New Results

A connection between the ribosome and two S. pombe tRNA modification mutants subject to rapid tRNA decay

Thareendra De Zoysa, Alayna C. Hauke, Nivedita R. Iyer, Erin Marcus, Sarah M. Ostrowski, Justin C. Fay, Eric M. Phizicky
doi: https://doi.org/10.1101/2023.09.18.558340

Abstract

tRNA modifications are crucial in all organisms to ensure tRNA folding and stability, and accurate translation in the ribosome. In both the yeast Saccharomyces cerevisiae and the evolutionarily distant yeast Schizosaccharomyces pombe, mutants lacking certain tRNA body modifications (outside the anticodon loop) are temperature sensitive due to rapid tRNA decay (RTD) of a subset of hypomodified tRNAs. Here we show that for each of two S. pombe mutants subject to RTD, mutations in ribosomal protein genes suppress the temperature sensitivity without altering tRNA levels. Prior work showed that S. pombe trm8Δ mutants, lacking 7-methylguanosine, were temperature sensitive due to RTD and that one class of suppressors had mutations in the general amino acid control (GAAC) pathway, which was activated concomitant with RTD, resulting in further tRNA loss. We now find that another class of S. pombe trm8Δ suppressors have mutations in rpl genes, encoding 60S subunit proteins, and that suppression occurs with minimal restoration of tRNA levels and reduced GAAC activation. Furthermore, trm8Δ suppression extends to other mutations in the large or small ribosomal subunit. We also find that S. pombe tan1Δ mutants, lacking 4-acetylcytidine, are temperature sensitive due to RTD, that one class of suppressors have rpl mutations, associated with minimal restoration of tRNA levels, and that suppression extends to other rpl and rps mutations. However, although S. pombe tan1Δ temperature sensitivity is associated with some GAAC activation, suppression by an rpl mutation does not significantly inhibit GAAC activation. These results suggest that ribosomal protein mutations suppress the temperature sensitivity of S. pombe trm8Δ and tan1Δ mutants due to reduced ribosome concentrations, leading to both a reduced requirement for tRNA, and reduced ribosome collisions and GAAC activation. Results with S. cerevisiae trm8Δ trm4Δ mutants are consistent with this model, and fuel speculation that similar results will apply across eukaryotes.

Introduction

tRNAs contain numerous post-transcriptional modifications. These tRNA modifications are highly conserved evolutionarily within each domain of life, and in some cases throughout all of the domains (de Crecy-Lagard et al. 2012; Jackman and Alfonzo 2013). Modifications impart important functional or structural properties to the tRNAs, and consequently, lack of any of a number of tRNA modifications results in growth defects in the budding yeast Saccharomyces cerevisiae and in neurological, mitochondrial, or other disorders in humans (Suzuki 2021; Phizicky and Hopper 2023). Modifications within the anticodon loop frequently affect the efficiency or fidelity of translation (Urbonavicius et al. 2001; Kothe and Rodnina 2007; Nedialkova and Leidel 2015; Grosjean and Westhof 2016; Rozov et al. 2016; Ranjan and Rodnina 2017), consistent with their interactions in the A-site of the ribosome. By contrast, modifications in the main tRNA body often impair the folding and/or stability of the tRNA (Helm et al. 1999; Kadaba et al. 2004; Alexandrov et al. 2006; Chernyakov et al. 2008).

The biology of body modifications in eukaryotes is best understood in S. cerevisiae, in which lack of any of several body modifications targets a subset of the hypomodified tRNAs to either or both of two quality control decay pathways, particularly at higher temperatures (see (Phizicky and Hopper 2023)). Lack of each of several modifications, alone or in combination with other body modifications, targets mature tRNAs for 5’-3’ exonucleolytic degradation by the rapid tRNA decay (RTD) pathway, which is catalyzed by Xrn1 and Rat1 and inhibited by lack of Met22 (Chernyakov et al. 2008; Dewe et al. 2012), due to the accumulation of the metabolite adenosine 3’,5’ bis-phosphate (Dichtl et al. 1997; Yun et al. 2018). Thus, trm8Δ trm4Δ mutants lack 7-methylguanosine at G46 (m7G46) and 5-methylcytidine (m5C) and are temperature sensitive due to RTD of tRNAVal(AAC) (Alexandrov et al. 2006; Chernyakov et al. 2008). Similarly, both tan1Δ trm44Δ mutants (lacking 4-acetylcytidine at C12 (ac4C12) and 2’-O-methyluridine at U44) and trm1Δ trm4Δ mutants (lacking N2,N2-dimethylguanosine at G26 (m2,2G26) and m5C) are temperature sensitive due to RTD of tRNASer(CGA) and tRNASer(UGA), and the temperature sensitivity of each of the trm8Δ, trm1Δ, and tan1Δ single mutants is associated with tRNA decay and inhibited by a met22Δ mutation (Chernyakov et al. 2008; Kotelawala et al. 2008; Dewe et al. 2012). By contrast, trm6 mutants, lacking m1A58, are targeted by both the nuclear surveillance pathway and the RTD pathway. The nuclear surveillance pathway degrades pre-tRNAiMet lacking m1A58 using the 3’-5’ exonucleases Rrp6 and Rrp44 of the nuclear exosome, after oligoadenylation by Trf4 of the TRAMP complex (Kadaba et al. 2004; Kadaba et al. 2006; Wang et al. 2008), and in addition, the RTD pathway has a prominent role in decay of tRNAiMet lacking m1A58 in trm6 mutants (Tasak and Phizicky 2022).

Our genetic analysis of the biology of body modification mutants in S. pombe has revealed strong evidence for conservation of the use of the RTD pathway in monitoring tRNA quality across at least the 600 million years separating S. pombe and S. cerevisiae, which pre-dates the Cambrian explosion during which the major animal phyla emerged (Parfrey et al. 2011). Thus, we showed that S. pombe trm8Δ mutants, lacking m7G46, were temperature sensitive due to reduced levels of tRNATyr(GUA), and to some extent tRNAPro(AGG), and that each of four trm8Δ suppressors with restored tRNA levels had mutations in the RAT1 ortholog dhp1 (De Zoysa and Phizicky 2020). Similarly, we found that the temperature sensitivity of S. pombe trm6Δ mutants, lacking m1A58, was due to the decay of tRNAiMet by the RTD pathway, and not the nuclear surveillance pathway, based on isolation of multiple trm6Δ suppressors with mutations in dhp1 or tol1 (the MET22 ortholog), and the lack of trm6Δ suppression by mutation of the TRF4 ortholog cid14 (Tasak and Phizicky 2022).

Our additional analysis of S. pombe trm8Δ suppressors also led to the discovery of a connection between the onset of RTD and activation of the general amino acid control (GAAC) pathway, equivalent to the integrated stress response pathway in humans. Thus, each of seven S. pombe trm8Δ suppressors that were sensitive to the GAAC activator 3-aminotriazole (3-AT) had null mutations in one of three components of the GAAC pathway (gcn1+, gcn2+, or gcn3+ (tif221+)) and had partially restored levels of tRNATyr and tRNAPro(AGG), consistent with the interpretation that decay of tRNATyr and tRNAPro(AGG) in S. pombe trm8Δ mutants triggers GAAC activation, causing a further loss of these tRNAs. In support of this interpretation, we found that the lowest temperature at which tRNA decay was detected in S. pombe trm8Δ mutants coincides with the temperature at which a growth defect was first observed and GAAC activation was first evident (De Zoysa and Phizicky 2020). Moreover, the connection between the onset of RTD and GAAC activation extends to S. cerevisiae, as the lowest temperature at which the well-studied S. cerevisiae trm8Δ trm4Δ mutant showed a growth defect was accompanied by significant tRNAVal(AAC) decay and GAAC activation. However, GAAC activation has opposite consequences in S. cerevisiae trm8Δ trm4Δ mutants, compared to S. pombe trm8Δ mutants, as introduction of GAAC mutations led to exacerbated temperature sensitivity and a further reduction in tRNAVal(AAC) levels, consistent with the GAAC pathway acting to prevent further tRNA loss in S. cerevisiae (De Zoysa and Phizicky 2020).

