ hybridization and immunohistochemistry

Total RNA was isolated from sterlet embryos using Trizol (Invitrogen, Thermo Fisher Scientific), following the manufacturer’s protocol, and cDNA synthesized using the Superscript III First Strand Synthesis kit (Invitrogen, Thermo Fisher Scientific). We used our sterlet transcriptome assemblies (from pooled yolk-sac larvae at stages 40-45; preprint: Minařík et al., 2023), which are available at DDBJ/EMBL/GenBank under the accessions GKLU00000000 and GKEF01000000, to design primers for Neurod4 (forward: GAGAGAGCCCCAAAGAGACGAG; reverse: CTGCTTGAGCGAGAAGTTGACG). cDNA fragments amplified under standard PCR conditions were cloned into the pDrive cloning vector (Qiagen). Individual clones were verified by sequencing (Department of Biochemistry Sequencing Facility, University of Cambridge, UK) and sequence identity verified using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi; McGinnis and Madden, 2004). For Neurod1, Neurod2, Neurod4 and Neurod6, synthetic gene fragments based on sterlet transcriptome data, with added M13 forward and reverse primer adaptors, were ordered from Twist Bioscience. GenBank accession numbers are as follows: Neurod1 OQ808944, Neurod2 OQ808945, Neurod4 OQ808946, Neurod6 OQ808947. The other genes used in this study have been published (preprint: Minařík et al., 2023).

The sterlet riboprobe template sequences were designed before chromosome-level genome assemblies for sterlet were available (Du et al., 2020 and the 2022 reference genome: https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Genome analysis showed that an independent whole-genome duplication occurred in the sterlet lineage, from which approximately 70% of ohnologs (i.e., gene paralogs arising from the whole-genome duplication) have been retained (Du et al., 2020). Supplementary File 1 shows the percentage match for each Neurod family riboprobe with the two ohnologs, obtained by performing a nucleotide BLAST search against the reference genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_902713425.1/). Equivalent data for the other riboprobes used in this study are available in the preprint Minařík et al. (2023). The percentage match with the ‘targeted’ Neurod family ohnolog ranged from 98.9-100%; the percentage match with the second ohnolog was also high, ranging from 96.2-100% (Supplementary File 1), suggesting that transcripts from the second ohnolog are likely to be targeted by each of these riboprobes.

Digoxigenin-labelled riboprobes were synthesized as previously described (preprint: Minařík et al., 2023). Whole-mount in situ hybridization (ISH) was performed as previously described (Modrell et al., 2011a). Whole-mount immunostaining post-ISH for Sox2 (rabbit monoclonal, 1:200; ab92494, Abcam) was performed as previously described (Metscher and Müller, 2011), using a horseradish peroxidase-conjugated goat anti-rabbit antibody (1:300, Jackson ImmunoResearch) and the metallographic peroxidase substrate EnzMet kit (Nanoprobes) as per the manufacturer’s instructions.

Genotyping

To confirm successful mutation in targeted regions, genotyping was performed on trunk and tail tissue that had been removed before ISH and stored in 100% ethanol at −20°C. The tissue was digested using Rapid Extract Lysis Kit (PCR Biosystems) and the target region amplified using HS Taq Mix Red (PCR Biosystems) according to the manufacturer’s instructions. Primers used for genotyping are listed in Supplementary Table 1. After agarose gel electrophoresis, PCR products were extracted using MinElute Gel Extraction Kit (Qiagen) and submitted for sequencing (Genewiz by Azenta Life Sciences). To analyze CRISPR editing efficiency, Sanger trace files were uploaded to the Synthego Inference of CRISPR Edits (ICE) tool (https://ice.synthego.com; Conant et al., 2022).

Imaging and image processing

Larvae were placed in a slit in an agar-coated Petri dish with PBS and imaged using a Leica MZFLIII dissecting microscope equipped with either a MicroPublisher 5.0 RTV camera (QImaging) controlled by QCapture Pro 6.0 or 7.0 software (QImaging), or a MicroPublisher 6 color CCD camera (Teledyne Photometrics) controlled by Ocular software (Teledyne Photometrics). For most larvae, a stack of images was acquired by manually focusing through the sample, then Helicon Focus software (Helicon Soft Limited) was used for focus stacking. Adobe Photoshop (Adobe Systems Inc.) was used to process images.

