New Results

A transmission chain linking Mycobacterium ulcerans with Aedes notoscriptus mosquitoes, possums and human Buruli ulcer cases in southeastern Australia

Peter T. Mee, Andrew H. Buultjens, Jane Oliver, Karen Brown, Jodie C. Crowder, Jessica L. Porter, Emma C. Hobbs, Louise M. Judd, George Taiaroa, Natsuda Puttharak, Deborah A. Williamson, Kim R. Blasdell, Ee Laine Tay, Rebecca Feldman, Mutizwa Odwell Muzari, Chris Sanders, Stuart Larsen, Simon R. Crouch, Paul D. R. Johnson, John R. Wallace, David J. Price, Ary A. Hoffmann, Katherine B. Gibney, Timothy P. Stinear, Stacey E. Lynch
doi: https://doi.org/10.1101/2023.05.07.539718

Abstract

In temperate southeastern Australia over the past two decades there has been a marked progressive increase in human cases of Buruli ulcer, an infection of subcutaneous tissue caused by Mycobacterium ulcerans. Native possums are the major local environmental reservoir of M. uclerans as they not only develop Buruli lesions but they also shed M. ulcerans in their excreta. However the way humans acquire M. ulcerans from possums has not been determined. Previous case-control studies, insect field surveys and vector competence studies have suggested a role for mosquitoes in M. ulcerans transmission between possums and humans. To explore these links we conducted an extensive, 4-month structured mosquito field survey and four ad hoc field surveys across an area of 350km2 on the Mornington Peninsula, an area endemic for Buruli ulcer. We then compared spatial and temporal patterns of M. ulcerans-positive mosquito occurrence with M. ulcerans-positive possums (established by previous possum excreta surveys) and human Buruli ulcer cases across the region. We used metabarcoding to assess mosquito blood-feeding host preference and to reconstruct M. ulcerans genomes from positive mosquitoes to test epidemiological inferences. We collected 66,325 mosquitoes spanning 26 different species from 180 repeatedly sampled traps over a 4-month peri oCdul.ex molestus and Aedes notoscriptus were the dominant species (42% and 35% of trapped mosquitoes, respectively). PCR screening 25% of trapped mosquitoes revealed a significant association between M. ulcerans and Ae. notoscriptus (p<0.0001) with a maximum likelihood estimate (MLE) of 5.88 M. ulcerans positive mosquitoes per 1,000 tested. Using spatial scanning statistics, we also observed significant overlap between clusters of M. ulcerans-positive Ae. notoscriptus, M. ulcerans-positive possum excreta and human Buruli ulcer cases. Metabarcoding analyses of blood-fed Ae. notoscriptus showed individual mosquitoes had fed both on humans and native possums. Enrichment genome sequencing from PCR-positive mosquitoes confirmed identical M. ulcerans genome single-nucleotide polymorphism (SNP) profiles between insects, possums and clinical human isolates within the same regions. These findings indicate that certain mosquito species likely transmit M. ulcerans in southeastern Australia and highlight mosquito control as a plausible means to control the Buruli ulcer epidemic in our region.

Introduction

Mycobacterium ulcerans is the causative agent of a neglected tropical skin disease called Buruli ulcer, a necrotising infection of skin and subcutaneous tissue1. Buruli ulcer is rarely a fatal condition but can cause severe tissue destruction if not diagnosed and managed effectively2. Buruli ulcer has been described in more than 32 countries worldwide3 and is an ongoing public health issue in west and central Africa4. Buruli ulcer has also been unexpectedly surging in temperate southeastern Australia (Figure 1) and encroaching on the major metropolitan centres of Melbourne (population 5.1 million) and Geelong (population 274,000), with >250 cases routinely notified each year since 2017 to the Victorian State Government Department of Health5.

Figure 1.
Figure 1.

Location of the Mornington Peninsula and the Bellarine Peninsula of Victoria, Australia. Population density is represented on the map from low to high (white to red) based on the human population per square kilometre.

How humans contract Buruli ulcer is a central question that has intrigued scientists and confounded public health control efforts since the discovery of M. ulcerans from patients in the Bairnsdale region of Australia in the 1930s and across Africa shortly after 1, 6, 7. Buruli ulcer epidemiology can be unpredictable, with outbreaks emerging in specific geographical areas and then disappearing over a number of years. M. ulcerans has a 4-5 month median incubation period. It is very challenging to isolate the bacterium in pure culture from the environment, presumably due to its very slow growth, although it can be isolated from human skin lesions. These factors combined have made it incredibly challenging to establish how M. ulcerans is spread to humans, despite global efforts to investigate this over more than 80 years 8.

The discovery that Buruli ulcer is a zoonosis and that Australian native possums are a major wildlife source of M. ulcerans that is intimately linked with disease transmission has addressed one key component of the transmission enigma 9–14. The role of mosquitoes as vectors spreading M. ulcerans from possums to humans (and between possums) is the subject of the research presented in this current study. The first indications that mosquitoes might be vectors of M. ulcerans from possums to humans in Australia came from a series of entomological field surveys in the southeast of the country in response to an increase in Buruli ulcer cases in the seaside township of Point Lonsdale, located on the Bellarine Peninsula 15. Among the 12 species identified from a trapping effort that collected 11,500 mosquitoes, five different species were IS2404 PCR positive for M. ulcerans, including Aedes camptorhynchus, Aedes notoscriptus, Coquillettidia linealis, Culex australicus, and Anopheles annulipes (maximum likelihood estimate (MLE) was 4.11/1000 mosquitoes) 15. Note that IS2404 is a M. ulcerans specific insertion sequence and molecular target for the gold-standard diagnostic PCR for Buruli ulcer 16.

A concurrent case control study performed in the same geographic area identified only two factors associated with the odds of being diagnosed with Buruli ulcer: insect repellent use (OR 0.37, 95% CI 0.19–0.69) and being bitten by mosquitoes on the lower legs (OR 2.60, 95% CI 1.22–5.53). A variety of outdoor activities were also surveyed but were not independently predictive suggesting that mosquito exposure specifically rather than environmental exposure generally might be the main mode of MU transmission to humans 17. In Africa, two case control studies conducted in Cameroon both found use of bed nets as a protective factor against Buruli ulcer, (OR 0.4, 95% CI 0.2-0.9, p=0.04) 18 and (OR 0.1, 95% CI 0.03-0.3, p<0.001) 19.

However, case control studies and entomological surveys alone are insufficient to indict biological agents as vectors of pathogens. There are formal frameworks used in biomedicine, such as the Barnett criteria 3 that build hierarchies of evidence to implicate a candidate disease vector. Here, we build on this aforementioned research to formally address the Barnett criteria, and test the hypothesis that mosquitoes are vectors of M. ulcerans to humans 20–22. A summary of our findings is shown in Table 1, including the new data presented in this study that specifically address criteria 1-3.

View this table:
Table 1:

Summary of evidence to indict mosquitoes as vectors of M. ulcerans

In the research presented here, based on a very substantial field survey of >65,000 mosquitoes undertaken over four months in 2019 and 2020, and four smaller ad hoc surveys conducted between 2016 and 2021, we employed spatial clustering analyses, bacterial enrichment genome sequencing and mosquito blood meal metabarcoding to continue building a hierarchy of evidence that implicates mosquitoes as vectors of M. ulcerans from local wildlife sources to humans.

Material and methods

Study Site

Insects were collected from the Mornington Peninsula suburbs of Rye (population 8,416), Blairgowrie (population 2,313), Tootgarook (population 2,869) and Capel Sound (population 4,930) 23. The study area encompasses an area of 350 km2 and is located 90 km south of Melbourne, the capital city of Victoria 10 (Figure 1). The area was originally covered in low-lying coastal vegetation 10, receives an average annual rainfall of 740 mm, and an elevation of 60 metres above sea-level 24. The Mornington Peninsula region continues to maintain among the highest incidences of Buruli ulcer in the world 25 with a conservative local incidence estimate of 55 human cases/100,000 population in 20225,26.

Arthropod collection and identification

Mosquito trapping campaigns used Biogent Sentinal (BGS) traps (Biogent) that were baited with dry ice pellets to provide a source of carbon dioxide over an intended 12-hour period. BGS traps were set out at dusk and collected at dawn in shaded locations on the grassed edges of the roadways in the study area. GPS locations for all traps were recorded. Trapped mosquitoes were knocked down with CO2 by placing the catch-bag in dry ice before being transported back to the laboratory and kept at −20°C until processing. Mosquito species were morphologically identified using a stereo dissecting microscope (Nikon, SMZ800N) and reference to taxonomic keys 27–29.

Other (non-mosquito) arthropods were collected using Yellow Sticky Traps (YST) and Sticky Ovitraps (SO). Two YST and SO were placed in residential properties where householders had previously noted insect activity to the researchers 9. The SO traps were placed on the ground and had hay grass infusion (3 Jack Rabbit (clover/lucerne) pellets (Laucke Mills, Barossa Valley, SA, Australia) in 500 mL water) added to them, while the YST (Bugs for Bugs, Toowoomba, QLD, Australia) were placed on the ground with a 14 cm plant tag plastic T-support (Garden City Plastics, Dandenong, VIC, Australia). Within three to four days of being set, residents were asked to pack up the YST and SO by covering the sticky card with a plastic film, and return the sealed traps to the laboratory, where they were stored at −20°C. Non-mosquito arthropods were morphologically identified to family level and, if PCR positive for M. ulcerans, were DNA barcoded for species confirmation by targeting the cytochrome c oxidase subunit I (COI) gene 30.