Here, we show the existence of a connection between tRNA modification biology in S. pombe and proteins in the ribosome, which also appears to extend to S. cerevisiae. We find that a prominent class of spontaneous suppressors of the temperature sensitivity of S. pombe trm8Δ mutants have mutations in rpl genes, encoding proteins in the large ribosomal subunit, and that suppression is accompanied by little or no restoration of tRNA levels and reduced activation of the GAAC pathway. This suppression of S. pombe trm8Δ mutants extends to each of several tested rpl and rps genes (encoding proteins in the small subunit). Furthermore, the connection between tRNA modification and proteins in the ribosome also extends to another S. pombe body modification mutant. Thus, we find that S. pombe tan1Δ mutants, lacking ac4C12 in their tRNAs, are temperature sensitive due to RTD of two tRNAs, and that a large class of tan1Δ suppressors have mutations in ribosomal protein genes. However, S. pombe tan1Δ mutants have reduced GAAC activation, compared to S. pombe trm8Δ mutants, and an rpl502Δ mutation does not dramatically inhibit GAAC activation, but suppresses the S. pombe tan1Δ growth defect more efficiently than a gcn2Δ mutation. In contrast, we find that rpl and rps mutations exacerbate the temperature sensitivity of the well-studied S. cerevisiae trm8Δ trm4Δ mutant, known to be subject to RTD. We interpret these results in terms of a model in which rpl and rps mutations lead to reduced ribosome concentrations (Steffen et al. 2012; Cheng et al. 2019), resulting in reduced ribosome collisions and consequent GAAC activation (Yan and Zaher 2021; Kim and Zaher 2022), as well as in a reduced need for tRNA. Based on these results, we speculate that mutations in ribosomal protein genes will similarly act to influence growth defects of other modification mutants in S. pombe and S. cerevisiae, as well as in other eukaryotes.

Results

A class of trm8Δ suppressors have mutations in rpl genes and distinct growth properties

To further understand mechanisms mediating the temperature sensitivity of S. pombe trm8Δ mutants, we identified additional suppressors with growth phenotypes different from those with mutations in the RTD pathway or the GAAC pathway, and then sequenced their genomes. We tested sensitivity to 5-fluorouracil (5-FU) for two reasons. First, our previous work showed that S. pombe trm8Δ mutants were modestly sensitive to 5-FU at higher temperatures (De Zoysa and Phizicky 2020), consistent with the 5-FU sensitivity of S. cerevisiae trm8Δ mutants (Gustavsson and Ronne 2008). Second, we had shown that S. pombe trm8Δ dhp1 mutants were 5-FU resistant (De Zoysa and Phizicky 2020), likely because the dhp1 mutations protect tRNAs from decay due to the lack of both m7G, and modifications inhibited by 5-FU (Frendewey et al. 1982; Santi and Hardy 1987; Huang et al. 1998). We also tested 3-AT sensitivity because S. pombe trm8Δ gcn2 mutants, like other strains with mutations in the GAAC pathway, are sensitive to 3-AT, a competitive inhibitor of His3 that leads to histidine starvation and activation of the GAAC pathway, resulting in massive re-programming of gene expression that includes increased biosynthesis of His3 (Hinnebusch 2005).

In this way, we identified a group of four trm8Δ suppressors that suppressed trm8Δ temperature sensitivity in rich (YES) and complete minimal media lacking histidine (EMMC-His) almost as efficiently as a trm8Δ suppressor with a representative dhp1 mutation (trm8Δ dhp1-W326L) or GAAC mutation (trm8Δ gcn2-M1I) (De Zoysa and Phizicky 2020). However, unlike the dhp1 suppressors, these suppressors grew poorly on media containing 5-FU at 33°C, and unlike the GAAC suppressors, these suppressors were resistant to 3-AT at 37°C (Fig. 1A and Fig. S1). This class of trm8Δ suppressors all proved to have mutations in rpl genes (rpl1701-Q72X, rpl502-Y44X, rpl1502-X201E, and rpl1102-K93X), encoding different proteins (Rpl17, Rpl5, Rpl15, and Rpl11) in the 60S subunit of the ribosome (Table S1). Based on Pombase, all of these mutations are in one of two paralogous genes and are not essential, and the three mutant alleles with a premature stop codon are predicted to be null mutants.

Fig. 1.
Fig. 1. A class of S. pombe trm8Δ suppressors have mutations in rpl genes, minimally restore tRNA levels, and prevent activation of the GAAC pathway.

(A). S. pombe trm8Δ suppressors with distinctive growth properties have mutations in rpl genes. S. pombe trm8Δ mutants and suppressors as indicated were grown overnight in YES media at 30°C, diluted to OD600 ∼ 0.5, serially diluted 10-fold in YES media, and 2 µl was spotted on plates containing YES, EMMC-His, EMMC-His with 10 mM 3-AT, and YES with 5-FU (30 µg/ml), as indicated. (B). The trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X suppressors do not appreciably prevent the decay of tRNATyr(GUA) and tRNAPro(AGG) at 38.5 °C in EMMC-Leu media. Strains transformed with a leu2+ vector were grown in triplicate in EMMC-Leu media at 30°C, diluted into fresh media at 30°C and 38.5°C and grown for 10 hours, and then bulk RNA was analyzed for tRNA levels by northern blot analysis as described in Materials and Methods, with the indicated probes. (C). Quantification of tRNA levels of WT, trm8Δ, and trm8Δ rpl mutants at 38.5°C in Fig. 1B. The bar chart depicts relative levels of tRNA species at 30°C and 38.5°C, relative to their levels in the WT strain at 30 °C (each value itself first normalized to levels of the control non-Trm8 substrate tRNAGly(GCC)). Standard deviations for each tRNA measurement are indicated. dark shades, 30°C growth; light shades, 38.5°C (D). S. pombe trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X mutants have reduced GAAC activation at 38.5°C, relative to trm8Δ strains. Bulk RNA from the growth in Fig. 1B was used for RT-qPCR analysis of the mRNA levels of the GAAC target lys4+ and the control act1+as described in Materials and Methods, and mRNA levels of lys4+were normalized to those of act1+.

To determine if the rpl mutations were responsible for the restoration of growth in the trm8Δ rpl suppressor mutants, we tested two of them for complementation by a [leu2+] plasmid containing the corresponding rpl+ gene. Consistent with complementation, we found that, like the trm8Δ [leu2+] strain, expression of rpl502+in the trm8Δ rpl502 mutant, or of rpl1701+ in the trm8Δ rpl1701 mutant (but not the vector controls) resulted in temperature sensitivity in EMMC-Leu media at 39°C, 5-FU resistance at 33°C, and 3-AT sensitivity at 38°C (Fig. S2).

Suppression of the S. pombe trm8Δ temperature sensitivity by each of three rpl mutations occurs without significant restoration of tRNA levels

As the temperature sensitivity of S. pombe trm8Δ mutants is due to decay of tRNATyr(GUA), and to a limited extent tRNAPro(AGG) (De Zoysa and Phizicky 2020), we analyzed tRNA levels of trm8Δ rpl suppressors after temperature shift from 30°C to 38.5°C. As expected, in trm8Δ mutants at 38.5°C, tRNATyr(GUA) levels were reduced, to 30% of WT levels (Fig. 1B, 1C). Surprisingly, we found that in the trm8Δ rpl1701-Q72X suppressor the tRNATyr(GUA) levels were not restored, but were if anything slightly reduced, relative to the trm8Δ mutant (23% vs 30%). Similarly, the tRNAPro(AGG) levels of the trm8Δ rpl1701-Q72X mutant (8%) were similar to, or slightly less, than those of the trm8Δ mutant (9%). Thus, for the trm8Δ rpl1701-Q72X suppressor, suppression is occurring without a detectable increase in levels of tRNATyr(GUA) or of tRNAPro(AGG). Comparable analysis shows that the trm8Δ rpl502-Y44X suppressor had slightly increased levels of tRNATyr(GUA) (36% vs 30%) and of tRNAPro(AGG) (13% vs 9%) relative to WT (Fig. 1B, 1C), and that the trm8Δ rpl1102-K93X suppressor also had little effect on levels of tRNATyr(GUA) and tRNAPro(AGG) (Fig. S3). By contrast, our prior results showed that each of four independent trm8Δ dhp1 suppressors invariably restored tRNATyr(GUA) levels by more than 2.8-fold (2.8 to 3.9 fold) relative to those in the trm8Δ mutant, to more than 72% (73 - 85%) of WT levels, whereas GAAC mutations partially restored tRNATyr(GUA) levels (by 1.7 to 2.1 fold), to 35 - 58% of WT levels (De Zoysa and Phizicky 2020). Thus, we conclude that as a group, these three rpl mutations suppress the temperature sensitivity of S. pombe trm8Δ mutants without obvious restoration of tRNATyr(GUA) levels, or of tRNAPro(AGG) levels.