Data availability statement

The publication and associated supplementary figures include representative example images of embryos from each experiment. Additional raw data underlying this publication consist of further images of these and other embryos from each experiment. Public sharing of these images is not cost-efficient but they are available from the corresponding author upon reasonable request.

Ethics statement

Sterlet animal work was reviewed and approved by The Animal Research Committee of Research Institute of Fish Culture and Hydrobiology, Faculty of Fisheries and Protection of Waters, University of South Bohemia in České Budějovice, Vodňany, Czech Republic and Ministry of Agriculture of the Czech Republic (MSMT-12550/2016-3).

Author contributions

CB conceived and designed the project and wrote the manuscript together with MM. MM performed most of the experiments, prepared all the manuscript figures and made a significant contribution to the writing of the manuscript. AC and RF performed some experiments. MH provided draft genome sequence data. MP and DG were instrumental in enabling all work with sterlet embryos. All authors read and commented on the manuscript.

Funding

This work was supported by the Biotechnology and Biological Sciences Research Council (BBSRC: grant BB/P001947/1 to CB). Additional support for MM was provided by the Cambridge Isaac Newton Trust (grant 20.07[c] to CB) and by the School of the Biological Sciences, University of Cambridge. AC was supported by a PhD research studentship from the Anatomical Society. The work of RF and MP was supported by the Ministry of Education, Youth and Sports of the Czech Republic, projects CENAKVA (LM2018099), Biodiversity (CZ.02.1.01/0.0/0.0/16_025/0007370) and Czech Science Foundation (20-23836S).

Rights Retention Statement

This work was funded by a grant from the Biotechnology and Biological Sciences Research Council (BBSRC: BB/P001947/1). For the purpose of open access, the author has applied a Creative Commons Attribution (CC BY) licence to any Author Accepted Manuscript version arising.

Acknowledgements

Thanks to Melinda Modrell for pilot work on CRISPR/Cas9 in paddlefish and for her advice and helpful discussions in planning the project. Thanks to Marek Rodina and Martin Kahanec for their help with sterlet spawns. Thanks to David Jandzik, András Simon, Alberto Joven Araus, Ahmed Elewa, and Mustafa Khokha for invaluable advice on CRISPR/Cas9 approaches and genotyping. Thanks to Jan Stundl and David Jandzik for sharing their sterlet Tyr gRNA sequences prior to publication. Thanks to Christine Hirschberger and Rolf Ericsson for their help with some of the in situ hybridization rounds.

Footnotes

  • Information about ohnologs, sgRNAs and genotyping primers updated in relation to the current reference genome; injection batch numbering revised; Methods and Supplementary files updated; Supplementary Figure S1 updated; author affiliations updated.