DNA extraction from mosquitoes

Mosquitoes were sorted by species per trap and by sex and then pooled in 2 mL o-ring tubes, with a maximum of 15 individuals in each pool. A subset of Ae. notoscriptus mosquitoes were also screened individually. Mosquitoe(s) were homogenised with 10 x 1.0 mm zirconia-silica beads (BioSpec Products), with 597 µL of Buffer RLT and 2.8 µL of carrier RNA. Homogenisation was performed using a TissueLyser II (Qiagen) at 30 oscillations/sec for 100 sec, repeated twice. Tubes were then centrifuged at 16,000 g for 3 mins. A 550 µL volume of supernatant was transferred into a 96 well deep well plate, with extraction performed as is the protocol for the BioSprint 96 One-For-All Vet Kit (Qiagen). Every eleventh of twelve wells in a 96-well plate was a blank DNA extraction control (seven in total) and a synthetic IS2404 positive control was spiked into one of these seven wells to act as a positive extraction control. Extraction was performed on a KingFisherTM Flex Magnetic Particle Processors (Thermo Scientific).

DNA extraction from arthropods

Arthropods other than mosquitoes collected on YST or SO were removed from the sticky cards and placed in 1.5 mL microtubes (Eppendorf). Insects were separated by family and trap location, and were pooled with a maximum of 10 individuals from each family per 1.5 mL tube. Samples were extracted non-destructively to allow species confirmation if positive detections occurred. DNA was extracted using the ISOLATE II Genomic DNA Kit (Bioline). Briefly, 25 µL of Proteinase K and 180 µL of Lysis Buffer GL was added to each tube with samples incubated overnight at 56°C. Following incubation, the insects were removed and stored to allow for further morphological identification if required, with the DNA extraction completed on the incubation solution as per manufacturer instructions.

Synthetic PCR positive control

A synthetic PCR positive control DNA molecule was designed to discriminate false positives due to contamination with positive control DNA versus the authentic IS2404 amplicon. The synthetic positive control was designed to have an amplicon size of 120 bp to easily differentiate from a true IS2404 PCR positive (59 bp) 16. The synthetic positive was added at the DNA extraction stage on all 96-well plates, as a positive control for this step and for the subsequent qPCR. The additional DNA sequence used to construct the synthetic positive control was randomly selected from a DNA sequence unlikely to be in the laboratory, in this case, Irrawaddy Dolphin (MK032252).

The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM, with 2 µL being used for extraction and positive controls. To confirm the presence of a true positive as opposed to contamination, 5 µL of the qPCR product was added to 1 µL of DNA Gel Loading Dye 6X (Thermo ScientificTM) and run on a 2 % agarose gel (TopVision Agarose Tablets, Thermo ScientificTM), with 1% SYBR Safe DNA Gel Stain (InvitrogenTM). The size of any positive IS2404 detection was assessed against 2 µL of 100 bp DNA Ladder (Promega) and run at 50 V for 1.5 hrs before being visualised with an EZ Gel Documentation System (Bio-Rad). Before the screening of insects commenced, the synthetic positive control for IS2404 was successfully designed and tested. By running the amplified PCR products on an agarose gel with the synthetic positive control and a real positive control, visual differentiation between a synthetic positive occurring at 120 bp and a true positive at 59 bp (Figure S1).

Screening insects by qPCR for M. ulcerans

The qPCR screening was performed using three independent assays IS2404, IS2606 and KR 16. All samples were first screened with the IS2404 qPCR; if a positive was detected, additional confirmation was attempted with IS2606 and KR qPCR assays. Reactions were performed using 7.5 µL TaqManTM Fast Universal PCR Master Mix (2X), no AmpEraseTM UNG (Applied BiosystemsTM), 1 µL of the primer-probe mix, 2 µL of DNA and 4.5 µL of nuclease-free water. A final primer-probe concentration for the IS2404 assay was as follows: 250:650:450nM for the forward primer, reverse primer and probe and 800:800:220nM for the forward primer, reverse primer and probe for the IS2606 and KR assay. A 2 µL volume of the synthetic positive control was added for the IS2404 reactions, whereas 2 µL of M. ulcerans DNA was used for IS2606 and KR. All reactions included six no-template extraction controls and were run in a 96 well plate format. Cycling conditions were as follows: denaturation at 95°C for 2 mins followed by 45 cycles at 95°C for 10 sec and 60°C for 30 sec, with qPCR performed on a QuantStudioTM 5 Real-Time PCR System (Applied BiosystemsTM). Positives were classified as reactions that produced a cycle quantification (Cq) value less than 40. Data were analysed using the QuantStudioTM Design and Analysis Software v1.4.3 with the Delta Rn threshold set at 0.04 for IS2404 and IS2606 and Delta Rn threshold of 0.1 for KR. The maximum likelihood estimate (MLE) per 1,000 mosquitoes tested (bias corrected MLE for point estimation of infection rate and a skew-corrected score confidence intervals) was calculated from the pooled samples as described 31. Fisher’s Exact test for assessing the significance of differences in IS2404 PCR positivity between mosquito species was calculated in R 4.0.2 32.

All qPCR screening was performed blind with mixed-species 96-well plates. The synthetic positive control was added at the DNA extraction phase to one well of each plate and to qPCR plates to check that both extraction and qPCR detections were successful. All no-template controls (extraction and qPCR stage) were checked to ensure they remained negative, and that synthetic positive controls were detected for both the DNA extraction and qPCR stage in each run. Positive samples were run on agarose gels to confirm they were true positives and not contamination from the synthetic positive control.

An IS2404 qPCR standard curve was prepared using 10-fold serial dilutions of M. ulcerans genomic DNA, with quadruplicate testing of each dilution. The DNA was extracted from M. ulcerans JKD8049 as described, and quantified using fluorimetry (Qubit, dsDNA HS ThermoFisher Scientific) 22. A limit-of-detection was defined as the lowest dilution that returned a positive signal for all four replicates. Genome equivalents were calculated based on the estimated mass of the M. ulcerans genome of 5.7 femtograms 22. IS2404 cycle threshold (Ct) values were converted to genome equivalents (GE) to estimate bacterial load within a sample by reference to a standard curve (r2 = 0.9956, y = [-3.829Ln(x)+37.17]*Z, where y = Ct and x = amount of DNA [fg] and Z = the dilution factor]) (Figure S2). An IS2404 qPCR standard curve was fitted using non-linear regression in GraphPad Prism (v9.5.1).

Mycobacterium ulcerans genome sequencing

Whole-genome sequencing was performed directly on DNA extracted from selected PCR positive mosquito samples and possum excreta specimens using a hybridisation capture approach, based on 120 nucleotide RNA baits spanning the 5.8 Mbp chromosome of the the M. ulcerans JKD8049 reference genome [Bioproject ID: PRJNA771185] (Datafile S1) (SureSelect Target enrichment system, Agilent, Santa Clara, CA, USA) and the Illumina Nextera Flex for Enrichment with RNA Probes protocol 33. Resulting sequence reads were submitted to NCBI GenBank and are available under Bioproject PRJNA943595 (Table S2).

Mycobacterium ulcerans phylogenetic analysis

To compare genomic variations between clinical isolates and sequence capture datasets, we mapped the sequence reads against a fully assembled M. ulcerans chromosome reconstructed from a Victorian clinical isolate (JKD8049; GenBank accession: NZ_CP085200.1) using the Snippy pipeline (v4.4.5) (https://github.com/tseemann/snippy). While standard parameters, including a minimum coverage of 10x were used for the clinical isolates and single possum sequence capture dataset, the mosquito sequence capture datasets had lower coverage, necessitating the adjustment of parameters. Thus, we lowered the minimum coverage threshold to 1x to facilitate SNP calling for the mosquito sequence capture datasets. The resulting SNPs were combined with those from the clinical isolates to generate an alignment of core genome SNPs, which was used to infer a maximum likelihood tree with the GTR model of nucleotide substitution using FastTree (v2.1.10) 34.

Aedes notoscriptus typing and species confirmation sequencing

Mosquito genotyping was performed by sequence comparisons of a partial fragment of the cytochrome c oxidase subunit I (COI) gene 30. DNA was extracted using the above protocols. PCR was performed using 5 µL of 5x MyFi Reaction Buffer, 1 µL of MyFi DNA polymerase, 5 µL of DNA, and primer concentrations as described 35, with reaction made up to 25 µL with nuclease-free water. Reaction conditions were as follows for COI, initial denaturation at 95 °C for 1 min, followed by 35 cycles at 95°C for 20 sec, 46°C for 20 sec, and 72°C for 60 sec before a final extension at 72°C for 5 mins. A 5µL volume of the amplified PCR product was added to 1 µL of DNA Gel Loading Dye 6X (Thermo ScientificTM) and run on a 1 % agarose gel (TopVision Agarose Tablets, Thermo ScientificTM), with 1% SYBR Safe DNA Gel Stain (InvitrogenTM). 2 µL of 100 bp DNA Ladder (Promega) was added to confirm amplicons size and run at 100 V for 45 mins. PCR products that produced bands of the correct size were purified using the ISOLATE II PCR and Gel Kit (Bioline) as per manufacturer’s protocol and submitted for sequencing using an Applied Biosystems 3730xl capillary analyser (Macrogen), with sequencing occurring on both strands.