Mutations in rpl genes prevent GAAC activation of S. pombe trm8Δ mutants

As we had previously shown that the temperature sensitivity of S. pombe trm8Δ mutants coincided with activation of the GAAC pathway and further loss of tRNATyr(GUA) (De Zoysa and Phizicky 2020), we measured GAAC activation in two of the S. pombe trm8Δ rpl mutants (trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X) at 38.5°C, using the same bulk RNA that we used for tRNA analysis in Fig. 2A and 2B. Consistent with our previous analysis (De Zoysa and Phizicky 2020), S. pombe trm8Δ mutants at 38.5°C had a 5.8-fold increase in relative mRNA levels of the GAAC target lys4+ (normalized to the control act1+mRNA), compared to that from WT cells at 38.5°C (5.13 vs 0.88) and a 7.5-fold increase compared to that from trm8Δ mutants at 30°C (5.13 vs 0.68). By contrast, trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X mutants had near baseline relative lys4+expression at both temperatures (0.97 and 0.88 vs 0.88 for WT, at 38.5°C) (Fig. 1D). Similar results were obtained by measuring relative aro8+ mRNA levels, although the GAAC activation is not as strong (Fig. S4), as we observed previously (De Zoysa and Phizicky 2020). We conclude that the rpl mutations inhibit the GAAC activation normally observed in trm8Δ mutants at 38.5°C, likely due to reduced ribosome concentrations arising from mutation of one of the two paralogs of each ribosomal protein.

Fig. 2.
Fig. 2. A reconstructed trm8Δ rpl502Δ mutant has the same properties as the trm8Δ rpl502-Y44X mutant.

(A). A reconstructed trm8Δ rpl502Δ mutant suppresses the S. pombe trm8Δ growth defect as efficiently as the original trm8Δ rpl502-Y44X mutant. WT, trm8Δ, trm8Δ rpl502-Y44X, and each of three independent reconstructed trm8Δ rpl502Δ strains and two independent rpl502Δ strains were analyzed for growth on media containing YES, EMMC-His, EMMC-His with 10 mM 3-AT, and YES with 5-FU (30 µg/ml), as indicated. (B). A reconstructed trm8Δ rpl502Δ suppressor does not substantially prevent decay of tRNATyr(GUA) and tRNAPro(AGG) in trm8Δ mutants at 38.5°C. Strains were grown in YES media at 30°C, shifted to 38.5°C for 9 hours, and analyzed for tRNA levels as described in Fig. 1B. (C). Quantification of tRNA levels of WT, trm8Δ and trm8Δ rpl502Δ mutants at 38.5°C. (D). A reconstructed trm8Δ rpl502Δ suppressor inhibits GAAC activation observed in trm8Δ mutants in YES Media at 38.5°C. Bulk RNA from the growth in Fig. 2B was analyzed for GAAC activation as described in Fig. 1D.

A reconstructed S. pombe trm8Δ rpl502Δ mutant has the same properties as a trm8Δ rpl502-Y44X mutant.

To ensure that the effects of the trm8Δ rpl502-Y44X mutant were solely due to the rpl502 mutation, rather than some background mutation that arose in the original trm8Δ strain before selection for suppressors, we introduced an rpl502Δ mutation into a clean trm8Δ mutant and tested the reconstructed trm8Δ rpl502Δ mutant. We found that a reconstructed trm8Δ rpl502Δ strain suppressed the growth defect of a trm8Δ mutant almost identically to the trm8Δ rpl502-Y44X mutant, with similar growth in YES and EMMC media at high temperature, and similar 5-FU sensitivity and 3-AT resistance (Fig. 2A). Also like trm8Δ rpl502-Y44X mutants, trm8Δ rpl502Δ mutants did not restore tRNATyr(GUA) levels after temperature shift to 38.5°C in YES media (33% vs 41% for trm8Δ mutants) whereas levels of tRNATyr(GUA) were modestly restored in trm8Δ gcn2Δ mutants (58% vs 41%), as we observed previously (De Zoysa and Phizicky 2020) (Fig. 2B, 2C). Similarly, tRNAPro(AGG) levels were not efficiently restored in trm8Δ rpl502Δ mutants (38%) relative to 25% in trm8Δ mutants and 49% in trm8Δ gcn2Δ strains. Furthermore, like trm8Δ rpl502-Y44X mutants, trm8Δ rpl502Δ mutants efficiently suppressed the GAAC activation observed in trm8Δ mutants, measured by relative lys4+ levels (from a 14.5-fold increase in trm8Δ mutants, to a 1.9-fold increase in trm8Δ rpl502Δ mutants), compared to near baseline 1.2-fold increase in a trm8Δ gcn2Δ strain (Fig. 2D; Fig. S5). We conclude that the suppression effects of the trm8Δ rpl502-Y44X mutant are explicitly due to the rpl mutation, and infer that the suppression by the trm8Δ rpl1701-Q72X and trm8Δ rpl1102-K93X mutations is also due to the rpl mutations.

We note that, as the control rpl502Δ mutants are as resistant to 3-AT as the trm8Δ rpl502Δ mutants (Fig. 2A), this property is due to the rplΔ mutation and not the trm8Δ mutation in these strains.

Deletion of any of several rpl+ or rps+ genes suppress the temperature sensitivity of S. pombe trm8Δ mutants

To determine if the spontaneous S. pombe trm8Δ rpl suppressors that we had found by selection represented a specific subset of ribosomal protein genes, we investigated whether or not suppression would extend to deletion of other rpl+or rps+ genes. We focused on six ribosomal protein genes that had two copies and thus were not essential, including rpl1701, for which we already had a spontaneous trm8Δ suppressor. Deletion of each of the two rps genes (rps2801Δ and rps802Δ, encoding Rps28 and Rps8) and four rpl genes examined (rpl1601Δ, rpl1202Δ, rpl2802Δ, and rpl1701Δ, encoding Rpl16, Rpl12, Rpl28, and Rpl17) resulted in efficient suppression of the trm8Δ temperature sensitivity in EMMC-His media, although suppression was somewhat weaker for the rpl1601Δ mutation (Fig. 3A, 3B). Similarly, all five of the trm8Δ rplΔ and trm8Δ rpsΔ mutants that were robust trm8Δ suppressors were also sensitive on YES+5-FU media at 33°C, whereas the weak trm8Δ rpl1601Δ suppressor was slightly sensitive on YES+5-FU. We conclude that rplΔ and rpsΔ mutations generally cause suppression of the S. pombe trm8Δ growth defect, presumably as a consequence of the reduced concentrations of the corresponding ribosomal subunits (Warner 1999; Cheng et al. 2019).

Fig. 3.
Fig. 3. Deletion of any of several rpl+ or rps+ genes restores growth of S. pombe trm8Δ mutants at elevated temperatures.

(A, B). S. pombe rpl genes and rps genes as indicated were deleted in WT and trm8Δ strains, and cultures were grown and analyzed on the indicated media.

By contrast, we found that 3-AT resistance was not correlated with the efficiency of suppression in trm8Δ rplΔ strain, as one of the robust trm8Δ suppressors was almost completely 3-AT sensitive (trm8Δ rpl1202Δ) and two other robust suppressors were only moderately 3-AT resistant (trm8Δ rps2801Δ and trm8Δ rps802Δ), whereas the robust trm8Δ rplΔ2802Δ and trm8Δ rpl1701Δ suppressor strains were strongly 3-AT resistant. This result is consistent with our finding above that 3-AT resistance is a property of the mutation in the ribosomal protein gene, and not the trm8Δ mutation, However, it is not immediately clear why some mutations in ribosomal protein genes result in 3-AT resistance and others result in sensitivity, although it is known that different mutations in ribosomal protein genes in S. cerevisiae result in different growth properties and phenotypes (Steffen et al. 2012; Cheng et al. 2019).

An S. pombe tan1Δ mutant lacks 4-acetylcytidine and is temperature sensitive due to decay of tRNALeu(AAG) and tRNALeu(UAG) by the RTD pathway

To explore the generality of the effect of the ribosome and GAAC mutations on the growth of S. pombe modification mutants, we examined an S. pombe tan1Δ mutant. It is well established from work in S. cerevisiae that tan1Δ mutants lack 4-acetylcytidine at C12 (ac4C12) in their tRNALeu and tRNASer species, which have a long variable arm (Johansson and Bystrom 2004), that tan1Δ trm44Δ mutants are temperature sensitive due to RTD of tRNASer(CGA) and tRNASer(UGA) (Chernyakov et al. 2008), and that the temperature sensitivity of tan1Δ single mutants is associated with decay of tRNASer(CGA) and tRNASer(UGA) and is suppressed by a met22Δ mutation (Dewe et al. 2012). Indeed, we find that the temperature sensitivity of S. cerevisiae tan1Δ mutants is completely suppressed by overexpression of tRNASer(CGA) and nearly as efficiently suppressed by overexpression of tRNASer(UGA) (Fig. S6).