References

  1. ↵
    Anwar, M., Tambalo, M., Ranganathan, R., Grocott, T., Streit, A., 2017. A gene network regulated by FGF signalling during ear development. Sci. Rep. 7, 6162.
    OpenUrlCrossRef
  2. ↵
    Arendt, D., Musser, J.M., Baker, C.V.H., Bergman, A., Cepko, C., Erwin, D.H., Pavlicev, M., Schlosser, G., Widder, S., Laubichler, M.D., Wagner, G.P., 2016. The origin and evolution of cell types. Nat. Rev. Genet. 17, 744–757.
    OpenUrlCrossRefPubMed
  3. ↵
    Baker, C.V.H., 2019. The development and evolution of lateral line electroreceptors: insights from comparative molecular approaches., in: B.A. Carlson, J.A. Sisneros, A.N. Popper, R.R. Fay (Eds.), Electroreception: Fundamental Insights from Comparative Approaches. Springer, Cham, pp. 25–62.
  4. ↵
    Baker, C.V.H., Modrell, M.S., 2018. Insights into electroreceptor development and evolution from molecular comparisons with hair cells. Integr. Comp. Biol. 58, 329–340.
    OpenUrlCrossRefPubMed
  5. ↵
    Baker, C.V.H., Modrell, M.S., Gillis, J.A., 2013. The evolution and development of vertebrate lateral line electroreceptors. J. Exp. Biol. 216, 2515–2522.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Baloch, A.R., Franěk, R., Tichopád, T., Fučíková, M., Rodina, M., Pšenička, M., 2019. Dnd1 knockout in sturgeons by CRISPR/Cas9 generates germ cell free host for surrogate production. Animals (Basel) 9, 174.
    OpenUrl
  7. ↵
    Bellono, N.W., Leitch, D.B., Julius, D., 2017. Molecular basis of ancestral vertebrate electroreception. Nature 543, 391–396.
    OpenUrlCrossRefPubMed
  8. ↵
    Bellono, N.W., Leitch, D.B., Julius, D., 2018. Molecular tuning of electroreception in sharks and skates. Nature 558, 122–126.
    OpenUrlCrossRefPubMed
  9. ↵
    Bermingham, N.A., Hassan, B.A., Price, S.D., Vollrath, M.A., Ben-Arie, N., Eatock, R.A., Bellen, H.J., Lysakowski, A., Zoghbi, H.Y., 1999. Math1: an essential gene for the generation of inner ear hair cells. Science 284, 1837–1841.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. T.H. Bullock,
    2. C.D. Hopkins,
    3. A.N. Popper,
    4. R.R. Fay
    Bodznick, D., Montgomery, J.C., 2005. The physiology of low-frequency electrosensory systems, in: T.H. Bullock, C.D. Hopkins, A.N. Popper, R.R. Fay (Eds.), Electroreception. Springer, New York, pp. 132–153.
  11. ↵
    Brown, T.L., Horton, E.C., Craig, E.W., Goo, C.E.A., Black, E.C., Hewitt, M.N., Yee, N.G., Fan, E.T., Raible, D.W., Rasmussen, J.P., 2023. Dermal appendage-dependent patterning of zebrafish atoh1a+ Merkel cells. eLife 12, e85800.
    OpenUrl
  12. ↵
    Bullock, T.H., Bodznick, D.A., Northcutt, R.G., 1983. The phylogenetic distribution of electroreception: evidence for convergent evolution of a primitive vertebrate sense modality. Brain Res. Rev. 287, 25–46.
    OpenUrl
  13. ↵
    Butts, T., Modrell, M.S., Baker, C.V.H., Wingate, R.J.T., 2014. The evolution of the vertebrate cerebellum: absence of a proliferative external granule layer in a non-teleost ray-finned fish. Evol. Dev. 16, 92–100.
    OpenUrlCrossRefPubMed
  14. ↵
    Caprara, G.A., Peng, A.W., 2022. Mechanotransduction in mammalian sensory hair cells. Mol. Cell. Neurosci. 120, 103706.
    OpenUrlPubMed
  15. ↵
    Chagnaud, B.P., Wilkens, L.A., Hofmann, M., 2021. The ampullary electrosensory system –a paddlefish case study, in: B. Fritzsch (Ed.), The Senses: A Comprehensive Reference. Elsevier, pp. 215–227.
  16. ↵