Sequences were analysed in Geneious Prime (v2019.2.1) and trimmed to high-quality bases, aligned using ClustalW v2.1 and trimmed to a consensus region, Ae. notoscriptus COI (874 bp) and for species identification COI (816-882 bp). Sequences were analysed using blastn against the NCBI database. COI sequences generated for species identification are available under accession numbers OQ600123-4 and COI sequences for Ae. notoscriptus phylogenetics under accession numbers OQ588831-67 (Table S2).

Mosquito bloodmeal analysis

Ninety blood-fed mosquitoes were identified as having an engorged abdomen and stilling having a red pigment indicating a fresh bloodmeal and were dissected with a sterile scalpel blade. Blood from the dissected abdomen was absorbed onto a 3 x 20 mm piece of a Whatman FTATM card (Merck) and placed in a 2 mL tube. DNA was extracted from the FTATM card using an ISOLATE II Genomic DNA Kit (Bioline) with a pre-lysis in 180 µL of Lysis Buffer GL and 25 µL Proteinase K for 2 hours before completing the extraction as per manufacturer’s protocol. Extracted DNA was amplified for Cyt b using primers previously described (Townzen et al. 2008), with MyTaqTM HS Red Mix (Bioline), thermocycling conditions used were as follows: 95°C for 1 min, 30 cycles of 95°C for 15 secs, 50°C for 20 sec, 72°C for 20 sec, with a final extension at 72°C for 2 mins. Negative extraction and negative PCR controls were included with each PCR reaction. 5 µL of the amplified products was run on a 1% agarose gel containing 0.1% SYBR Safe DNA gel stain (Invitrogen) and visualised with a G:BOX Syngene blue light visualisation instrument. If a band was visualised at ∼480 bp the PCR product was purified using an ISOLATE II PCR and Gel Kit (Bioline).

PCR products were quantified using a Qubit (Invitrogen) Fluorometer with an HS dsDNA kit. Sequencing libraries were prepared using 10 ng of purified PCR product with a NEXTFLEX® Rapid XP DNA-Seq Kit (PerkinElmer) barcoded using NEXTFLEX® UDI Barcodes (PerkinElmer). As a result, 70 bloodmeal libraries were sequenced, as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.

Sequence data were analysed by identifying poor-quality reads using Rcorrector (Song & Florea, 2015) and removed with TrimGalore v0.6.5 (Krueger 2019). De novo assembly was performed on the remaining sequence reads using Trinity v2.8.6 (Grabherr et al., 2011). The resulting contigs were filtered to be between 400-480bp and analysed using BLASTN (Altschul et al. 1990) against the nucleotide database publicly available on the National Centre for Biotechnology Information (NCBI) website. The resulting hits were filtered to exclude those sequences which had < 97% sequence identity to the database. Contigs identified as a host bloodmeal were confirmed by mapping raw reads using BWA-MEM v0.7.17 (Li & Durbin, 2009). Sequence reads were submitted to Genbank (Table S2).

Mosquito phylogenetic analysis

Phylogenetic analysis was performed on trimmed consensus regions of Ae. notoscriptus COI. The substitution model was selected using jModelTest2 v2.1.10, with the topology taking the best of nearest neighbour interchange, subtree pruning and regrafting 36. The most appropriate substitution model was selected based on the Akaike information criterion. Maximum-likelihood trees were constructed in PhyML v3.3.2 with 1,000 bootstrap replicates; the gamma distribution parameter was used to estimate rate variation across sites 37. The Hasegawa-Kishino-Yano (HKY) substitution model was selected for the COI tree.

Geographical data acquisition and spatial cluster analysis

The population map was created in qGIS v2.18.20 38, using a 1 km2 population grid 39 with 2011 Victorian mesh block data. Since 2004, Buruli ulcer has been a notifiable condition in Victoria, requiring Health Department reporting by doctors and laboratories. De-identified case notification data of Buruli ulcer patients who had laboratory-confirmed M. ulcerans infection and who lived on the Mornington Peninsula during the years 2019-2020 were provided by the Victorian Department of Health. The cases were defined as patients with a clinical lesion that was diagnosed using IS2404 qPCR and culture 16. To conduct high-resolution spatial analyses, the data were aggregated at the mesh block level, the smallest geographical census units which typically contain 30-60 dwellings. The 2011 Victorian mesh block boundaries and the Victorian mesh block census population counts datasets were obtained from the Australian Bureau of Statistics (ABS) website 40. The datasets were joined using the unique mesh block IDs using the QGIS v.3.16.7 geographic information system software 41. The latitude and longitude (projected in GDA94) were derived from the centroids of the mesh block polygon. The dataset was then down-sampled to include only the Mornington Peninsula study area, specifically the Point Nepean and Rosebud-McCrae ABS level 2 Statistical Area.

SaTScan version 10.1.0 42 was utilised to identify spatial clusters among trapped mosquitoes positive for M. ulcerans, possum excreta positive for M. ulcerans, and human Buruli ulcer cases. The software searches for instances where the observed number of spatial incidences exceeds the expected number within a circular window of varying size across a defined study area. A log likelihood ratio statistic is calculated for each window by comparing the number of observed and expected cases inside and outside the circle against the assumption of randomly distributed cases. In addition to the most likely cluster, there are usually secondary clusters with almost as high likelihood that substantially overlap with the primary clusters. These secondary clusters can be indicative of sub-clusters within the primary cluster or potentially distinct clusters that are spatially adjacent to the primary cluster. The Mornington Peninsula surveillance data used in these analyses consisted of trapped mosquitoes (177 traps screened for IS2404 collected: 12/11/19 to 20/03/20), M. ulcerans detected in possum excreta collected during the summer (December to February) of 2019 using data from a previous study 43 and notified human Buruli ulcer cases from the study area in the years 2019-2020. The use of possum excreta collected during the summer was appropriate as Buruli ulcer transmission is most likely to occur during that time of year 44, 45. For each of the three data sources (trapped mosquitoes, possum excreta, and human cases), the null hypothesis assumes that M. ulcerans detections or Buruli ulcer cases are uniformly distributed across the study area, where the alternative hypothesis suggests that there may be certain locations with higher rates than expected if the risk was evenly distributed. Primary and secondary clusters were accepted only if the secondary clusters did not overlap with previously reported clusters with a higher likelihood. Given that the trapped mosquito and possum excreta IS2404 PCR results were binary (positive or negative), a Bernoulli model was used to scan for spatial clusters, with the maximum cluster size set to 50% of the population size. The human Buruli ulcer case data aggregated at the mesh block level varied in number, with some mesh blocks having zero cases and others having one or more. We applied the Poisson probability model to the notified Buruli ulcer case counts, using a background population at risk that was derived from the 2011 population census. The maximum cluster size was limited to 14,481 individuals, 10% of the total population at risk. To determine the likelihood of a triple-cluster overlap between the three SaTScan analyses occurring by chance, we conducted a permutation test (https://github.com/abuultjens/BU-3-way-SatScan). In each of 10,000 iterations, the geographical coordinates for each variable were randomly shuffled. The number of SaTScan clusters with triple overlap was determined using the ‘sf’ package 46 in the R statistical programming language 47.

Results

Mosquito surveys of the Mornington Peninsula

A primary goal of this research was to test the hypothesis that mosquitoes are associated with M. ulcerans transmission, as reflected by IS2404 PCR positivity at a certain frequency in areas of the Mornington Peninsula with human Buruli ulcer cases. A total of 73,580 mosquitoes were collected, consisting of 72,263 females (Table 2) and 1,317 males (Table S2). The majority (90%) of these insects were collected in the large survey of 2019-2020 (Datafile S2). Across all five surveys, 26 different mosquito species were collected covering six genera (Table 2). The most dominant species identified during the 2019-2020 survey was Cx. molestus accounting for 42% of mosquitoes, followed by Ae. notoscriptus (35%) and Cx. australicus (8%). Twenty-three other species comprised the remaining 15% of mosquitos. The distribution of the two dominant species across the survey area is shown in Figure 2. This mapping revealed an asymmetric distribution of each species, with Ae. notoscriptus dominant to the eastern end and Cx. molestus dominant towards the western end of the Peninsula (Figure 2).

Figure 2.
Figure 2. Dominant mosquito species distribution across the Mornington Peninsula.

Map showing the proportional distribution of the two dominant mosquito species trapped during 2019/2020. The pie charts are an aggregation of the 180 different trap sites. Trap groups containing mosquitoes that were PCR positive for M. ulcerans are also indicated. Shown too, are the meshblock statistical areas, with those in red containing at least one human Buruli ulcer case diagnosed in 2019-2020.

View this table:
Table 2.

Female mosquitoes trapped on the Mornington Peninsula and screened by IS2404 PCR.

M. ulcerans PCR positive mosquitoes were predominantly Aedes notoscriptus

The IS2404 qPCR assay was used to infer the presence of M. ulcerans in association with mosquitoes. Of the 73,580 mosquitoes trapped across all years, 18,610 (25%) were screened by IS2404 qPCR for the presence of M. ulcerans (Table 2). Mycobacterium ulcerans qPCR positives were observed in 53 pools or individuals of Ae. notoscriptus, with detections occurring in each year across all survey events (Figure 2, Table 2). Only one other mosquito species tested IS2404 positive, which was a two-insect pool of Ae. camptorhynchus (Table 3). The positive association between M. ulcerans and Ae. notoscriptus compared to other mosquitoes, in particular the other abundant mosquito species, Culex molestus, was highly significant (P <0.0001, Fisher’s exact test).