Consistent with the biology of Tan1 in S. cerevisiae, we find that S. pombe tan1Δ mutants are temperature sensitive due to decay of two tRNA species by the RTD pathway. As anticipated based on the conservation of Tan1 sequence and the Tan1 requirement for ac4C12 modification of tRNALeu and tRNASer within a CCG motif (Aravind and Koonin 2001; Sharma et al. 2015; Sas-Chen et al. 2020; Broly et al. 2022), purified tRNALeu(CAA) from S. pombe tan1Δ mutants lacks any detectable ac4C, compared to that in WT cells, but has similar levels of four control modifications (Fig. 4A). In addition, we find that S. pombe tan1Δ mutants are temperature sensitive on both YES media and EMMC-Leu media at 38°C (Fig. 4B). The S. pombe tan1Δ temperature sensitivity is associated with reduced levels of tRNALeu(AAG) and tRNALeu(UAG) at 30°C that are further reduced at 39°C (relative to those in WT cells), whereas levels of each of the other tRNALeu and tRNASer species do not conform to this pattern (Fig. 4C, Fig. S7, S8). Furthermore, the temperature sensitivity of S. pombe tan1Δ mutants is almost entirely due to tRNALeu(AAG), and to some extent tRNALeu(UAG), as overexpression of these two tRNAs, or tRNALeu(AAG) alone, efficiently suppresses the temperature sensitivity (Fig. 4D). Moreover, as anticipated from Tan1 biology in S. cerevisiae, whole genome sequencing resulted in identification of three S. pombe tan1Δ suppressors with dhp1 mutations (dhp1-I196T, dhp1-P677S, and dhp1-P203L), indicating decay of these tRNAs by the RTD pathway; these suppressors will be discussed elsewhere.

Fig. 4.
Fig. 4. S. pombe tan1Δ mutants lack 4-acetylcytidine and are temperature sensitive due to decay of tRNALeu(AAG) and tRNALeu(UAG).

(A). S. pombe tan1Δ mutants lack ac4C in their tRNALeu(CAA). S. pombe WT and tan1Δ mutants were grown in triplicate in YES media at 30°C to late log phase, and tRNALeu(CAA) was purified from bulk RNA, digested to nucleosides, and analyzed for modifications by HPLC as described in Materials and Methods. (B). S. pombe tan1Δ mutants are temperature sensitive. S. pombe WT and tan1Δ mutants were transformed with a [leu2+] or a [leu2+ tan1+] plasmid as indicated, and transformants were grown overnight in EMMC-Leu media, serially diluted, and plated on media as indicated. (C). S. pombe tan1Δ mutants have reduced levels of tRNALeu(AAG) and tRNALeu(UAG) at 39°C. S. pombe WT and tan1Δ mutants were transformed with a [leu2+] plasmid, and transformants were grown in EMMC-Leu media to mid-log phase, diluted and shifted to 39°C and grown for 12 hours, and RNA was isolated at 0, 3, 6, 9, and 12 hours and analyzed by Northern blot as described in Materials and Methods, with the indicated probes. shades of blue, WT strains, analyzed at 0 (darkest) through 12 hours (lightest); shades of green, tan1Δ strains (D). The temperature sensitivity of S. pombe tan1Δ mutants is efficiently suppressed by overexpression of tRNALeu(AAG) and, to some extent, tRNALeu(UAG). S. pombe WT and tan1Δ mutants were transformed with a [leu2+] plasmid expressing tRNAs as indicated, or a vector control, and transformants were grown overnight in EMMC - Leu media at 30 °C and analyzed for growth, as in Fig 1A, on plates containing EMMC – Leu or YES media.

A prominent class of S. pombe tan1Δ suppressors have mutations in rpl genes or related genes predicted to reduce 60S subunits

Consistent with our results with S. pombe trm8Δ suppressors, we find that several spontaneous suppressors of the temperature sensitivity of S. pombe tan1Δ mutants have mutations in ribosomal protein genes. Thus, of seven tan1Δ suppressors that are resistant to 3-AT at 35°C and somewhat sensitive to 5-FU at 38°C, whole genome sequencing showed that five have rpl mutations (rpl1101-N7fs, rpl1102-R133fs, rpl1502-R67_R68_insVR, rpl1701-T35fs, rpl2802-G113fs, and rpl3001-N80fs) and the seventh has a grn1-N37fs mutations. S. pombe Grn1 and its S. cerevisiae ortholog Nug1 are critical GTPases required for pre-60S rRNA processing (Bassler et al. 2001; Du et al. 2006). It is therefore clear that this selection (temperature resistance) and screening procedure (3-AT-resistance, 5-FU sensitivity) is consistently yielding tan1Δ suppressors with mutations predicted to reduce the amount of the 60S subunit, just as we observed with trm8Δ suppressors.

We confirmed two of the ribosomal protein mutations as tan1Δ suppressors by introduction of the corresponding deletion mutation into a clean tan1Δ background. Thus, we find that an rpl2802Δ mutation efficiently suppresses the growth phenotypes of an S. pombe tan1Δ mutant, resulting in temperature resistance on EMMC-His media and YES media at 38°C, 3-AT resistance at 35°C, and 5-FU sensitivity at 35°C (Fig. 5A). Similarly, an rpl1701Δ mutation also efficiently suppresses each of the growth phenotypes of an S. pombe tan1Δ mutant, resulting in temperature resistance, 3-AT resistance, and 5-FU sensitivity (Fig. 5B).

Fig. 5.
Fig. 5. The temperature sensitivity of S. pombe tan1Δ mutants is efficiently suppressed by rplΔ and rpsΔ mutations.

(A). A reconstructed tan1Δ rpl2802Δ mutant suppresses the S. pombe tan1Δ growth defect. The rpl2802Δ mutation was introduced into WT, and tan1Δ strains, and then WT, tan1Δ, rpl2802Δ, tan1Δ rpl2802Δ strains were grown overnight in YES media and analyzed for growth on media containing YES, EMMC - His, EMMC - His with 10 mM 3-AT, and YES with 5-FU (30 µg/ml), as indicated. (B). A reconstructed tan1Δ rpl1701Δ mutant suppresses the S. pombe tan1Δ growth defect, as does each of two other tested deletions of ribosomal proteins. The rpl1701Δ, rps23Δ, and rpl502Δ mutations were introduced into WT and tan1Δ strains, and then strains were grown overnight in YES media and analyzed for growth on media containing YES, EMMC - His, EMMC - His with 10 mM 3-AT, and YES with 5-FU (30 µg/ml), as indicated.

In addition, we find that tan1Δ suppression is not restricted to the specific ribosomal protein mutations that were selected, based on analysis of two other ribosomal protein genes. Thus, we find that an rps23Δ mutation and an rpl502Δ mutation each efficiently suppress the temperature sensitivity of the tan1Δ mutant, although we note that the tan1Δ rps23Δ mutant is not 5-FU sensitive, and that the tan1Δ rpl502Δ mutant is only slightly 3-AT resistant at 35°C (Fig. 5B).

The rpl502Δ mutation suppresses the temperature sensitivity of the S. pombe tan1Δ mutant without restoring tRNA levels or affecting GAAC activation

To assess the role of the rpl502Δ mutation in suppression of the S. pombe tan1Δ growth defect, we grew cells at 30°C in YES media, shifted to 39°C, and analyzed both tRNA levels and GAAC activation after 9 hours. As we saw for the trm8Δ rpl502Δ strain, we find that the tan1Δ rpl502Δ strain does not have restored tRNA levels after growth at 39°C (Fig. 6A, 6B). Relative tRNALeu(AAG) levels are reduced substantially in tan1Δ strains after growth at 39°C (to 24% of WT), and remain low in the tan1Δ rpl502Δ strain at 39°C (19% of WT), but each of two control tRNAs are unaffected in both strains. However, we find that although an S. pombe tan1Δ mutant activates the GAAC pathway, based on analysis of relative lys4+mRNA levels, the activation is weak, and is only modestly reduced in a tan1Δ rpl502Δ strain (Fig. 6C). Thus, we find that a tan1Δ mutant has a 3.3-fold increase in relative lys4+ mRNA levels at 39°C (1.62) compared to WT at 39°C (0.49) and a 2.1-fold increase compared to tan1Δ mutants at 30°C (0.80). This is substantially weaker than the GAAC activation of a trm8Δ mutant in the same experiment, which increases 23.4-fold compared to WT at 39°C (11.45 vs 0.49) and 12.6-fold, compared to trm8Δ mutants at 30°C (11.45 vs 0.91). Moreover, we find that an rpl502Δ mutation has only a minimal effect on GAAC activation by a tan1Δ mutant. Thus, a tan1Δ rpl502Δ mutant has a 2.5-fold increase in relative lys4+ levels at 39°C relative to 30°C (1.13 vs 0.46), compared to 2.1-fold for the tan1Δ mutant. and a 2.31-fold increase at 39°C relative to WT at 39°C (1.13 vs 0.49), compared to 3.31-fold for the tan1Δ mutant.

Fig. 6.
Fig. 6. An S. pombe tan1Δ rpl502Δ suppressor does not rescue the tRNALeu(AAG) decay observed in tan1Δ mutants and only minimally inhibits the modest GAAC activation.