    Chen, J., Wang, W., Tian, Z., Dong, Y., Dong, T., Zhu, H., Zhu, Z., Hu, H., Hu, W., 2018. Efficient gene transfer and gene editing in sterlet. Front. Genet. 9, 117.
    OpenUrlCrossRef
  17. ↵
    Chen, Y., Gu, Y., Li, Y., Li, G.L., Chai, R., Li, W., Li, H., 2021. Generation of mature and functional hair cells by co-expression of Gfi1, Pou4f3, and Atoh1 in the postnatal mouse cochlea. Cell Rep. 35, 109016.
    OpenUrlCrossRef
  18. ↵
    Conant, D., Hsiau, T., Rossi, N., Oki, J., Maures, T., Waite, K., Yang, J., Joshi, S., Kelso, R., Holden, K., Enzmann, B.L., Stoner, R., 2022. Inference of CRISPR edits from Sanger trace data. CRISPR J. 5, 123–130.
    OpenUrlCrossRef
  19. ↵
    Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Crampton, W.G.R., 2019. Electroreception, electrogenesis and electric signal evolution. J. Fish Biol. 95, 92–134.
    OpenUrlCrossRef
  21. ↵
    Cunningham, F., Allen, J.E., Allen, J., Alvarez-Jarreta, J., Amode, M.R., Armean, I.M., Austine-Orimoloye, O., Azov, A.G., Barnes, I., Bennett, R., Berry, A., Bhai, J., Bignell, A., Billis, K., Boddu, S., Brooks, L., Charkhchi, M., Cummins, C., Da Rin Fioretto, L., Davidson, C., Dodiya, K., Donaldson, S., El Houdaigui, B., El Naboulsi, T., Fatima, R., Giron, C.G., Genez, T., Martinez, J.G., Guijarro-Clarke, C., Gymer, A., Hardy, M., Hollis, Z., Hourlier, T., Hunt, T., Juettemann, T., Kaikala, V., Kay, M., Lavidas, I., Le, T., Lemos, D., Marugán, J.C., Mohanan, S., Mushtaq, A., Naven, M., Ogeh, D.N., Parker, A., Parton, A., Perry, M., Piližota, I., Prosovetskaia, I., Sakthivel, M.P., Salam, A.I.A., Schmitt, B.M., Schuilenburg, H., Sheppard, D., Pérez-Silva, J.G., Stark, W., Steed, E., Sutinen, K., Sukumaran, R., Sumathipala, D., Suner, M.M., Szpak, M., Thormann, A., Tricomi, F.F., Urbina-Gómez, D., Veidenberg, A., Walsh, T.A., Walts, B., Willhoft, N., Winterbottom, A., Wass, E., Chakiachvili, M., Flint, B., Frankish, A., Giorgetti, S., Haggerty, L., Hunt, S.E., IIsley, G.R., Loveland, J.E., Martin, F.J., Moore, B., Mudge, J.M., Muffato, M., Perry, E., Ruffier, M., Tate, J., Thybert, D., Trevanion, S.J., Dyer, S., Harrison, P.W., Howe, K.L., Yates, A.D., Zerbino, D.R., Flicek, P., 2022. Ensembl 2022. Nucleic Acids Res. 50, D988–D995.
    OpenUrlCrossRef
  22. ↵
    Dettlaff, T.A., Ginsburg, A.S., Schmalhausen, O.I., 1993. Sturgeon Fishes: Developmental Biology and Aquaculture. Springer-Verlag, Berlin.
  23. ↵
    Dirksen, M.-L., Jamrich, M., 1995. Differential expression of fork head genes during early Xenopus and zebrafish development. Dev. Genet. 17, 107–116.
    OpenUrlCrossRefPubMed
  24. ↵
    Du, K., Stöck, M., Kneitz, S., Klopp, C., Woltering, J.M., Adolfi, M.C., Feron, R., Prokopov, D., Makunin, A., Kichigin, I., Schmidt, C., Fischer, P., Kuhl, H., Wuertz, S., Gessner, J., Kloas, W., Cabau, C., Iampietro, C., Parrinello, H., Tomlinson, C., Journot, L., Postlethwait, J.H., Braasch, I., Trifonov, V., Warren, W.C., Meyer, A., Guiguen, Y., Schartl, M., 2020. The sterlet sturgeon genome sequence and the mechanisms of segmental rediploidization. Nat. Ecol. Evol. 4, 841–852.
    OpenUrl
  25. ↵
    Duggan, C.D., Demaria, S., Baudhuin, A., Stafford, D., Ngai, J., 2008. Foxg1 is required for development of the vertebrate olfactory system. J. Neurosci. 28, 5229–5239.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Eagleson, G.W., Dempewolf, R.D., 2002. The role of the anterior neural ridge and Fgf-8 in early forebrain patterning and regionalization in Xenopus laevis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 132, 179–189.