View this table:
Table 3.

The number of M. ulcerans positive pools tested by insertion sequence IS2404 qPCR and Maximum likelihood estimate (MLE) of M. ulcerans per 1,000 mosquitoes trapped in the Mornington Peninsula.

Subsets of Ae. notoscriptus were screened individually to better estimate the prevalence of M. ulcerans positive mosquitoes in this species. Individually tested mosquitoes included all of the 2017/2018 collection (367/367 individuals with 8 positives), 448/4,330 of the 2019/2020 collection with 3 positives, and all 1,247 individuals of the 2021 collection with 7 positives (Table S3). Thus, based on screening individual insects, 18/2,062 (0.87%) Ae. notoscriptus were IS2404 PCR positive. All other Ae. notoscriptus and other mosquito species in this study were screened in pools (up to 15 insects per pool) with 24/747 Ae. notoscriptus pools (3%), PCR positive (Table S4).

Of the 46 Ae. notoscriptus that tested positive for IS2404, 26 (56%) were confirmed positive for IS2606 and 31 (67%) for KR, with 24 (52%) pools positive by all three qPCR assays (Table S3). Of the 46 IS2404 positive Ae. notoscriptus, eight (17%) pools were not tested using the IS2606 assay and one (2%) pool using the KR assay due to limited template DNA available. The average Ct value for IS2404 positive Ae. notoscriptus was 36.00 (range 29.74-39.65). The average Ct value for IS2606 was 37.73 (range 32.49-45.00), and the average Ct value for KR was 34.19 (range 28.52-39.26). With reference to an IS2404 qPCR standard curve (Figure S2), we estimated the M. ulcerans burden per mosquito. The mean bacterial genome equivalents (GE) per insect was 294 GE (range: 11 – 4200) (Table S3). The MLE of estimated infection rate for all Ae. notoscriptus was 5.88 based on the IS2404 M. ulcerans qPCR-positive mosquitoes per 1,000 tested (95% CI 4.37-7.76) for all Ae. notoscriptus tested over the years and 2.96 for Ae. camptorhynchus (95% CI 0.17-14.19) (Table 3).

IS2404 PCR positive Ae. notoscriptus and possum excreta yield M. ulcerans genomic SNP profiles that match human patient isolates

Genomic epidemiological studies have shown there are unique SNP signatures associated with M. ulcerans clinical isolates from specific endemic areas in southeastern Australia 48. To test if the M. ulcerans genotype present in mosquitoes from our study area matched that found in possums and human Buruli ulcer cases in the same region, we conducted genome sequence enrichment using M. ulcerans custom RNA baits (Datafile S1). This method facilitates whole genome sequencing of target pathogen genomes in complex microbial samples or when competing background DNA precludes sequencing the target directly. As reported in other pathogen sequence enrichment studies, we observed decreasing genome sequence recovery with decreasing pathogen load, as indicated by increasing IS2404 Ct values (Figure 3A) 49. While DNA sequence reads were obtained from three mosquitoes, only DNA from one Ae. notoscriptus extract (sample ID: 5675, Ct 32.66) had a high enough concentration of M. ulcerans DNA to yield sufficient reads for SNP-calling following read mapping. Nevertheless, the fact that sequence reads mapped across the length of the M. ulcerans chromosome for all three insects, despite low coverage for two of them, confirms the presence of the pathogen on (or in) Ae. notoscriptus (Figure 3B). We also included sequence capture enrichment results for two IS2404 positive possum excreta specimens, collected as part of a large field survey of M. ulcerans in Australian native possums in the region 43. More than 500,000 reads were obtained from these samples (primary IS2404 Ct values <23). We then inferred a phylogeny, using a 5.6Mbp core-genome alignment that identified 23 SNP positions from mapping the reads from these possum excreta samples, the Ae. notoscriptus sample (ID: 5675) and a reference panel of sequence read sets from 36 published M. ulcerans genomes from southeastern Australia 48. These 36 genomes were selected because they span the population structure of M. ulcerans in this locale (Table S1). The resulting phylogeny (tree tips aligned by sample/isolate geographic origin) showed possum and mosquito M. ulcerans genotypes co-clustering with each other and with human M. ulcerans isolates from the Mornington Peninsula (north) area, with no SNP differences between them.

Figure 3.
Figure 3.

Comparison of M. ulcerans genome from human Buruli ulcer cases compared with sequences recovered from possum excreta and mosquitoes on the Mornington Peninsula. (A) Summary of IS2404 qPCR screening of primary samples and the sequence capture libraries pre- and post-enrichment. Note that possum excreta were enriched as barcoded sequence library pools so share the same pre- and post-enrichment Ct values; (B) Artemis coverage plots showing sequence capture reads mapped to the M. ulcerans JKD8409 chromosome from possum excreta samples and three qPCR positive mosquitoes; (C) Maximum-likelihood phylogeny inferred from an alignment of 23 core-genome SNPs using reads mapped to the JKD8049 reference chromosome, and with tips aligned with environmental sample or patient origin. Dataset includes reads from the five environmental samples listed in panel (A) and a reference collection of 36 M. ulcerans genomes representing the genomic diversity of the bacterial population in southeastern Australia 48. The shortest vertical branch length represents a single SNP difference.

Genetic characterisation of Ae. notoscriptus collected on the Mornington Peninsula

To assess if M. ulcerans presence was associated with a particular clade of Ae. notoscriptus on the Mornington Peninsula we compared COI gene sequences for 18 M. ulcerans positive (confirmed by all IS2404, IS2606 and KR qPCR assays) Ae. notoscriptus and 19 M. ulcerans negative Ae. notoscriptus (Figure 2). Based on the COI phylogenetic tree, Ae. notoscriptus from the Mornington Peninsula spanned the three previously identified clades and there was no association between M. ulcerans and a particular mosquito lineage (Figure S3) 35.

IS2404 PCR screening of arthropods other than mosquitoes

We also investigated the association of M. ulcerans with arthropods other than mosquitoes in the region using yellow sticky traps (YST) and sticky ovitraps (SO). A total of 21,000 specimens were collected and sorted from 278 YST and 33 SO traps. We were able to classify 2,696 as insects that may bite or pierce human skin (Table 4). Flies were the largest group collected on the sticky traps. YSTs collected more insects than the SOs, but this was proportional to the number of traps set (Table 4). Of the 2,696 insects screened by PCR, only two flies tested positive for M. ulcerans (Table S3). Both flies had high Ct values for IS2404 (Ct 35.92 and 37.54) and each sample was only confirmed for either IS2606 or KR assay (Table S3), but not with all three assays. Both insects were blowflies (Calliphora hilli Patton) based on morphology and sequencing of the COI region with sequences having >99.86 nt identity to C. hilli (Table S1).

View this table:
Table 4.

Number of arthropods collected on Yellow Sticky Traps (YST) and Sticky Ovitraps (SO) on the Mornington Peninsula that might bite or pierce human skin.

Mosquito bloodmeal analysis

Of the mosquitoes collected, a proportion of individuals identified as being engorged (bloodfed) were PCR screened and the resulting amplicon sequenced for Cytochrome B (CytB) to identify host bloodmeal sources. A total of 90 individual engorged mosquitoes were extracted, with 70 DNA preparations producing high quality amplicons that were of sufficient concentration to permit Illumina amplicon sequencing. After quality filtering, 36 individuals were identified as having had a recent bloodmeal: 14 Cx. molestu, s13 Ae. notoscriptus, 2 Ae. rubrithorax, 2 Cx. globocoxitus, 2 Cx. quinquefasciatus, 2 Cq. linealis and 1 Cx. australicus. Of the bloodmeals detected, common ringtail possum was the most commonly identified with 20 detections across the 36 samples, followed by 17 blackbirds, 13 humans, 11 red wattle birds, and 5 little wattle birds; a further 16 bloodmeals identified 10 minor host species (Figure 4, Figure S4). Dual bloodmeals were commonly identified, with 55% (20/36) of individuals having more than one bloodmeal identified. Additionally, two mosquitoes had evidence of three different bloodmeal sources within an individual insect. Three individuals (2 x Ae. notoscriptus and 1 x Ae. rubrithorax) were also identified as having dual bloodmeals from ringtail possum and human origins (Figure 4).

Figure 4.
Figure 4.

Mosquito blood meal analysis. Summary of cytochrome B (Cytb) gene sequences from the 36 bloodfed mosquitoes to identify host bloodmeal sources. A blue circle indicates positive for host blood source; the larger the circle, the more individual mosquitoes with an identical bloodmeal profile. Red boxes indicate individual mosquitoes which have dual bloodmeals for both humans and ringtail possum sources.

Spatial clustering links M. ulcerans positive mosquitoes with positive possum excreta and human Buruli ulcer cases

In our previous research, we demonstrated a spatial association between possum excreta containing M. ulcerans, as detected by structured surveys, and clusters of human Buruli ulcer cases 50. To expand on this finding, we investigated whether further spatial clustering associations could be detected by analysing qualitative qPCR (IS2404) data of trapped mosquitoes using SaTScan. Here, three separate analyses were conducted: (i) human Buruli ulcer case data from individuals reported to have acquired the disease in the study area during 2019-2020, (ii) qPCR data from possum excreta collected in a previous investigation (2018-2019), and (iii) qPCR data from trapped mosquitoes (2019-2020). These analyses identified a single mosquito cluster, four possum clusters and six human Buruli ulcer clusters (Figure 4A-B). Notably, one human Buruli ulcer cluster and two possum excreta clusters had higher numbers of observed Buruli ulcer cases or M. ulcerans detections, respectively, than expected if uniformly distributed (p-value <0.05) (Figure 4B). Importantly, the analyses revealed an instance of triple cluster overlap (mosquito/possum excreta/human) in the Mornington Peninsula suburb of Rye, where all three SaTScan analyses had an overlapping cluster (Figure 4A).