(A). An S. pombe tan1Δ rpl502Δ suppressor does not rescue the tRNALeu(AAG) decay observed in tan1Δ mutants. Strains were grown in YES media at 30°C, shifted to 39°C for 9 hours, and bulk RNA was analyzed for tRNA levels as described in Fig. 1B. (B). Quantification of tRNA levels of WT, tan1Δ, and tan1Δ rpl502Δ mutants at 39°C in Fig. 6A. (C). Analysis of GAAC activation. Bulk RNA from the growth in Fig. 6A was analyzed for GAAC activation as described in Fig. 1D. (D). The temperature sensitivity of a tan1Δ mutant is more efficiently suppressed in tan1Δ rpl502Δ strains than in tan1Δ gcn2Δ strains. WT and tan1Δ strains with rpl502Δ or gcn2Δ mutations were grown overnight in YES media and analyzed for growth on media containing YES or EMMC - His, as indicated.

A similar analysis after growth of strains in EMMC-Leu media yields similar results regarding the effect of the rpl502Δ mutation on S. pombe tan1Δ mutants (Fig. S9). We observe reduced levels of tRNALeu(AAG) in the S. pombe tan1Δ mutant at 39°C (23% of WT levels at 30°C), which remain at similar or slightly lower levels in the tan1Δ rpl502Δ strain (19%). Although we observe some activation of the GAAC pathway in an S. pombe tan1Δ mutant, based on analysis of relative lys4+ mRNA levels, the rpl502Δ mutation has only a modest effect on this activation. The tan1Δ mutant has a 3.8-fold increase in relative lys4+ mRNA levels, compared to WT at 39°C (4.79 vs 1.27) (which is smaller than the 5.7-fold in the trm8Δ mutant), whereas the tan1Δ rpl502Δ strain has a 2.6 fold increase (Fig. S9).

These weak effects of the tan1Δ mutant and the tan1Δ rpl502Δ mutant on GAAC activation are consistent with the observation that an rpl502Δ mutation is a more efficient suppressor of the temperature sensitivity of an S. pombe tan1Δ mutant than is a gcn2Δ mutation, on either YES media or EMMC-His media at 38°C (Fig. 6D).

We infer from these results that the rpl502Δ mutation suppresses that tan1Δ mutant by reducing the need for tRNALeu(AAG), and likely tRNALeu(UAG), due to the reduced number of translating ribosomes arising from the rpl502Δ mutation, rather than by effects on the GAAC pathway due to reduced ribosome collisions.

In S. cerevisiae, deletion of rpl or rps genes exacerbates the temperature-sensitivity of trm8Δ trm4Δ mutants

To investigate the evolutionary conservation of the effect of loss of ribosomal protein genes on mutants lacking m7G, we examined the growth properties arising from deletion of RPL or RPS genes in an S. cerevisiae trm8Δ trm4Δ mutant. This mutant is known to be highly temperature sensitive due to decay of tRNAVal(AAC) by the RTD pathway (Alexandrov et al. 2006; Chernyakov et al. 2008), and like the S. pombe trm8Δ mutant, undergoes GAAC activation coincident with temperature sensitivity and the onset of tRNA decay (De Zoysa and Phizicky 2020). However, unlike the case with S. pombe trm8Δ mutants, gcn2Δ and gcn1Δ mutations each exacerbate the temperature sensitivity of S. cerevisiae trm8Δ trm4Δ mutants, and exacerbate the loss of tRNAVal(AAC) at 32°C, leading to the conclusion that GAAC activation in S. cerevisiae trm8Δ trm4Δ mutants prevents further loss of tRNAVal(AAC) and is beneficial (De Zoysa and Phizicky 2020).

We find that deletion of each of four tested RPL genes (RPL1A, RPL11B, RPL17B, or RPL33B) or three RPS genes (RPS0A, RPS22A, RPS28A) in the S. cerevisiae trm8Δ trm4Δ mutant does not suppress the temperature sensitivity of the strain, but rather, exacerbates its temperature sensitivity on rich (YPD) media and/or minimal (SD) media (Fig. 7A, 7B). We note that the exacerbated growth defect in the S. cerevisiae trm8Δ trm4Δ rpl1AΔ mutant is less distinct, which is likely related to the fact that although the tested ribosomal protein genes are all duplicated, the RPL1A gene is known to be the minor paralog (Petitjean et al. 1995; Steffen et al. 2008). Overall, the exacerbated growth defect in S. cerevisiae trm8Δ trm4Δ mutants bearing rplΔ or rplsΔ mutations is consistent with the opposite effects of GAAC activation in S. pombe trm8Δ mutants and S. cerevisiae trm8Δ trm4Δ mutants.

Fig. 7.
Fig. 7. Deletion of any of several ribosomal protein genes exacerbates the temperature sensitivity of S. cerevisiae trm8Δ trm4Δ mutants in YPD Media.

rpl genes (A) and rps genes (B) as indicated were deleted in S. cerevisiae WT and trm8Δ trm4Δ strains, and cultures were grown and analyzed on the indicated media.

Discussion

We have provided evidence here that for each of two S. pombe body modification mutants (trm8Δ mutants and tan1Δ mutants), that are temperature sensitive due to RTD of specific hypomodified tRNAs, mutations in ribosomal protein genes suppress the growth defect without altering tRNA levels.

The finding that S. pombe tan1Δ mutants are temperature sensitive due to RTD is consistent with our work in S. cerevisiae showing that tan1Δ mutants are temperature sensitive due to RTD (Chernyakov et al. 2008; Kotelawala et al. 2008; Dewe et al. 2012)(Fig. S6), and emphasizes the conservation of this aspect of Tan1 biology across 600 million years (Parfrey et al. 2011). Recently, several individuals with a specific syndromic neurodevelopmental disorder were found to have bi-allelic mutations in the human TAN1 ortholog THUMPD1, which was linked to complete loss of ac4C in small RNA and in purified tRNASer(CGA) for one set of derived lymphoblastoid cell lines, and for each of two human KO cell lines (Broly et al. 2022). Based on our results, one plausible explanation for the neurological disorder of patients with bi-allelic THUMPD1 mutations is that one or more tRNAs is destabilized due to the loss of ac4C, resulting in degradation of those tRNAs by the RTD pathway.

We interpret the results presented here as an expansion of our prior model to explain the common link between the RTD pathway and GAAC activation that we observe in both S. pombe trm8Δ mutants and S. cerevisiae trm8Δ trm4Δ mutants (Fig. 8). In the original model (De Zoysa and Phizicky 2020), increased temperature in both of these mutant strains concomitantly reduces the growth rate and triggers decay of specific hypomodified tRNAs (tRNATyr(GUA) and tRNAPro(AGG) in S. pombe trm8Δ mutants, and tRNAVal(AAC) in S. cerevisiae trm8Δ trm4Δ mutants), which in turn activates the GAAC pathway. In S. pombe trm8Δ mutants, GAAC activation results in further loss of the tRNATyr(GUA) and tRNAPro(AGG), explaining why mutation of GAAC components suppresses their temperature sensitivity. In contrast, in S. cerevisiae trm8Δ trm4Δ mutants, GAAC activation prevents further loss of the tRNAVal(AAC), explaining why mutation of GAAC components exacerbates their temperature sensitivity and loss of tRNAVal(AAC).

Fig. 8.
Fig. 8. A model describing the roles of rpl, rps mutations in the biology of S. pombe trm8Δ and S. cerevisiae trm8Δ trm4Δ mutants.

In both S. pombe trm8Δ mutants (red) and S. cerevisiae trm8Δ trm4Δ mutants (green), elevated temperature (38.5°C and 32°C respectively) triggers RTD of the corresponding tRNA (decay of tRNATyr(GUA) by Dhp1/Rat1 in S. pombe and decay of tRNAVal(AAC) by Rat1/Dhp or Xrn1 in S. cerevisiae). In each organisms, the reduced levels of the corresponding tRNA result in increased ribosome collisions and activation of the GAAC pathway (blue), leading to further loss of tRNATyr(GUA) in S. pombe and prevention of further loss of tRNAVal(AAC) in S. cerevisiae (De Zoysa and Phizicky 2020). In both organisms, the rpl and rps mutations (brown) result in a reduced concentration of ribosomes, leading to inhibition of ribosome collisions and reduced GAAC activation. In both organisms, the reduced concentration of ribosomes is also expected to result in reduced translation and reduced demand for tRNA use in translation.