    OpenUrlCrossRefPubMed
  27. ↵
    Elewa, A., Wang, H., Talavera-López, C., Joven, A., Brito, G., Kumar, A., Hameed, L.S., Penrad-Mobayed, M., Yao, Z., Zamani, N., Abbas, Y., Abdullayev, I., Sandberg, R., Grabherr, M., Andersson, B., Simon, A., 2017. Reading and editing the Pleurodeles waltl genome reveals novel features of tetrapod regeneration. Nat. Commun. 8, 2286.
    OpenUrlCrossRef
  28. ↵
    Fei, J.-F., Lou, W.P.-K., Knapp, D., Murawala, P., Gerber, T., Taniguchi, Y., Nowoshilow, S., Khattak, S., Tanaka, E.M., 2018. Application and optimization of CRISPR-Cas9-mediated genome engineering in axolotl (Ambystoma mexicanum). Nat. Protoc. 13, 2908–2943.
    OpenUrlCrossRef
  29. ↵
    Flowers, G.P., Timberlake, A.T., McLean, K.C., Monaghan, J.R., Crews, C.M., 2014. Highly efficient targeted mutagenesis in axolotl using Cas9 RNA-guided nuclease. Development 141, 2165–2171.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Gillis, J.A., Modrell, M.S., Northcutt, R.G., Catania, K.C., Luer, C.A., Baker, C.V.H., 2012. Electrosensory ampullary organs are derived from lateral line placodes in cartilaginous fishes. Development 139, 3142–3146.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Golson, M.L., Kaestner, K.H., 2016. Fox transcription factors: from development to disease. Development 143, 4558–4570.
    OpenUrlAbstract/FREE Full Text
  32. ↵
    Hanashima, C., Li, S.C., Shen, L., Lai, E., Fishell, G., 2004. Foxg1 suppresses early cortical cell fate. Science 303, 56–59.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Hernández, P.P., Olivari, F.A., Sarrazin, A.F., Sandoval, P.C., Allende, M.L., 2007. Regeneration in zebrafish lateral line neuromasts: expression of the neural progenitor cell marker sox2 and proliferation-dependent and-independent mechanisms of hair cell renewal. Dev. Neurobiol. 67, 637–654.
    OpenUrlCrossRefPubMedWeb of Science
  34. ↵
    Hwang, C.H., Simeone, A., Lai, E., Wu, D.K., 2009. Foxg1 is required for proper separation and formation of sensory cristae during inner ear development. Dev. Dyn. 238, 2725–2734.
    OpenUrlCrossRefPubMedWeb of Science
  35. ↵
    Iyer, A.A., Groves, A.K., 2021. Transcription factor reprogramming in the inner ear: turning on cell fate switches to regenerate sensory hair cells. Front. Cell. Neurosci. 15, 660748.
    OpenUrl
  36. ↵
    Iyer, A.A., Hosamani, I., Nguyen, J.D., Cai, T., Singh, S., McGovern, M.M., Beyer, L., Zhang, H., Jen, H.I., Yousaf, R., Birol, O., Sun, J.J., Ray, R.S., Raphael, Y., Segil, N., Groves, A.K., 2022. Cellular reprogramming with ATOH1, GFI1, and POU4F3 implicate epigenetic changes and cell-cell signaling as obstacles to hair cell regeneration in mature mammals. eLife 11, e79712.
    OpenUrl
  37. ↵
    Jen, H.-I., Singh, S., Tao, L., Maunsell, H.R., Segil, N., Groves, A.K., 2022. GFI1 regulates hair cell differentiation by acting as an off-DNA transcriptional co-activator of ATOH1, and a DNA-binding repressor. Sci. Rep. 12, 7793.
    OpenUrl
  38. ↵
    1. T.H. Bullock,
    2. C.D. Hopkins,
    3. A.N. Popper,
    4. R.R. Fay
    Jørgensen, J.M., 2005. Morphology of electroreceptive sensory organs, in: T.H. Bullock, C.D. Hopkins, A.N. Popper, R.R. Fay (Eds.), Electroreception. Springer, New York, pp. 47–67.
  39. ↵
    Kawauchi, S., Santos, R., Kim, J., Hollenbeck, P.L.W., Murray, R.C., Calof, A.L., 2009. The role of Foxg1 in the development of neural stem cells of the olfactory epithelium. Ann. N. Y. Acad. Sci. 1170, 21–27.