Figure 4.
Figure 4. SaTScan analyses of trapped mosquitoes, possum excreta, and human Buruli ulcer cases on the Mornington Peninsula, revealing spatial clustering.

A) Map illustrating the clusters identified by the three separate SaTScan analyses: (I) trapped mosquitoes (177 traps screened for IS2404 collected: 12.11.19 to 20.03.20), (ii) M. ulcerans detected in possum scats collected during the summer of 2019 (Dec 2018 – Feb 2019) using data from a previous study, and (iii) notified human Buruli ulcer cases from the study area in the years 2019-2020. The zoomed insert highlights an instance where all three analyses had overlapping clusters in the suburb of Rye. B) Table summarising the SaTScan results for all identified clusters. Log likelihood ratio is abbreviated as “LLR.” Clusters with p-values 〜0.05 are marked with asterisks.

The results of our permutation test to explore the probability of these three categories (mosquitoes, possums and humans) overlapping showed that a triple-cluster overlap occurred with randomly rearranged location labels at a low frequency of 8.9%. This analysis adds support to a causal relationship between the presence of M. ulcerans in possums and mosquitoes and humans contracting Buruli ulcer in the Mornington Peninsula suburb of Rye.

Discussion

Using insect field surveys augmented with genomics we have addressed Barnett Criteria 1 – 3 (Table 1) to add to a hierarchy of evidence indicting mosquitoes as principal vectors in the spread of M. ulcerans from the environment to humans 3, 15, 17, 21, 22. Our survey area was the Mornington Peninsula, where human Buruli ulcer cases have increased progressively over the past 20 years 12. Our key findings were that M. ulcerans was almost exclusively associated with one mosquito species in this region, Aedes notoscriptus, a mammalian host feeder, at a frequency of 0.87%. The estimated pathogen burden in each insect (Table S3) was consistent with the reported low infectious dose for M. ulcerans 22, 51. Pathogen genomics provided confirmation of a linked transmission chain between mosquitoes, native possums and humans in this region. The metabarcoding bloodmeal analysis of trapped mosquitoes revealed dual feeding by individual mosquitoes on both possums and humans, providing an example of a potential transmission pathway between infected possums and humans. Finally, spatial clustering analysis showed a striking overlap between clusters of possums shedding M. ulcerans, mosquitoes harbouring M. ulcerans and human Buruli ulcer cases, reinforcing the importance of possums and mosquitoes in the spread of M. ulcerans to humans.

Indications that invertebrates might be playing a role in the spread of Buruli ulcer first came from field surveys in West Africa in the late 1990s, where surveys in Benin identified water bugs in the genera Naucoris and Diplonychus as IS2404 PCR positive for M. ulcerans 15, 16, 52. Subsequent culture isolation of M. ulcerans from an aquatic insect in Benin (Gerris sp.) and potentially from Naucoris sp. in neighbouring Cote d’Ivoire further suggested a role for water bugs in disease transmission, at least in west Africa 53, 54. A role for mosquitoes in the transmission of M. ulcerans anywhere was first revealed from entomological surveys in the mid-2000s on the Bellarine Peninsula and then more recently in Far North Queensland 15, 21, 55. Other observations that supported a role for mosquitoes in transmission included an analysis of the Buruli ulcer lesion location on the human body, which included more than 600 human Buruli ulcer cases, and showed a preponderance of lesions on ankles, elbows and backs of legs. These areas are frequently exposed and insects may preferentially bloodfeed there 56. Laboratory studies under one transmission scenario have also shown the competence of Ae. notoscriptus as mechanical vectors of M. ulcerans (Barnett criteria No. 4, Table 1) 22.

Of the ∼18,600 mosquitoes tested by IS2404 PCR from five different survey periods in the present study, Ae. notoscriptus was consistently positively associated with M. ulcerans. Where and how M. ulcerans is contaminating (or infecting) these mosquitoes remains to be determined. However, we made the somewhat unexpected observation that the most abundant mosquito species trapped on the Mornington Peninsula, Culex molestus, which predominately feeds on avian species 57 was consistently IS2404 PCR negative. This observation might be explained by a difference in the ecology of these two mosquito species, such as how (or where) they are encountering M. ulcerans. The apparent Ae. notoscriptus/M. ulcerans tropism might also indicate a specific biological interaction between this insect and the mycobacterium, or alternatively, a Cx. molestus antagonism to mycobacterial carriage.

MLE is a parameter used in vector ecology to estimate the proportion of infected mosquitoes that are pathogen positive, based on a pooling-based screening assay, where the proportion is the parameter of a binomial distribution 58. The MLE of Ae. notoscriptus over all 5 years of our surveys was 5.88 M. ulcerans positive mosquitoes/1,000 tested (95% CI 4.37-7.76). The MLE for the only other positive mosquito species, Ae. camptorhynchus (consisting of two insects that tested positive for M. ulcerans), was 2.96/1,000 tested (95% CI 0.17-14.19). These estimates are consistent with those previously reported for Ae. camptorhynchus (10,558 mosquitoes tested, MLE 3.98 per 1,000) and Ae. notoscriptus (221 mosquitoes tested, MLE of 4.47 per 1,000) during the Bellarine Peninsula survey of that Buruli ulcer endemic area 15. Interestingly, these values are significantly higher than the MLE values from an M. ulcerans mosquito survey conducted in tropical far north Queensland, Australia which reported an MLE value of 0.13 /1,000 (95% CI 0.01–0.61) for different species of mosquito 55. To note though, there were few reported cases of Buruli ulcer in this area of Queensland during the field survey period, consistent with the suggestion that mosquito surveys for M. ulcerans will be useful for predicting Buruli ulcer risk in humans.

In tropical far north Queensland, Australia, host-seeking mosquitoes that harboured M. ulcerans collected through similar carbon-dioxide light traps to those used in this study were within the genera Verallina, Coquillettidia and Mansonia 55. These comparisons highlight that the mosquitoes encountering M. ulcerans appear to be region/environment specific, and these observations support the idea that mosquitoes are mechanical vectors of M. ulcerans. The major mosquito species associated with detection of M. ulcerans in Victoria, Ae. notoscriptus, Ae. camptorhynchus, An. annulipes and Cq. linealis, are all diverse opportunistic feeders.

To explore host sources for mosquitoes trapped in our study, we used metagenomic amplicon sequencing of engorged mosquitoes 59–64. Of the 90 blood-fed mosquitoes processed, 36 individual insects successfully had their host blood source identified. The 54 bloodmeals that were unidentified were probably due to degradation of the host DNA that occurs approximately 36 hours post-feeding 65. As the mosquitoes analysed in this study were collected from baited mosquito traps, the exact time post-feeding they were collected is unknown. Of the host blood sources identified, common ringtail possum was the most commonly identified bloodmeal, followed by birds and humans, with dual bloodmeals observed in 55% of mosquitoes (Fig. 4, Fig. S4). Most notably, three insects were determined to have bloodmeals from both common ringtail possums and humans. These insects consisted of two Ae. notoscriptus and one Ae. rubrithorax. Common ringtail possums are major wildlife reservoirs of M. ulcerans 11, and in this study we identified M. ulcerans in frequent association with Ae. notoscriptus. The identification of these dual bloodmeals provides evidence that Ae. notoscriptus mosquitoes are bloodfeeding between possums and humans within a relatively short timeframe. Dual bloodmeals may provide an opportunity for a mechanical transmission event of M. ulcerans from a possum with a Buruli ulcer teeming with M. ulcerans, from which a mosquito bloodfeeds and then moves to a nearby human. However, the observed positive association specifically between Ae. notoscriptus and M. ulcerans is not explained by our bloodmeal analysis, which showed several other mosquito species that were not M. ulcerans positive, such as Cx. molestus, Ae. rubrithorax and Cq. Linealis, also fed on possums. An alternative source of M. ulcerans acquisition for Ae. notoscriptus might be from possum excreta contaminating the Ae. notoscriptus breeding sites, as this species breeds in small artificial containers 59. Previous studies have shown that mosquito larvae can ingest M. ulcerans and test positive for M. ulcerans during the larval stage, but M. ulcerans is not detected in the pupa or adult, which is largely thought to be a result of the larval midgut being purged 66. However, if possum excreta, which can have a high concentration of M. ulcerans 11, falls into these artificial breeding sites, then this may provide a means to contaminate the adult Ae. notoscriptus during eclosion and emergence on top of the water’s surface.