In the expanded model (Fig. 8), the rpl and rps mutations lead to a reduced concentration of ribosomes in both S. pombe and S. cerevisiae, consistent with the fact that many S. cerevisiae rpl or rps mutants result in reduced concentrations of 60S or 40S subunits and reduced translation (Warner 1999; Cheng et al. 2019). The reduced population of ribosomes has two consequences. First, there are reduced collisions of translating ribosomes, known to result in reduced activation of the GAAC (integrated stress response) pathway in S. cerevisiae and mammals (Wu et al. 2020; Yan and Zaher 2021; Kim and Zaher 2022). This effect is seen in S. pombe trm8Δ mutants and S. cerevisiae trm8Δ trm4Δ mutants, leading to suppression of the temperature sensitivity of S. pombe trm8Δ mutants and exacerbation of the temperature sensitivity of S. cerevisiae trm8Δ trm4Δ mutants. Second, the reduced population of ribosomes in strains with rplΔ and rpsΔ mutations results in reduced translation and therefore a reduced requirement for tRNA. This effect is seen in S. pombe tan1Δ mutants, in which an rpl502Δ mutation does not restore tRNALeu(AAG) levels at 39°C, does not significantly inhibit the relatively weak GAAC activation observed in tan1Δ mutants, but suppresses the tan1Δ growth defect more efficiently than a gcn2Δ mutation.

We infer that the ribosomal protein mutations result in a reduced number of ribosomes, rather than resulting in a specific mode of ribosome function, for two reasons. First there is large diversity in the rpl and rps mutations/deletions that suppress the growth defect of S. pombe trm8Δ mutants (encoding seven different large subunit proteins and two different small subunit proteins) or of S. pombe tan1Δ mutants (encoding four different large subunit proteins and one small subunit protein, including one from each subunit that was not observed or tested in trm8Δ mutants). Second, these eight different proteins of the large subunit and three different proteins of the small subunit are found at different locations on the mature ribosome (Ben-Shem et al. 2011; Yusupova and Yusupov 2014). The isolation of the grn1-N37fs mutation as a tan1Δ suppressor also implicates the concentration of the 60S subunit, given its known crucial role in 60S biogenesis (Bassler et al. 2001; Du et al. 2006).

It is curious that many of the spontaneous S. pombe trm8Δ and tan1Δ suppressors that we sequenced after screening for 3-AT resistance and 5-FU sensitivity had mutations in rpl genes or in the grn1 gene (implicated in 60S production), but not in rps genes. Although we do not know the source of this bias, results of others show distinct differences in the growth rates of individual S. cerevisiae rplΔ or rpsΔ mutant strains, and significant differences between the properties of rplΔ and rpsΔ mutant strains (Steffen et al. 2008; Steffen et al. 2012; Cheng et al. 2019). Presumably the same is true in S. pombe rplΔ or rpsΔ mutant strains. We note in this connection that different tested S. pombe rplΔ or rpsΔ mutations have different growth properties in 3-AT.

According to the proposed model, the mechanism by which rpl or rps mutations suppress will depend on which specific consequence of reduced ribosome concentration is more important in the particular modification mutant. In S. pombe trm8Δ mutants, the GAAC activation is large and concomitant with the onset of a growth defect and the initial loss of tRNA, and the rpl mutations unambiguously suppress the GAAC activation, whereas in S. pombe tan1Δ mutants, the GAAC activation is not as large, and suppression occurs more because of the reduced need for tRNA. As both the reduced GAAC activation and the reduced need for tRNA act in the same direction, to suppress the growth defect in S. pombe, the dominant effect of the rpl mutation (inhibition of GAAC activation or reduced need for tRNA) will depend on the modification mutant, and on the specific conditions of the growth experiment. The situation is more complicated in S. cerevisiae trm8Δ trm4Δ mutants, because the mutations in ribosomal protein genes are expected to exert their effects in two opposite directions. Thus, in S. cerevisiae trm8Δ trm4Δ mutants, rplΔ and rpsΔ mutations are expected to exacerbate the growth defect by preventing GAAC activation, resulting in increased loss of tRNA (Fig. 8), and are also expected to suppress the growth defect by reducing tRNA demand. The result of these two opposite effects is a more modest predicted effect of rplΔ and rpsΔ mutations on the growth of S. cerevisiae trm8Δ trm4Δ mutants than on the growth of S. pombe trm8Δ or tan1Δ mutants.

Based on our model, it seems likely that mutations in rpl or rps genes will similarly suppress the growth defect of other S. pombe modification mutants, particularly those in which the growth defect is due to RTD of an elongator tRNA. Moreover, as the connection between the ribosome and body modification mutants extends to S. cerevisiae trm8Δ trm4Δ mutants, it seems likely that similar modification mutants in other organisms, including humans will have corresponding effects.

Materials and Methods

Yeast strains

S. pombe haploid WT and two independent S. pombe trm8Δ::kanMX strains were derived from SP286 (ade6-M210/ade6-M216, leu1-32/leu1-32, ura4-D18/ura4-D18 h+/h+)(Kim and Johnson 1988), and were obtained from Jeffrey Pleiss (Cornell University). S. pombe trm8Δ::kanMX and trm8Δ::kanMX rpl502Δ::hygMX strains were constructed from haploid WT strains by PCR amplification of trm8Δ::kanMX DNA or rpl502Δ::hygMX, followed by linear transformation using lithium acetate (Bahler et al. 1998). Other deletion strains were constructed in the same way (Table S1). S. cerevisiae deletion strains (Table S2) were constructed by linear transformation with PCR amplified DNA from the appropriate knockout strain (Giaever et al. 2002). All S. pombe and S. cerevisiae strains were confirmed before use by PCR amplification, and two or three independent isolates were compared for growth properties before use.

Plasmids

Plasmid AB553-1 was derived from pREP3X (De Zoysa and Phizicky 2020). The S. pombe plasmids expressing S. pombe Prpl502+ rpl502+(EAH 284-1) and S. pombe Prpl1701+ rpl1701+ (EAH 282-1) were generated by inserting PCR amplified DNA genomic DNA (including ∼1000 bp upstream and downstream) into the Not I and Xho I sites of AB 553-1, removing the Pnmt1 promoter (Table S3).

Yeast media and growth conditions

S. pombe strains were grown in rich (YES) media (containing 0.5% yeast extract, 3% glucose, and supplements of 225 mg/l of adenine, uracil, leucine, histidine and lysine), or Edinburgh minimal media complete (EMM-C) containing glucose and 225 mg/l of all amino acids, adenine, and uracil, as well as 100 mg/l of para-amino benzoic acid and inositol, and 1125 mg/l of leucine for Leu- auxotrophs (Udagawa et al. 2008). For temperature shift experiments, cells were grown in YES or EMMC-Leu media at 30°C to OD600 ∼ 0.5, diluted to ∼ 0.1 OD in pre-warmed media and grown for 9-10 hours as indicated (De Zoysa and Phizicky 2020).

Bulk RNA preparation and northern blot analysis

For northern analysis, 3 biological replicates were grown in parallel, and then bulk RNA was isolated from pellets derived from 2 ml culture using acid washed glass beads and phenol, separated on a 10% polyacrylamide (19:1), 7M urea, 1X TBE gel, transferred to Amersham Hybond-N+ membrane, and analyzed by hybridization to 5’ 32P-labeled DNA probes (Table S4) as described ((Alexandrov et al. 2006).

Isolation and purification of tRNA, and analysis of nucleoside modifications

S. pombe tan1Δ mutants and WT cells were grown to OD ∼ 1.0 in YES media at 30°C. Then bulk RNA was extracted from ∼ 300 OD of pellets with hot phenol, and tRNALeu(CAA) was purified using the 5’-biotinylated oligonucleotide ONV22 (5’ TGGTGACCAGTGAGGGATTCGAAC, complementary to residues 76-53, using standard nomenclature), digested to nucleosides, and analyzed by HPLC as previously described (Jackman et al. 2003).

Quantitative RT-PCR analysis

Strains were grown in triplicate to log phase and bulk RNA was prepared from 2-5 OD pellets using acid washed glass beads and phenol, treated with RQ1 RNase-free DNase (Promega), reverse transcribed with Superscript II Reverse Transcriptase, and cDNA was analyzed by quantitative PCR as described (Preston et al. 2013).

Spontaneous suppressors and whole-genome sequencing

To select spontaneous suppressors of S. pombe trm8Δ mutants, individual colonies were inoculated into YES media at 30°C and ∼107 cells of overnight cultures were plated YES media at 38°C and 39°C. Whole genome sequencing was performed by the University of Rochester Genomics Center at a read depth of 20–110 per genome nucleotide.

Supplementary Figure Legends

Fig. S1.
Fig. S1. S. pombe trm8Δ rpl1102 mutants show growth properties similar to trm8Δ rpl 1701 mutants.

S. pombe trm8Δ mutants and suppressors as indicated were grown overnight in YES media at 30°C and analyzed for growth on plates as described in Fig.1A.

Fig. S2:
Fig. S2: The growth properties of trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X mutants are complemented by their respective WT genes.

S. pombe trm8Δ rpl502-Y44X and trm8Δ rpl1701-Q72X mutants were transformed with a [leu2+ rpl502+] or [leu2+ rpl1701+] plasmid respectively, or a [leu2+] vector control, and transformants were grown overnight in EMMC-Leu media at 30 °C and analyzed for growth, as in Fig 1A, on plates containing EMMC-Leu, YES with 5-FU (30 µg/ml), and EMMC-His with 10 mM 3-AT.