    OpenUrlCrossRefPubMedWeb of Science
  40. ↵
    Kniss, J.S., Jiang, L., Piotrowski, T., 2016. Insights into sensory hair cell regeneration from the zebrafish lateral line. Curr. Opin. Genet. Dev. 40, 32–40.
    OpenUrlCrossRef
  41. ↵
    1. B.A. Carlson,
    2. J.A. Sisneros,
    3. A.N. Popper,
    4. R.R. Fay
    Leitch, D.B., Julius, D., 2019. Electrosensory transduction: comparisons across structure, afferent response properties, and cellular physiology., in: B.A. Carlson, J.A. Sisneros, A.N. Popper, R.R. Fay (Eds.), Electroreception: Fundamental Insights from Comparative Approaches. Springer, Cham, pp. 63–90.
  42. ↵
    Lenhardt, M., Finn, R.N., Cakic, P., Kolarevic, J., Krpocetkovic, J., Radovic, I., Fyhn, H.J., 2005. Analysis of the post-vitellogenic oocytes of three species of Danubian Acipenseridae. Belg. J. Zool. 135, 205.
    OpenUrl
  43. ↵
    Ludwig, A., Belfiore, N.M., Pitra, C., Svirsky, V., Jenneckens, I., 2001. Genome duplication events and functional reduction of ploidy levels in sturgeon (Acipenser, Huso and Scaphirhynchus). Genetics 158, 1203–1215.
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Lukoseviciute, M., Gavriouchkina, D., Williams, R.M., Hochgreb-Hagele, T., Senanayake, U., Chong-Morrison, V., Thongjuea, S., Repapi, E., Mead, A., Sauka-Spengler, T., 2018. From pioneer to repressor: bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo. Dev. Cell 47, 608–628.
    OpenUrlCrossRef
  45. ↵
    Lush, M.E., Diaz, D.C., Koenecke, N., Baek, S., Boldt, H., St Peter, M.K., Gaitan-Escudero, T., Romero-Carvajal, A., Busch-Nentwich, E.M., Perera, A.G., Hall, K.E., Peak, A., Haug, J.S., Piotrowski, T., 2019. scRNA-Seq reveals distinct stem cell populations that drive hair cell regeneration after loss of Fgf and Notch signaling. eLife 8, e44431.
    OpenUrlCrossRef
  46. ↵
    McGinnis, S., Madden, T.L., 2004. BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32, W20–5.
    OpenUrlCrossRefPubMedWeb of Science
  47. ↵
    Metscher, B.D., Müller, G.B., 2011. MicroCT for molecular imaging: quantitative visualization of complete three-dimensional distributions of gene products in embryonic limbs. Dev. Dyn. 240, 2301–2308.
    OpenUrlCrossRefPubMed
  48. ↵
    Millimaki, B.B., Sweet, E.M., Dhason, M.S., Riley, B.B., 2007. Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development 134, 295–305.
    OpenUrlAbstract/FREE Full Text
  49. ↵
    Minařík, M., Modrell, M.S., Gillis, J.A., Campbell, A.S., Fuller, I., Lyne, R., Micklem, G., Gela, D., Pšenička, M., Baker, C.V.H., 2023. Identification of multiple transcription factor genes potentially involved in the development of electrosensory versus mechanosensory lateral line organs. bioRxiv doi: 10.1101/2023.04.14.536701.
    OpenUrlAbstract/FREE Full Text
  50. ↵
    Modrell, M.S., Baker, C.V.H., 2012. Evolution of electrosensory ampullary organs: conservation of Eya4 expression during lateral line development in jawed vertebrates. Evol. Dev. 14, 277–285.
    OpenUrlPubMed
  51. ↵
    Modrell, M.S., Bemis, W.E., Northcutt, R.G., Davis, M.C., Baker, C.V.H., 2011a. Electrosensory ampullary organs are derived from lateral line placodes in bony fishes. Nat. Commun. 2, 496.
    OpenUrlCrossRefPubMed
  52. ↵
    Modrell, M.S., Buckley, D., Baker, C.V.H., 2011b. Molecular analysis of neurogenic placode development in a basal ray-finned fish. genesis 49, 278–294.
    OpenUrlCrossRefPubMedWeb of Science
