New Results

Spoink, a LTR retrotransposon, invaded D. melanogaster populations in the 1990s

Riccardo Pianezza, Almorò Scarpa, Prakash Narayanan, Sarah Signor, Robert Kofler
doi: https://doi.org/10.1101/2023.10.30.564725

Abstract

During the last few centuries D. melanogaster populations were invaded by several transposable elements, the most recent of which was thought to be the P-element between 1950 and 1980. Here we describe a novel TE, which we named Spoink, that has invaded D. melanogaster. It is a 5216nt LTR retrotransposon of the Ty3/gypsy superfamily. Relying on strains sampled at different times during the last century we show that Spoink invaded worldwide D. melanogaster populations after the P-element between 1983 and 1993. This invasion was likely triggered by a horizontal transfer from the D. willistoni group, much as the P-element. Spoink is probably silenced by the piRNA pathway in natural populations and about 1/3 of the examined strains have an insertion into a canonical piRNA cluster such as 42AB. Given the degree of genetic investigation of D. melanogaster it is surprising that Spoink was able to invade unnoticed.

Introduction

Transposable elements (TEs) are short genetic elements that can increase in copy number within the host genome. They are abundant in most organisms and can make up the majority of some genomes, i.e. maize where TEs constitute 83% of the genome [Schnable et al., 2009]. There are two classes of TEs which transpose by different mechanisms - DNA transposons which replicate by directly moving to a new genomic location in a ‘cut and paste’ method, and retrotransposons which replicate through an RNA intermediate in a ‘copy and paste’ method [Kapitonov and Jurka, 2003, Finnegan, 1989, Wicker et al., 2007]. From humans to flies, more genetic variation (in bp) is due to repetitive sequences such as transposable elements than all single nucleotide variants combined [Chakraborty et al., 2021]. Although some TEs, such as R1 and R2 elements, may benefit hosts [Eickbush and Eickbush, 1995, Nelson et al., 2023] most TE insertions are thought to be deleterious [Elena et al., 1998, Pasyukova et al., 2004]. Host genomes have therefore evolved an elaborate system of suppression frequently involving small RNAs [Sarkies et al., 2015]. Suppression of TEs in Drosophila relies upon small RNAs termed piRNAs are cognate to TE sequences [Brennecke et al., 2007, Gunawardane et al., 2007, Brennecke et al., 2008]. These small RNAs bind to PIWI clade proteins and mediate the degradation of TE transcripts and the formation of heterochromatin silencing the TE [Brennecke et al., 2007, Le Thomas et al., 2013, 2014a,b, Yamanaka et al., 2014, Andreev et al., 2022, Rangan et al., 2011]. However, while host defenses quickly adapt to new transposon invasions, TEs can escape silencing through horizontal transfer to new, defenseless, genomes [Peccoud et al., 2017, Scarpa et al., 2023, Kofler et al., 2015, Signor et al., 2023].

This horizontal transfer allows TEs to colonize the genomes of novel species [Zhang et al., 2020, Zanni et al., 2013, Signor et al., 2023, Schaack et al., 2010, Peccoud et al., 2017]. The first well-documented instance of horizontal transfer of a TE was the P-element, which spread from D. willistoni to D. melanogaster [Daniels et al., 1990]. Following this horizontal transfer the P-element invaded natural D. melanogaster populations between 1950 and 1980 [Anxolabéhère et al., 1988, Kidwell, 1983]. It was further realized that the I-element, Hobo and Tirant spread in D. melanogaster populations earlier than the P-element, between 1930 and 1960 [Kidwell, 1983, Periquet et al., 1989, Schwarz et al., 2021]. The genomes from historical D. melanogaster specimens collected about two hundred years ago, recently revealed that Opus, Blood, and 412 spread in D. melanogaster populations between 1850 and 1933 [Scarpa et al., 2023]. In total, it was suggested that seven TEs invaded D. melanogaster populations during the last two hundred years where one invasion (the P-element) was triggered by horizontal transfer from a species of the willistoni group and six invasions by horizontal transfer from the simulans complex [Schwarz et al., 2021, Scarpa et al., 2023, Loreto et al., 2008, Daniels et al., 1990, Simmons, 1992, Blumenstiel, 2019].