Fig. S3.
Fig. S3. S. pombe trm8Δ rpl1102 mutants do not significantly restore tRNATyr(GUA) and tRNAPro(AGG) levels at 38.5 °C.

Strains were transformed with a leu2+vector and then grown in EMMC-Leu media at 30°C and shifted to 38.5°C. Growth was monitored for 10 hours before harvest, and then bulk RNA was isolated and analyzed by northern blot analysis as described in Materials and Methods, and tRNA levels were quantified as described in Fig. 1C. Note that for this experiment biological replicates were compared, rather than triplicates.

Fig. S4.
Fig. S4. S. pombe trm8Δ rpl1701-Q72X and trm8Δ rpl502-Y44X mutants have reduced GAAC activation of aro8+ mRNA at 38.5°C, relative to trm8Δ strains.

Bulk RNA from the experiment in Fig. 1B was used to analyze aro8+ mRNA levels, as described in Fig 1D.

Fig. S5.
Fig. S5. S. pombe trm8Δ rpl502Δ mutants have reduced GAAC activation of aro8+ mRNA at 38.5°C, relative to trm8Δ strains.

Bulk RNA from the experiment in Fig. 2B was used to analyze aro8+ mRNA levels, as described in Fig 1D.

Fig. S6.
Fig. S6. The temperature sensitivity of an S. cerevisiae tan1Δ mutant is efficiently suppressed by overexpression of tRNASer(CGA) or tRNASer(UGA).

S. cerevisiae WT and tan1Δ mutants were transformed with a [LEU2+] plasmid expressing tRNAs as indicated, or a vector control, and transformants were grown overnight in SD - Leu media at 30 °C and analyzed for growth as in Fig 1A, on plates containing SD – Leu or YPD media.

Fig. S7.
Fig. S7. S. pombe tan1Δ mutants have reduced levels of tRNALeu(AAG) and tRNALeu(UAG) at 39°C.

S. pombe WT and tan1Δ mutants were transformed with a [leu2+] plasmid, and transformants were grown in EMMC - Leu media to mid-log phase, diluted and shifted to 39°C and grown for 12 hours, and RNA was isolated at 0, 3, 6, 9, and 12 hours and analyzed by Northern blot as described in Materials and Methods, with the indicated probes.

Fig. S8.
Fig. S8. Quantification of the Northern in Fig. S7 shows that S. pombe tan1Δ mutants have reduced levels of tRNALeu(AAG) and tRNALeu(UAG) at 39°C.

The Northern in Fig. S7 was quantified as described in Fig. 1C. Note that the data in Fig. 4C is from this quantification. shades of blue, WT strains analyzed at 0 (darkest) through 12 hours (lightest); shades of green, tan1Δ strains.

Fig. S9.
Fig. S9. An S. pombe tan1Δ rpl502Δ suppressor does not rescue the tRNALeu(AAG) decay observed in tan1Δ mutants after growth in SD – Leu media and only minimally inhibits the modest GAAC activation.

(A). An S. pombe tan1Δ rpl502Δ suppressor does not rescue the tRNALeu(AAG) decay observed in tan1Δ mutants in SD – Leu media. S. pombe WT, tan1Δ, and tan1Δ rpl502Δ mutants were transformed with a [leu2+] plasmid, and transformants were grown in EMMC - Leu media to mid-log phase, diluted into fresh media at 30°C and 39°C and grown for 9 hours, and then bulk RNA was analyzed for tRNA levels by northern blot analysis as described in Materials and Methods, with the indicated probes. (B). Quantification of tRNA levels of WT, tan1Δ, and tan1Δ rpl502Δ mutants at 39°C in Fig. 6A. (C). Analysis of GAAC activation. Bulk RNA from the growth in Fig. S9A was analyzed for GAAC activation as described in Fig. 1D.

Supplementary Tables

View this table:
Table S1. S. pombe strains used in this study
View this table:
Table S2. S. cerevisiae strains used in this study
View this table:
Table S3. Plasmids used in this study
View this table:
Table S4. Oligonucleotides used in this study

Acknowledgments

We also thank Dr. Elizabeth Grayhack for valuable discussions and comments during the course of this work and for critical reading of the manuscript, Dr. Franziska Stegemann for help in manuscript preparation, and members of the Phizicky and Grayhack labs for discussions throughout this work. This research was supported by National Institutes of Health, National Institute of General Medical Sciences (NIH/NIGMS) grant GM052347 to E.M.P. and GM080669 to J.C.F.