  53. ↵
    Modrell, M.S., Lyne, M., Carr, A.R., Zakon, H.H., Buckley, D., Campbell, A.S., Davis, M.C., Micklem, G., Baker, C.V.H., 2017a. Insights into electrosensory organ development, physiology and evolution from a lateral line-enriched transcriptome. eLife 6, e24197.
    OpenUrlCrossRefPubMed
  54. ↵
    Modrell, M.S., Tidswell, O.R.A., Baker, C.V.H., 2017b. Notch and Fgf signaling during electrosensory versus mechanosensory lateral line organ development in a non-teleost ray-finned fish. Dev. Biol. 431, 48–58.
    OpenUrlCrossRef
  55. ↵
    Mogdans, J., 2019. Sensory ecology of the fish lateral-line system: Morphological and physiological adaptations for the perception of hydrodynamic stimuli. J. Fish Biol. 95, 53–72.
    OpenUrlCrossRef
  56. ↵
    Moser, T., Grabner, C.P., Schmitz, F., 2020. Sensory processing at ribbon synapses in the retina and the cochlea. Physiol. Rev. 100, 103–144.
    OpenUrl
  57. ↵
    Mukhopadhyay, M., Pangrsic, T., 2022. Synaptic transmission at the vestibular hair cells of amniotes. Mol. Cell. Neurosci. 121, 103749.
    OpenUrl
  58. ↵
    Nicolson, T., 2017. The genetics of hair-cell function in zebrafish. J. Neurogenet. 31, 102–112.
    OpenUrlCrossRefPubMed
  59. ↵
    Northcutt, R.G., 1997. Evolution of gnathostome lateral line ontogenies. Brain Behav. Evol. 50, 25–37.
    OpenUrlCrossRefPubMedWeb of Science
  60. ↵
    Northcutt, R.G., Catania, K.C., Criley, B.B., 1994. Development of lateral line organs in the axolotl. J. Comp. Neurol. 340, 480–514.
    OpenUrlCrossRefPubMedWeb of Science
  61. ↵
    O’Neill, P., McCole, R.B., Baker, C.V.H., 2007. A molecular analysis of neurogenic placode and cranial sensory ganglion development in the shark, Scyliorhinus canicula. Dev. Biol. 304, 156–181.
    OpenUrlCrossRefPubMedWeb of Science
  62. ↵
    Papalopulu, N., Kintner, C., 1996. A posteriorising factor, retinoic acid, reveals that anteroposterior patterning controls the timing of neuronal differentiation in Xenopus neuroectoderm. Development 122, 3409–3418.
    OpenUrlAbstract
  63. ↵
    Pauley, S., Lai, E., Fritzsch, B., 2006. Foxg1 is required for morphogenesis and histogenesis of the mammalian inner ear. Dev. Dyn. 235, 2470–2482.
    OpenUrlCrossRefPubMedWeb of Science
  64. ↵
    Pickett, S.B., Raible, D.W., 2019. Water waves to sound waves: using zebrafish to explore hair cell biology. J. Assoc. Res. Otolaryngol. 20, 1–19.
    OpenUrlCrossRefPubMed
  65. ↵
    Piotrowski, T., Baker, C.V.H., 2014. The development of lateral line placodes: Taking a broader view. Dev. Biol. 389, 68–81.
    OpenUrlCrossRefPubMed
  66. ↵
    Roccio, M., Senn, P., Heller, S., 2020. Novel insights into inner ear development and regeneration for targeted hearing loss therapies. Hear. Res. 397, 107859.
    OpenUrl
  67. ↵
    Singh, S., Groves, A.K., 2016. The molecular basis of craniofacial placode development. WIREs Dev. Biol. 5, 363–376.
    OpenUrl
  68. ↵
    Square, T., Romášek, M., Jandzik, D., Cattell, M.V., Klymkowsky, M., Medeiros, D.M., 2015. CRISPR/Cas9-mediated mutagenesis in the sea lamprey Petromyzon marinus: a powerful tool for understanding ancestral gene functions in vertebrates. Development 142, 4180–4187.
    OpenUrlAbstract/FREE Full Text
  69. ↵
    Square, T.A., Jandzik, D., Massey, J.L., Romášek, M., Stein, H.P., Hansen, A.W., Purkayastha, A., Cattell, M.V., Medeiros, D.M., 2020. Evolution of the endothelin pathway drove neural crest cell diversification. Nature 585, 563–568.