In common with other arthropod-borne bacterial pathogens, M. ulcerans also has the genomic hallmarks of niche adaptation 67, 68. For instance, the bacterial diseases vectored by blood-feeding arthropods, such as bubonic plague, spread to humans through the bite of fleas harbouring the bacterium Yersinia pestis 69, the tick-borne infections such as Lyme disease, Rocky Mountain Spotted Fever, ehrlichiosis (among others) caused by Borrelia burgdorferi, Rickettsia rickettsi iand Ehrlichia sp., respectively 70, or tularemia, caused by infection with Francisella tularensis spread through the bite of infected ticks (with some subspecies also spread by mosquitoes) 71–73, are all caused by bacteria that have degenerating genomes. That is, like M. ulcerans, their genomes bear the distinctive hallmarks of evolutionary bottlenecks and niche-adaptation (plasmid acquisition, pseudogene accumulation, insertion sequence expansion), a genomic pattern thought indicative of a shared trajectory towards symbiosis with the arthropod host 74. In addition, the absence of recombination and highly clonal population structure of M. ulcerans is aligned with the population structure of bacteria in ‘closed symbiosis’ with their host animal 75.

Mosquitoes were not the only arthropods from which M. ulcerans were detected in the Mornington Peninsula. With over 20,500 arthropods collected using sticky traps (YST and SO), this study screened other insects that might broadly act as a mechanical vector, that is, an insect that is involved in the accidental transport of a pathogen76,22. M. ulcerans was successfully identified on two of ∼1,800 flies tested, identified as blowflies (Calliphora hilli). Previous studies have screened other species of flies, such as March flies (Tabanidae), with no positive detections 55. C. hilli is a native species occurring along the Australian east coast and in South Australia 77. This species is a carrion breeder occurring year-round throughout Victoria, with the female laying her eggs in decaying flesh where the larvae emerge 77. Possum carcases are readily infested by C. hilli 78, which may explain how this fly species is becoming contaminated with M. ulcerans, as possums are wildlife reservoirs of M. ulcerans 10. The likelihood of C. hilli carrying M. ulcerans to humans is relatively low due to this species rarely biting humans 79.

Interestingly, all species that have tested positive for M. ulcerans share quite different breeding environments and feeding preferences, although most feed on humans. Aedes camptorhynchus and Verrallina sp. are saltmarsh mosquitoes 80, 81, while Ae. notoscriptus is a freshwater container breeder occurring in close association to humans 82. Anopheles annulipes and Culex australicus are also freshwater breeding mosquitoes 83, although Culex australicus typically feeds on avian species and is not considered to feed on humans 84. This diversity in mosquito species, habitats, flight range from breeding sites and host-preference feeding raises interesting questions about how these mosquitoes are coming into contact with M. ulcerans and how potential vector mosquito species may change based on the study area. Additionally, the ecology of the mosquito sub-species are generally poorly understood, including Ae. Notoscriptus, which occurs as a series of genetically differentiated clades within Australia 35.

In this study, we also deployed for the first time targeted enrichment genome capture using the Agilent RNA bait system to demonstrate beyond reasonable doubt the presence of M. ulcerans in association with mosquitoes 49. The IS2404, IS2606 and KR PCR assays have provided robust evidence for the presence of M. ulcerans in the environment, but detecting pathogen genomic DNA and using those sequences to forensically dissect transmission chains by matching pathogen genome SNP profiles is a powerful technological advance 49. While the method lost sensitivity for IS2404 qPCR Ct values >32, we generated sufficient genome coverage from one IS2404 PCR positive mosquito and from two possum excreta specimens to show that the M. ulcerans genotypes of the captured genomes were identical to those associated with human Buruli ulcer cases in the study area, rather than Buruli ulcer cases linked to other regions (Fig. 3). These findings provide strong support for mosquitoes and possums playing a role in the transmission of M. ulcerans in the Mornington Peninsula. These results also add to the growing body of evidence demonstrating the utility of pathogen genomics in specifically identifying the sources and transmission pathways of environmental pathogens and suggest that continued surveillance of M. ulcerans genotypes in mosquitoes and possums could be useful in guiding public health interventions that seek to control the spread of Buruli ulcer in the region. We are now exploring the use of genome sequence enrichment to dissect the genomic epidemiology from the perspective of environmental sources, in particular to track the spread of Buruli ulcer in Australian native possums across the region 50.

The SaTScan clustering analyses provide compelling evidence for the spatial association between the presence of M. ulcerans in possums, mosquitoes, and human Buruli ulcer cases in the study area (Figure 4). The triple-cluster overlap observed in our SaTScan analyses suggests that the spatial distribution of these three factors is likely to be closely linked and may be contributing to the persistence of Buruli ulcer in the Mornington Peninsula. Our finding of a low frequency of triple-cluster overlap among 10,000 randomisations, with only 8.9% of replicates showing this phenomenon, provides a level of confidence that our observations have not occurred randomly. This further supports the validity of our findings and reinforces the idea that the presence of M. ulcerans in possums and mosquitoes may play a crucial role in the transmission of M. ulcerans to humans in the study area. Our findings highlight the importance of ongoing surveillance of possum and mosquito populations, which may provide critical insights into the epidemiology of Buruli ulcer in the region and inform targeted public health interventions to control the disease.

Our research has some limitations. Although we found a spatial association between the presence of M. ulcerans in possums and mosquitoes, and human Buruli ulcer cases, we cannot absolutely conclude causality or directionality. In addition, the very specific set of circumstances that have led to the rise of Buruli ulcer in temperate southeastern Australia restricts the generalisability of our results. One must be cautious to draw parallels with African Buruli ulcer endemic countries for instance, where a highly susceptible mammalian reservoir equivalent to the Australian native possum is yet to be identified. Further investigations are needed to better understand the underlying mechanisms that drive the association between the presence of M. ulcerans in these different species and the development of human Buruli ulcer cases.

Despite these caveats, our collective research over more than 15 years makes it very clear that mosquitoes are likely vectors and native possums are major wildlife reservoirs of M. ulcerans in southeastern Australia. Mosquito surveillance with M. ulcerans screening coupled with mosquito control and public health messaging to avoid mosquito bites are practical interventions that would be expected to reduce the incidence of human Buruli ulcer.

Funding

TPS: National Health and Medical Research Council of Australia (GNT1152807, GNT1196396). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Ethics

Ethical approval for the use in this study of de-identified human BU case location, aggregated at mesh block level, was obtained from the Victorian Government Department of Health Human Ethics Committee under HREC/54166/DHHS-2019-179235(v3), ‘Spatial risk map of Buruli ulcer infection in Victoria.’.

Author Contributions

Conceptualisation PTM, JO, RF, SRC, PDRJ, JRW, AAH, KBG, TPS, SEL; Data curation PTM, KB, JO; Formal Analysis PTM, AHB, TPS; Funding acquisition SRC, PDRJ, KBG, JRW, AH, KG, TPS, SEL; Methodology PTM, AHB, KB, JCC, JRW, TPS, SEL; Writing – original draft PTM, AHB, SEL, TPS; Writing – review & editing all authors.

Acknowledgments

We would like to acknowledge the residents of the Mornington Peninsula for assisting in collecting and sending sticky cards to our laboratory as part of our surveillance and to Mary Tachedjian, Michael Dunn, Simone Clayton, Julie Gaburro and Victoria Boyd for assistance during field work.