It was, however, widely assumed until now that the P-element invasion, which occurred between 1950-1980, was the last and most recent TE invasion in D. melanogaster [Kidwell, 1983, Anxolabéhère et al,. 1985, Bonnivard and Higuet, 1999, Schwarz et al,. 2021, Scarpa et al,. 2023]. Here we report the discovery of Spoink, a novel TE which invaded worldwide D. melanogaster populations between 1983 and 1993, i.e. after the invasion of the P-element. Spoink is a LTR retrotransposon of the Ty3/gypsy group. We suggest that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group, similarly to the P-element invasion in D. melanogaster. In a model species as heavily investigated as D. melanogaster it is surprising that Spoink was able to invade undetected.

Results

Previous work showed that at least seven TE families invaded D. melanogaster populations during the last two hundred years [Scarpa et al., 2023, Schwarz et al., 2021, Kidwell, 1983]. To explore whether additional, hitherto poorly characterised TEs could have invaded D. melanogaster, we investigated long-read assemblies of recently collected D. melanogaster strains [Rech et al., 2022] using a newly assembled repeat library [Chakraborty et al., 2021]. Interestingly we found differences in the abundance of “gypsy 7 DEl” between the reference strain Iso-1 and more recently collected D. melanogaster strains (Supplementary table S1). To better characterize this TE, we generated a consensus sequence based on the novel insertions and checked if this consensus sequence matches any of the repeats described in repeat libraries generated for D. melanogaster and related species [Quesneville et al., 2005, Rech et al., 2022, Chakraborty et al., 2021, Srivastav et al., 2023, Ellison and Cao, 2020]. A fragmented copy of this TE, with just one of the two LTRs being present, was reported by Rech et al. [2022] (0.13% divergence; “con41 UnFmcl001 RLX-incomp”; Supplementary table S2). The next best hits were gypsy7 Del, gypsy2 DSim, micropia and Invader6 (18-30% divergence; Supplementary table S2). Given this high sequence divergence from previously described TE families and the fact that this novel TE belongs to an entirely different superfamily/group than gypsy7 (see below), we decided to give this TE a new name. We call this novel TE ”Spoink” inspired by a Pokémon that needs to continue jumping to stay alive.

Spoink is an LTR retrotransposon with a length of 5216 bp and LTRs of 349 bp (fig. 1A). At positions 4639-4700 Spoink contains a poly-A tract with a few mismatches. Spoink encodes a 695 aa putative gag-pol polyprotein. Ordered from the N-to the C-terminus the conserved domains of the polyprotein are zinc knuckle (likely part of gag ; e-value e = 4.5e − 03), retropepsin (e = 1.3e − 05), reverse transcriptase of LTR (e = 1.8e − 59), RNase HI of Ty3/gypsy elements (e = 2.9e − 38), integrase zinc binding domain (e = 2.9e − 16) and integrase core domain (e = 4.5e − 10). Spoink lacks an env protein. The order of these domains, with the integrase downstream of the reverse transcriptase, is typical for Ty3/gypsy transposons [Eickbush and Malik, 2002].

Figure 1.
Figure 1.

Spoink is a novel TE of the Ty3/gypsy superfamily. A) Overview of the composition of Spoink. Features are shown in color and the alignments show the sequences around the main features of Spoink for two insertions in each of three different long-read assemblies of D. melanogaster. B) Phylogenetic tree based on the reverse-transcriptase domain of pol for Spoink and several other LTR transposons. Multiple families have been picked for each of the main superfamilies/groups of LTR transposons [Kapitonov and Jurka, 2003]. Our data suggest that Spoink is a member of the gypsy/mdg3 group.