    OpenUrl
  70. ↵
    Stundl, J., Soukup, V., Franěk, R., Pospisilova, A., Psutkova, V., Pšenička, M., Cerny, R., Bronner, M.E., Medeiros, D.M., Jandzik, D., 2022. Efficient CRISPR mutagenesis in sturgeon demonstrates its utility in large, slow-maturing vertebrates. Front. Cell Dev. Biol. 10, 750833.
    OpenUrl
  71. ↵
    Tasdemir-Yilmaz, O.E., Druckenbrod, N.R., Olukoya, O.O., Dong, W., Yung, A.R., Bastille, I., Pazyra-Murphy, M.F., Sitko, A.A., Hale, E.B., Vigneau, S., Gimelbrant, A.A., Kharchenko, P.V., Goodrich, L.V., Segal, R.A., 2021. Diversity of developing peripheral glia revealed by single-cell RNA sequencing. Dev. Cell 56, 2516–2535.
    OpenUrlCrossRefPubMed
  72. ↵
    Toresson, H., Martinez-Barbera, J.P., Bardsley, A., Caubit, X., Krauss, S., 1998. Conservation of BF-1 expression in amphioxus and zebrafish suggests evolutionary ancestry of anterior cell types that contribute to the vertebrate telencephalon. Dev. Genes Evol. 208, 431–439.
    OpenUrlCrossRefPubMedWeb of Science
  73. ↵
    Uribe-Salazar, J.M., Kaya, G., Sekar, A., Weyenberg, K., Ingamells, C., Dennis, M.Y., 2022. Evaluation of CRISPR gene-editing tools in zebrafish. BMC Genomics 23, 12.
    OpenUrl
  74. ↵
    Webb, J.F., 2021. Morphology of the mechanosensory lateral line system of fishes, in: B. Fritzsch (Ed.), The Senses: A Comprehensive Reference. Elsevier, pp. 29–46.
  75. ↵
    Whitear, M., 1989. Merkel cells in lower vertebrates. Arch. Histol. Cytol. 52 Suppl., 415–422.
    OpenUrlCrossRefPubMedWeb of Science
  76. ↵
    Wu, X., Kriz, A.J., Sharp, P.A., 2014. Target specificity of the CRISPR-Cas9 system. Quant. Biol. 2, 59–70.
    OpenUrl
  77. ↵
    York, J.R., Zehnder, K., Yuan, T., Lakiza, O., McCauley, D.W., 2019. Evolution of Snail-mediated regulation of neural crest and placodes from an ancient role in bilaterian neurogenesis. Dev. Biol. 453, 180–190.
    OpenUrl
  78. ↵
    Yu, H.V., Tao, L., Llamas, J., Wang, X., Nguyen, J.D., Trecek, T., Segil, N., 2021. POU4F3 pioneer activity enables ATOH1 to drive diverse mechanoreceptor differentiation through a feed-forward epigenetic mechanism. Proc. Natl. Acad. Sci. U.S.A. 118, e2105137118.
    OpenUrlAbstract/FREE Full Text
  79. ↵
    Zhang, S., Zhang, Y., Dong, Y., Guo, L., Zhang, Z., Shao, B., Qi, J., Zhou, H., Zhu, W., Yan, X., Hong, G., Zhang, L., Zhang, X., Tang, M., Zhao, C., Gao, X., Chai, R., 2019. Knockdown of Foxg1 in supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse cochlea. Cell. Mol. Life Sci. 77, 1401–1419.
    OpenUrl
  80. ↵
    Zhang, Y., Zhang, S., Zhang, Z., Dong, Y., Ma, X., Qiang, R., Chen, Y., Gao, X., Zhao, C., Chen, F., He, S., Chai, R., 2020. Knockdown of Foxg1 in Sox9+ supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse utricle. Aging (Albany NY) 12, 19834–19851.
    OpenUrl
  81. ↵
    Zhao, X.-F., Suh, C.S., Prat, C.R., Ellingsen, S., Fjose, A., 2009. Distinct expression of two foxg1 paralogues in zebrafish. Gene Expr. Patterns 9, 266–272.
    OpenUrlCrossRefPubMed
Back to top
Posted January 03, 2024.
Download PDF

Supplementary Material

Email
Atoh1 is required for the formation of lateral line electroreceptors and hair cells, whereas Foxg1 represses an electrosensory fate
Martin Minařík, Alexander S. Campbell, Roman Franěk, Michaela Vazačová, Miloš Havelka, David Gela, Martin Pšenička, Clare V. H. Baker
bioRxiv 2023.04.15.537030; doi: https://doi.org/10.1101/2023.04.15.537030
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area