References

  1. ↵
    Alexandrov A, Chernyakov I, Gu W, Hiley SL, Hughes TR, Grayhack EJ, Phizicky EM. 2006. Rapid tRNA decay can result from lack of nonessential modifications. Mol Cell 21: 87–96.
    OpenUrlCrossRefPubMedWeb of Science
  2. ↵
    Aravind L, Koonin EV. 2001. THUMP--a predicted RNA-binding domain shared by 4-thiouridine, pseudouridine synthases and RNA methylases. Trends in biochemical sciences 26: 215–217.
    OpenUrlCrossRefPubMedWeb of Science
  3. ↵
    Bahler J, Wu JQ, Longtine MS, Shah NG, McKenzie A, 3rd, Steever AB, Wach A, Philippsen P, Pringle JR. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14: 943-951.
    OpenUrl
  4. ↵
    Bassler J, Grandi P, Gadal O, Lessmann T, Petfalski E, Tollervey D, Lechner J, Hurt E. 2001. Identification of a 60S preribosomal particle that is closely linked to nuclear export. Mol Cell 8: 517–529.
    OpenUrlCrossRefPubMedWeb of Science
  5. ↵
    Ben-Shem A, Garreau de Loubresse N, Melnikov S, Jenner L, Yusupova G, Yusupov M. 2011. The structure of the eukaryotic ribosome at 3.0 A resolution. Science 334: 1524–1529.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Broly M, Polevoda BV, Awayda KM, Tong N, Lentini J, Besnard T, Deb W, O’Rourke D, Baptista J, Ellard S et al. 2022. THUMPD1 bi-allelic variants cause loss of tRNA acetylation and a syndromic neurodevelopmental disorder. Am J Hum Genet 109: 587–600.
    OpenUrlCrossRef
  7. ↵
    Cheng Z, Mugler CF, Keskin A, Hodapp S, Chan LY, Weis K, Mertins P, Regev A, Jovanovic M, Brar GA. 2019. Small and Large Ribosomal Subunit Deficiencies Lead to Distinct Gene Expression Signatures that Reflect Cellular Growth Rate. Mol Cell 73: 36–47 e10.
    OpenUrlCrossRefPubMed
  8. ↵
    Chernyakov I, Whipple JM, Kotelawala L, Grayhack EJ, Phizicky EM. 2008. Degradation of several hypomodified mature tRNA species in Saccharomyces cerevisiae is mediated by Met22 and the 5’-3’ exonucleases Rat1 and Xrn1. Genes Dev 22: 1369–1380.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    de Crecy-Lagard V, Marck C, Grosjean H. 2012. Decoding in Candidatus Riesia pediculicola, close to a minimal tRNA modification set? Trends in cell & molecular biology 7: 11–34.
    OpenUrl
  10. ↵
    De Zoysa T, Phizicky EM. 2020. Hypomodified tRNA in evolutionarily distant yeasts can trigger rapid tRNA decay to activate the general amino acid control response, but with different consequences. PLoS genetics 16: e1008893.
    OpenUrl
  11. ↵
    Dewe JM, Whipple JM, Chernyakov I, Jaramillo LN, Phizicky EM. 2012. The yeast rapid tRNA decay pathway competes with elongation factor 1A for substrate tRNAs and acts on tRNAs lacking one or more of several modifications. RNA 18: 1886–1896.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Dichtl B, Stevens A, Tollervey D. 1997. Lithium toxicity in yeast is due to the inhibition of RNA processing enzymes. Embo Journal 16: 7184–7195.
    OpenUrlAbstract
  13. ↵
    Du X, Rao MR, Chen XQ, Wu W, Mahalingam S, Balasundaram D. 2006. The homologous putative GTPases Grn1p from fission yeast and the human GNL3L are required for growth and play a role in processing of nucleolar pre-rRNA. Mol Biol Cell 17: 460–474.
    OpenUrlAbstract/FREE Full Text
  14. Forsburg SL. 1993. Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res 21: 2955–2956.
    OpenUrlCrossRefPubMedWeb of Science
  15. ↵
    Frendewey DA, Kladianos DM, Moore VG, Kaiser, II. 1982. Loss of tRNA 5-methyluridine methyltransferase and pseudouridine synthetase activities in 5-fluorouracil and 1-(tetrahydro-2-furanyl)-5-fluorouracil (ftorafur)-treated Escherichia coli. Biochimica et biophysica acta 697: 31–40.
    OpenUrlPubMed
  16. ↵
    Giaever G, Chu AM, Ni L, Connelly C, Riles L, Veronneau S, Dow S, Lucau-Danila A, Anderson K, Andre B et al. 2002. Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: 387–391.
    OpenUrlCrossRefPubMedWeb of Science
  17. ↵
    Grosjean H, Westhof E. 2016. An integrated, structure- and energy-based view of the genetic code. Nucleic Acids Res 44: 8020–8040.
    OpenUrlCrossRefPubMed
  18. ↵
    Gustavsson M, Ronne H. 2008. Evidence that tRNA modifying enzymes are important in vivo targets for 5-fluorouracil in yeast. RNA 14: 666–674.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Helm M, Giege R, Florentz C. 1999. A Watson-Crick base-pair-disrupting methyl group (m1A9) is sufficient for cloverleaf folding of human mitochondrial tRNALys. Biochemistry 38: 13338–13346.
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    Hinnebusch AG. 2005. Translational regulation of GCN4 and the general amino acid control of yeast. Annu Rev Microbiol 59: 407–450.
    OpenUrlCrossRefPubMedWeb of Science
  21. ↵
    Huang L, Pookanjanatavip M, Gu X, Santi DV. 1998. A conserved aspartate of tRNA pseudouridine synthase is essential for activity and a probable nucleophilic catalyst. Biochemistry 37: 344–351.
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Jackman JE, Alfonzo JD. 2013. Transfer RNA modifications: nature’s combinatorial chemistry playground. Wiley interdisciplinary reviews RNA 4: 35–48.
    OpenUrl
  23. ↵
    Jackman JE, Montange RK, Malik HS, Phizicky EM. 2003. Identification of the yeast gene encoding the tRNA m1G methyltransferase responsible for modification at position 9. RNA 9: 574–585.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Johansson MJ, Bystrom AS. 2004. The Saccharomyces cerevisiae TAN1 gene is required for N4-acetylcytidine formation in tRNA. RNA 10: 712–719.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Kadaba S, Krueger A, Trice T, Krecic AM, Hinnebusch AG, Anderson J. 2004. Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev 18: 1227–1240.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Kadaba S, Wang X, Anderson JT. 2006. Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA 12: 508–521.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Kim D, Johnson J. 1988. Construction, expression, and function of a new yeast amber suppressor, tRNATrpA. J Biol Chem 263: 7316–7321.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Kim KQ, Zaher HS. 2022. Canary in a coal mine: collided ribosomes as sensors of cellular conditions. Trends in biochemical sciences 47: 82–97.
    OpenUrlCrossRef
  29. ↵
    Kotelawala L, Grayhack EJ, Phizicky EM. 2008. Identification of yeast tRNA Um(44) 2’-O-methyltransferase (Trm44) and demonstration of a Trm44 role in sustaining levels of specific tRNA(Ser) species. RNA 14: 158–169.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Kothe U, Rodnina MV. 2007. Codon reading by tRNAAla with modified uridine in the wobble position. Mol Cell 25: 167–174.
    OpenUrlCrossRefPubMedWeb of Science
  31. ↵
    Nedialkova DD, Leidel SA. 2015. Optimization of Codon Translation Rates via tRNA Modifications Maintains Proteome Integrity. Cell 161: 1606–1618.
    OpenUrlCrossRefPubMed
  32. ↵
    Parfrey LW, Lahr DJ, Knoll AH, Katz LA. 2011. Estimating the timing of early eukaryotic diversification with multigene molecular clocks. Proc Natl Acad Sci U S A 108: 13624–13629.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Petitjean A, Bonneaud N, Lacroute F. 1995. The duplicated Saccharomyces cerevisiae gene SSM1 encodes a eucaryotic homolog of the eubacterial and archaebacterial L1 ribosomal proteins. Mol Cell Biol 15: 5071–5081.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    Phizicky EM, Hopper AK. 2023. The life and times of a tRNA. RNA 29: 898–957.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Preston MA, D’Silva S, Kon Y, Phizicky EM. 2013. tRNAHis 5-methylcytidine levels increase in response to several growth arrest conditions in Saccharomyces cerevisiae. RNA 19: 243–256.
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Ranjan N, Rodnina MV. 2017. Thio-Modification of tRNA at the Wobble Position as Regulator of the Kinetics of Decoding and Translocation on the Ribosome. Journal of the American Chemical Society 139: 5857–5864.
    OpenUrlCrossRefPubMed
  37. ↵
    Rozov A, Demeshkina N, Khusainov I, Westhof E, Yusupov M, Yusupova G. 2016. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code. Nature communications 7: 10457.
    OpenUrl
  38. ↵
    Santi DV, Hardy LW. 1987. Catalytic mechanism and inhibition of tRNA (uracil-5-)methyltransferase: evidence for covalent catalysis. Biochemistry 26: 8599–8606.
    OpenUrlCrossRefPubMedWeb of Science
  39. ↵
    Sas-Chen A, Thomas JM, Matzov D, Taoka M, Nance KD, Nir R, Bryson KM, Shachar R, Liman GLS, Burkhart BW et al. 2020. Dynamic RNA acetylation revealed by quantitative cross-evolutionary mapping. Nature 583: 638–643.
    OpenUrlCrossRef
  40. ↵
    Sharma S, Langhendries JL, Watzinger P, Kotter P, Entian KD, Lafontaine DL. 2015. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1. Nucleic Acids Res 43: 2242–2258.
    OpenUrlCrossRefPubMed
  41. ↵
    Steffen KK, MacKay VL, Kerr EO, Tsuchiya M, Hu D, Fox LA, Dang N, Johnston ED, Oakes JA, Tchao BN et al. 2008. Yeast life span extension by depletion of 60s ribosomal subunits is mediated by Gcn4. Cell 133: 292–302.
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Steffen KK, McCormick MA, Pham KM, MacKay VL, Delaney JR, Murakami CJ, Kaeberlein M, Kennedy BK. 2012. Ribosome deficiency protects against ER stress in Saccharomyces cerevisiae. Genetics 191: 107–118.
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Suzuki T. 2021. The expanding world of tRNA modifications and their disease relevance. Nat Rev Mol Cell Biol 22: 375–392.
    OpenUrl
  44. ↵
    Tasak M, Phizicky EM. 2022. Initiator tRNA lacking 1-methyladenosine is targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species. PLoS genetics 18: e1010215.
    OpenUrl
  45. ↵
    Udagawa T, Nemoto N, Wilkinson CR, Narashimhan J, Jiang L, Watt S, Zook A, Jones N, Wek RC, Bahler J et al. 2008. Int6/eIF3e promotes general translation and Atf1 abundance to modulate Sty1 MAPK-dependent stress response in fission yeast. J Biol Chem 283: 22063–22075.
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Urbonavicius J, Qian O, Durand JMB, Hagervall TG, Bjork GR. 2001. Improvement of reading frame maintenance is a common function for several tRNA modifications. Embo Journal 20: 4863–4873.
    OpenUrlAbstract
  47. ↵
    Wang X, Jia H, Jankowsky E, Anderson JT. 2008. Degradation of hypomodified tRNA(iMet) in vivo involves RNA-dependent ATPase activity of the DExH helicase Mtr4p. RNA 14: 107–116.
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Warner JR. 1999. The economics of ribosome biosynthesis in yeast. Trends in biochemical sciences 24: 437–440.
    OpenUrlCrossRefPubMedWeb of Science
  49. ↵
    Wu CC, Peterson A, Zinshteyn B, Regot S, Green R. 2020. Ribosome Collisions Trigger General Stress Responses to Regulate Cell Fate. Cell 182: 404–416 e414.
    OpenUrlCrossRefPubMed
  50. ↵
    Yan LL, Zaher HS. 2021. Ribosome quality control antagonizes the activation of the integrated stress response on colliding ribosomes. Mol Cell 81: 614–628 e614.
    OpenUrlCrossRef
  51. ↵
    Yun JS, Yoon JH, Choi YJ, Son YJ, Kim S, Tong L, Chang JH. 2018. Molecular mechanism for the inhibition of DXO by adenosine 3’,5’-bisphosphate. Biochemical and biophysical research communications 504: 89–95.
    OpenUrlCrossRef
  52. ↵
    Yusupova G, Yusupov M. 2014. High-resolution structure of the eukaryotic 80S ribosome. Annual review of biochemistry 83: 467–486.
    OpenUrlCrossRefPubMed
Back to top
Posted September 18, 2023.
Download PDF
Email
A connection between the ribosome and two S. pombe tRNA modification mutants subject to rapid tRNA decay
Thareendra De Zoysa, Alayna C. Hauke, Nivedita R. Iyer, Erin Marcus, Sarah M. Ostrowski, Justin C. Fay, Eric M. Phizicky
bioRxiv 2023.09.18.558340; doi: https://doi.org/10.1101/2023.09.18.558340
Reddit logo Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area