Footnotes

References

  1. ↵
    MacCullum, P., Tolhurst, J. C., Buckle, G. & Sissons, H. A. A new Mycobacterial infection in man. J Pathol Bacteriol 60, 93–102 (1948).
    OpenUrlCrossRefPubMed
  2. ↵
    World Health Organization. (World Health Organization, Geneva, 2004).
  3. ↵
    Merritt, R. W. et al. Ecology and transmission of Buruli ulcer disease: a systematic review. PLoS Negl Trop Dis 4, e911–e911, doi:10.1371/journal.pntd.0000911 (2010).
    OpenUrlCrossRefPubMed
  4. ↵
    Organization, W. H. Buruli ulcer (Mycobacterium ulcerans infection), <https://www.who.int/news-room/fact-sheets/detail/buruli-ulcer-(mycobacterium-ulcerans-infection)> (2022).
  5. ↵
    Department of Health and Human Services (Victoria). Interactive infectious disease surveillance reports [internet], <https://www2.health.vic.gov.au/public-health/infectious-diseases/infectious-diseases-surveillance/interactive-infectious-disease-reports> (2021).
  6. ↵
    Janssens, P. G., Quertinmont, M. J., Sieniawski, J. & Gatti, F. Necrotic tropical ulcers and mycobacterial causative agents. Trop Geogr Med 11, 293–312 (1959).
    OpenUrlPubMed
  7. ↵
    Clancey, J. K., Dodge, O. G., Lunn, H. F. & Oduori, M. L. Mycobacterial skin ulcers in Uganda. Lancet (London, England) 2, 951–954, doi:10.1016/s0140-6736(61)90793-0 (1961).
    OpenUrlCrossRef
  8. ↵
    Muleta, A. J., Lappan, R., Stinear, T. P. & Greening, C. Understanding the transmission of Mycobacterium ulcerans: A step towards controlling Buruli ulcer. PLoS Negl Trop Dis 15, e0009678, doi:10.1371/journal.pntd.0009678 (2021).
    OpenUrlCrossRef
  9. ↵
    Blasdell, K. R. et al. Environmental risk factors associated with the presence of Mycobacterium ulcerans in Victoria, Australia. PLoS One 17, e0274627, doi:10.1371/journal.pone.0274627 (2022).
    OpenUrlCrossRef
  10. ↵
    Carson, C. et al. Potential wildlife sentinels for monitoring the endemic spread of human buruli ulcer in South-East australia. PLoS Negl Trop Dis 8, e2668, doi:10.1371/journal.pntd.0002668 (2014).
    OpenUrlCrossRefPubMed
  11. ↵
    Fyfe, J. A. M. et al. A major Role for mammals in the ecology of Mycobacterium ulcerans. PLoS Negl Trop Dis 4, e791, doi:10.1371/journal.pntd.0000791 (2010).
    OpenUrlCrossRefPubMed
  12. ↵
    Johnson, P. D. R. in Buruli Ulcer: Mycobacterium Ulcerans Disease (eds G. Pluschke & K. Roltgen) 61–76 (2019).
  13. O’Brien, C. R. et al. Clinical, microbiological and pathological findings of Mycobacterium ulcerans infection in three Australian Possum species. PLoS Negl Trop Dis 8, e2666, doi:10.1371/journal.pntd.0002666 (2014).
    OpenUrlCrossRef
  14. ↵
    Xu, R. W., Stinear, T. P., Johnson, P. D. & O’Brien, D. P. Possum bites man: case of Buruli ulcer following possum bite. Med J Aust 216, 452–453, doi:10.5694/mja2.51505 (2022).
    OpenUrlCrossRef
  15. ↵
    Johnson, P. D. R. et al. Mycobacterium ulcerans in mosquitoes captured during outbreak of Buruli ulcer, southeastern Australia. Emerging Infectious Diseases 13, 1653–1660, doi:10.3201/eid1311.061369 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  16. ↵
    Fyfe, J. A. et al. Development and application of two multiplex real-time PCR assays for the detection of Mycobacterium ulcerans in clinical and environmental samples. Applied and environmental microbiology 73, 4733–4740 (2007).
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Quek, T. Y. et al. Risk factors for Mycobacterium ulcerans infection, southeastern Australia. Emerg Infect Dis 13, 1661–1666, doi:10.3201/eid1311.061206 (2007).
    OpenUrlCrossRefPubMed
  18. ↵
    Landier, J. et al. Adequate wound care and use of bed nets as protective factors against Buruli Ulcer: results from a case control study in Cameroon. PLoS Negl Trop Dis 5, e1392, doi:10.1371/journal.pntd.0001392 (2011).
    OpenUrlCrossRefPubMed
  19. ↵
    Pouillot, R. et al. Risk factors for buruli ulcer: a case control study in Cameroon. PLoS Negl Trop Dis 1, e101, doi:10.1371/journal.pntd.0000101 (2007).
    OpenUrlCrossRefPubMed
  20. ↵
    Johnson, P. D. et al. Consensus recommendations for the diagnosis, treatment and control of Mycobacterium ulcerans infection (Bairnsdale or Buruli ulcer) in Victoria, Australia. Med J Aust 186, 64–68, doi:10.5694/j.1326-5377.2007.tb00802.x (2007).
    OpenUrlCrossRefPubMedWeb of Science
  21. ↵
    Lavender, C. J. et al. Risk of Buruli ulcer and detection of Mycobacterium ulcerans in mosquitoes in southeastern Australia. PLoS Negl Trop Dis 5, e1305, doi:10.1371/journal.pntd.0001305 (2011).
    OpenUrlCrossRefPubMed
  22. ↵
    Wallace, J. R. et al. Mycobacterium ulcerans low infectious dose and mechanical transmission support insect bites and puncturing injuries in the spread of Buruli ulcer. PLoS Negl Trop Dis 11, e0005553, doi:10.1371/journal.pntd.0005553 (2017).
    OpenUrlCrossRefPubMed
  23. ↵
  24. ↵
    Australian Bureau of Meteorology. Summary statisitcs Mornington, <http://www.bom.gov.au/climate/averages/tables/cw_086079.shtml> (2022).
  25. ↵
    World Health Organization. Number of new reported cases of Buruli ulcer, <https://apps.who.int/gho/data/node.main.A1631> (2023).
  26. ↵
    Mornington Peninsula Shire. Mornington Peninsula Shire population forecasts, <https://forecast.id.com.au/mornington-peninsula> (2023).
  27. ↵
    Russell, R. C. A colour photo atlas of mosquitoes of Southeastern Australia. (University of Sydney Printing Service, NSW, 1996).
  28. Dobrotworsky, N. V. The mosquitoes of Victoria (Diptera, Culicidae). (Melbourne University Press, 1965).
  29. ↵
    Liehne, P. F. S. An atlas of the mosquitoes of Western Australia. (Health Department of Western Australia, 1991).
  30. ↵
    Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3, 294–299 (1994).
    OpenUrlCrossRefPubMed
  31. ↵
    PooledInfRate, Version 4.0: a Microsoft(R) Office Excel(C) Add-In to compute prevalence estimates from pooled samples. (Fort Collins, CO, USA, 2009).
  32. ↵
    R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria (2020).
  33. ↵
  34. ↵
    Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree: computing large minimum evolution trees with profiles instead of a distance matrix. Mol Biol Evol 26, 1641–1650, doi:10.1093/molbev/msp077 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  35. ↵
    Endersby, N. M. et al. Evidence of cryptic genetic lineages within Aedes notoscriptus (Skuse). Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases 18, 191–201, doi:10.1016/j.meegid.2013.04.035 (2013).
    OpenUrlCrossRef
  36. ↵
    Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9, 772, doi:10.1038/nmeth.2109 (2012).
    OpenUrlCrossRefPubMed
  37. ↵
    Guindon, S. & Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic biology 52, 696–704, doi:10.1080/10635150390235520 (2003).
    OpenUrlCrossRefPubMedWeb of Science
  38. ↵
    QGIS Geographic Information System. Open Source Geospatial Foundation Project. (2022).
  39. ↵
    Statistics, A. B. o. 1270.0.55.007 - Australian Population Grid, 2011, <https://www.abs.gov.au/ausstats/abs@.nsf/lookup/1270.0.55.007main+features12011> (2011).
  40. ↵
    Australian Bureau of Statistics. <https://www.abs.gov.au> (2023).
  41. ↵
    QGIS Geographic Information System (2021).
  42. ↵
    Kulldorff, M. A spatial scan statistic. Commun Stat-Theor M 26, 1481–1496, doi:Doi 10.1080/03610929708831995 (1997).
    OpenUrlCrossRef
  43. ↵
    Vandelannoote, K. et al. Structured surveys of Australian native possum excreta predict Buruli ulcer occurrence in humans. Biorxiv, doi:https://doi.org/10.1101/2022.11.16.516821 (2022).
  44. ↵
    Loftus, M. J. et al. The incubation period of Buruli ulcer (Mycobacterium ulcerans infection) in Victoria, Australia - Remains similar despite changing geographic distribution of disease. PLoS Negl Trop Dis 12, e0006323, doi:10.1371/journal.pntd.0006323 (2018).
    OpenUrlCrossRefPubMed
  45. ↵
    Trubiano, J. A., Lavender, C. J., Fyfe, J. A., Bittmann, S. & Johnson, P. D. The incubation period of Buruli ulcer (Mycobacterium ulcerans infection). PLoS Negl Trop Dis 7, e2463, doi:10.1371/journal.pntd.0002463 (2013).
    OpenUrlCrossRefPubMed
  46. ↵
    Pebesma, E. Simple Features for R: Standardized Support for Spatial Vector Data. R J 10, 439–446 (2018).
    OpenUrl
  47. ↵
    R: A language and environment for statistical computing (R Foundation for Statistical Computing, Vienna, Austria., 2021).
  48. ↵
    Buultjens, A. H. et al. Comparative Genomics Shows That Mycobacterium ulcerans Migration and Expansion Preceded the Rise of Buruli Ulcer in Southeastern Australia. Appl Environ Microbiol 84, doi:10.1128/AEM.02612-17 (2018).
    OpenUrlAbstract/FREE Full Text
  49. ↵
    Taouk, M. L. et al. Characterisation of Treponema pallidum lineages within the contemporary syphilis outbreak in Australia: a genomic epidemiological analysis. Lancet Microbe 3, e417–e426, doi:10.1016/S2666-5247(22)00035-0 (2022).
    OpenUrlCrossRef
  50. ↵
    Vandelannoote, K. et al. Statistical modelling based on structured surveys of Australian native possum excreta harbouring Mycobacterium ulcerans predicts Buruli ulcer occurrence in humans. Elife 12, doi:10.7554/eLife.84983 (2023).
    OpenUrlCrossRef
  51. ↵
    Mangas, K. M. et al. Vaccine-Specific Immune Responses against Mycobacterium ulcerans Infection in a Low-Dose Murine Challenge Model. Infect Immun 88, doi:10.1128/IAI.00753-19 (2020).
    OpenUrlAbstract/FREE Full Text
  52. ↵
    Portaels, F., Elsen, P., Guimaraes-Peres, A., Fonteyne, P. A. & Meyers, W. M. Insects in the transmission of Mycobacterium ulcerans infection. Lancet (London, England )353, 986, doi:10.1016/s0140-6736(98)05177-0 (1999).
    OpenUrlCrossRef
  53. ↵
    Marsollier, L. et al. Aquatic plants stimulate the growth of and biofilm formation by Mycobacterium ulcerans in axenic culture and harbor these bacteria in the environment. Appl Environ Microbiol 70, 1097–1103, doi:10.1128/AEM.70.2.1097-1103.2004 (2004).
    OpenUrlAbstract/FREE Full Text
  54. ↵
    Portaels, F. et al. First cultivation and characterization of Mycobacterium ulcerans from the environment. PLoS Negl Trop Dis 2, e178–e178, doi:10.1371/journal.pntd.0000178 (2008).
    OpenUrlCrossRefPubMed
  55. ↵
    Singh, A., McBride, W. J. H., Govan, B., Pearson, M. & Ritchie, S. A. A survey on Mycobacterium ulcerans in mosquitoes and march flies captured from endemic areas of Northern Queensland, Australia. PLoS Negl Trop Dis 13, e0006745, doi:10.1371/journal.pntd.0006745 (2019).
    OpenUrlCrossRef
  56. ↵
    Yerramilli, A. et al. The location of Australian Buruli ulcer lesions—Implications for unravelling disease transmission. PLoS Negl Trop Dis 11, e0005800, doi:10.1371/journal.pntd.0005800 (2017).
    OpenUrlCrossRefPubMed
  57. ↵
    Gomes, B. et al. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization. Parasit Vectors 6, 93, doi:10.1186/1756-3305-6-93 (2013).
    OpenUrlCrossRef
  58. ↵
    Bustamante, D. M. & Lord, C. C. Sources of error in the estimation of mosquito infection rates used to assess risk of arbovirus transmission. The American journal of tropical medicine and hygiene 82, 1172–1184, doi:10.4269/ajtmh.2010.09-0323 (2010).
    OpenUrlAbstract/FREE Full Text
  59. ↵
    Kay, B. H., Boyd, A. M., Ryan, P. A. & Hall, R. A. Mosquito feeding patterns and natural infection of vertebrates with Ross River and Barmah Forest viruses in Brisbane, Australia. The American journal of tropical medicine and hygiene 76, 417–423 (2007).
    OpenUrlAbstract/FREE Full Text
  60. Jansen, C. C. et al. Blood sources of mosquitoes collected from urban and peri-urban environments in eastern Australia with species-specific molecular analysis of avian blood meals. The American journal of tropical medicine and hygiene 81, 849–857, doi:10.4269/ajtmh.2009.09-0008 (2009).
    OpenUrlAbstract/FREE Full Text
  61. Flies, E. J., Flies, A. S., Fricker, S. R., Weinstein, P. & Williams, C. R. Regional comparison of mosquito bloodmeals in South Australia: implications for Ross River virus ecology. Journal of Medical Entomology 53, 902–910, 909 (2016).
    OpenUrlCrossRefPubMed
  62. Muller, M., Murray, M. & Edwards, J. Blood-sucking midges and mosquitoes feeding on mammals at Beatrice Hill, N.T. Australian Journal of Zoology 29, 573–588, doi:https://doi.org/10.1071/ZO9810573 (1981).
    OpenUrl
  63. Lee, D. J., Clinton, K. J. & O’Gower, A. K. The blood sources of some Australian mosquitoes. Australian journal of biological sciences 7, 282–301, doi:10.1071/bi9540282 (1954).
    OpenUrlCrossRefPubMed
  64. ↵
    Johansen, C. A., Power, S. L. & Broom, A. K. Determination of mosquito (Diptera: Culicidae) bloodmeal sources in western australia: implications for arbovirus transmission. Journal of Medical Entomology 46, 1167–1175, doi:10.1603/033.046.0527 (2009).
    OpenUrlCrossRefPubMed
  65. ↵
    Oshaghi, M. A. et al. Effects of post-ingestion and physical conditions on PCR amplification of host blood meal DNA in mosquitoes. Exp Parasitol 112, 232–236, doi:10.1016/j.exppara.2005.11.008 (2006).
    OpenUrlCrossRefPubMed
  66. ↵
    Wallace, J. R. et al. Interaction of Mycobacterium ulcerans with mosquito species: implications for transmission and trophic relationships. Appl Environ Microbiol 76, 6215–6222, doi:10.1128/AEM.00340-10 (2010).
    OpenUrlAbstract/FREE Full Text
  67. ↵
    Doig, K. D. et al. On the origin of Mycobacterium ulcerans, the causative agent of Buruli ulcer. BMC Genomics 13, 258, doi:10.1186/1471-2164-13-258 (2012).
    OpenUrlCrossRefPubMed
  68. ↵
    Stinear, T. P. et al. Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer. Genome Res 17, 192–200, doi:10.1101/gr.5942807 (2007).
    OpenUrlAbstract/FREE Full Text
  69. ↵
    Eisen, R. J. & Gage, K. L. Transmission of flea-borne zoonotic agents. Annu Rev Entomol 57, 61–82, doi:10.1146/annurev-ento-120710-100717 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  70. ↵
    Kernif, T., Leulmi, H., Raoult, D. & Parola, P. Emerging Tick-Borne Bacterial Pathogens. Microbiol Spectr 4, doi:10.1128/microbiolspec.EI10-0012-2016 (2016).
    OpenUrlCrossRef
  71. ↵
    Ryden, P. et al. Outbreaks of tularemia in a boreal forest region depends on mosquito prevalence. J Infect Dis 205, 297–304, doi:10.1093/infdis/jir732 (2012).
    OpenUrlCrossRefPubMed
  72. Thelaus, J. et al. Francisella tularensis subspecies holarctica occurs in Swedish mosquitoes, persists through the developmental stages of laboratory-infected mosquitoes and is transmissible during blood feeding. Microb Ecol 67, 96–107, doi:10.1007/s00248-013-0285-1 (2014).
    OpenUrlCrossRefPubMed
  73. ↵
    Abdellahoum, Z., Maurin, M. & Bitam, I. Tularemia as a Mosquito-Borne Disease. Microorganisms 9, doi:10.3390/microorganisms9010026 (2020).
    OpenUrlCrossRef
  74. ↵
    Hendry, T. A. et al. Ongoing Transposon-Mediated Genome Reduction in the Luminous Bacterial Symbionts of Deep-Sea Ceratioid Anglerfishes. mBio 9, doi:10.1128/mBio.01033-18 (2018).
    OpenUrlAbstract/FREE Full Text
  75. ↵
    Perreau, J. & Moran, N. A. Genetic innovations in animal-microbe symbioses. Nat Rev Genet 23, 23–39, doi:10.1038/s41576-021-00395-z (2022).
    OpenUrlCrossRefPubMed
  76. ↵
    Drucker, M. & Then, C. Transmission activation in non-circulative virus transmission: a general concept? Current Opinion in Virology 15, 63–68, doi:https://doi.org/10.1016/j.coviro.2015.08.006 (2015).
    OpenUrl
  77. ↵
    Archer, M. S. The ecology of invertebrate associations with vertebrate carrion in Victoria, with reference to forensic entomology Doctor of Philosophy thesis, The University of Melbourne, (2002).
  78. ↵
    Lang, M. D., Allen, G. R. & Horton, B. J. Blowfly succession from possum (Trichosurus vulpecula) carrion in a sheep-farming zone. Medical and Veterinary Entomology 20, 445–452, doi:https://doi.org/10.1111/j.1365-2915.2006.00654.x (2006).
    OpenUrlCrossRefPubMed
  79. ↵
    Skopyk, A. D., Forbes, S. L. & LeBlanc, H. N. Recognizing the inherent variability in Dipteran colonization and decomposition rates of human donors in Sydney, Australia. Journal of Clinical and Health Sciences 6, 102–119 (2021).
    OpenUrl
  80. ↵
    C A. Van Schie, Spafford, H., Carver, S. S. & Weinstein, P. Salinity tolerance of Aedes camptorhynchus (Diptera: Culicidae) from two regions in southwestern Australia. Austral Entomology 48, 293–299 (2009).
    OpenUrl
  81. ↵
    Jeffery, J. A. L., Kay, B. H. & Ryan, P. A. Development time and survival of Verrallina funerea (Theobald) (Diptera: Culicidae) immatures and other brackish water mosquito species in southeast Queensland, Australia. Australian Journal of Entomology 44, 226–232, doi:https://doi.org/10.1111/j.1440-6055.2005.00479.x (2005).
    OpenUrl
  82. ↵
    Hamlyn-Harris, R. Notes on the breeding-places of Aedes (Finlaya) notoscriptus, Skuse, in Queensland. Bulletin of Entomological Research 19, 405–409, doi:10.1017/S0007485300020782 (1928).
    OpenUrlCrossRef
  83. ↵
    Russell, R. C. Mosquitoes and mosquito-borne disease in southeast Australia. (Department of Medical Entomology, Westmead Hospital and Department of Medicine, University of Sydney, NSW, 1993).
  84. ↵
    Russell, R. C. A review of the status and significance of the species within the Culex pipiens group in Australia. Journal of the American Mosquito Control Association 28, 24–27 (2012).
    OpenUrl
Back to top
Posted May 07, 2023.
Download PDF

Supplementary Material

Data/Code
Email
A transmission chain linking Mycobacterium ulcerans with Aedes notoscriptus mosquitoes, possums and human Buruli ulcer cases in southeastern Australia
Peter T. Mee, Andrew H. Buultjens, Jane Oliver, Karen Brown, Jodie C. Crowder, Jessica L. Porter, Emma C. Hobbs, Louise M. Judd, George Taiaroa, Natsuda Puttharak, Deborah A. Williamson, Kim R. Blasdell, Ee Laine Tay, Rebecca Feldman, Mutizwa Odwell Muzari, Chris Sanders, Stuart Larsen, Simon R. Crouch, Paul D. R. Johnson, John R. Wallace, David J. Price, Ary A. Hoffmann, Katherine B. Gibney, Timothy P. Stinear, Stacey E. Lynch
bioRxiv 2023.05.07.539718; doi: https://doi.org/10.1101/2023.05.07.539718
Reddit logo Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area