A phylogeny based on the reverse transcriptase domain of different TE families suggests that Spoink is a member of the gypsy/mdg3 superfamily/group of LTR retrotransposons (fig. 1B; [Kapitonov and Jurka, 2003]). As expected for members of the Ty3/gypsy superfamily Spoink generates a target site duplication of 4 bp and it has an insertion motif enriched for ATAT (fig. 1A; [Kapitonov and Jurka, 2003, Linheiro and Bergman, 2012]). However, Spoink differs from what is expected for the Ty3/gypsy superfamily in several ways. First, the encoded gag-pol polyprotein is atypical for Ty3/gypsy transposons [Eickbush and Malik, 2002]. Second, the predicted primer binding site of Spoink directly follows the LTR, whereas typically for Ty3/gypsy there is a shift of 5-8nt (fig. 1A; [Kapitonov and Jurka, 2003]). Third, the LTR motif is TG…TA which is different from the TG…CA motif usually reported for gypsy TEs [Kapitonov and Jurka, 2003].

Finally we investigated the genomic distribution of Spoink insertions in long-read assemblies of D. melanogaster strains collected ≥ 2003 [Rech et al., 2022]. In total, these assemblies contains 481 full-length (> 80% length with at least one LTR) insertions of Spoink (on the average 16 per genome). Unlike the P-element which has a strong insertion bias into promoters, Spoink insertions are mostly found in introns and intergenic regions (Supplementary fig. S1). 54% of the Spoink insertions are in 201 different genes. Interestingly we found 7 independent Spoink insertions in Myo83F.

To summarize we characterized a novel LTR-retrotransposon of the Ty3/gypsy superfamily in the genome of D. melanogaster that we call Spoink.

Spoink recently invaded worldwide D. melanogaster populations

To substantiate our hypothesis that Spoink recently invaded D. melanogaster we used three independent approaches: Illumina short read data, long-read assemblies, and PCR/Sanger sequencing. First we aligned short reads from a strain collected in 1958 (Hikone-R) and a strain collected in 2015 (Ten-15) [Rech et al., 2022, Schwarz et al., 2021] to the consensus sequence of Spoink using DeviaTE [Weilguny and Kofler, 2019]. DeviaTE estimates the abundance of Spoink insertions by normalizing the coverage of Spoink to the coverage of single-copy genes. Furthermore, DeviaTE is useful for generating an intuitive visualization of the abundance and composition (i.e. SNPs, indels, truncations) of Spoink in samples. We found that only a few degraded reads aligned to Spoink in the 1950’s strain (Hikone-R) whereas many reads covered the sequence of Spoink in the more recently collected strain Ten-15 (fig. 2A). There were also very few SNPs or indels in the recently collected strain suggesting that most insertions have a very similar sequence (fig. 2A). This observation holds true when multiple old and young D. melanogaster strains are analysed (Supplementary fig. S1).

Figure 2.
Figure 2.

Spoink invaded D. melanogaster. A) DeviaTE plots of Spoink for a strain collected in 1954 (Hikone-R) and a strain collected in 2015 (Ten-15). Short reads were aligned to the consensus sequence of Spoink and the coverage was normalized to the coverage of single-copy genes. The coverage based on uniquely mapped reads is shown in dark grey and light grey is used for ambiguously mapped reads. Single-nucleotide polymorphisms (SNPs) and small internal deletions (indels) are shown as colored lines. The coverage was manually curbed at the poly-A track (between dashed lines). B) Insertions with a similarity to the consensus sequence of Spoink in the long-read assemblies of Oregon-R (collected around 1925) and the more recently collected strain RAL737 (2003). C) PCR results for two Spoink primer pairs (for location of primers see sketch at bottom) and one primer pair for the gene vasa. Spoink is absent in old strains (Lausanne-S, Hikone-R and iso-1) and present in more recently collected strains (RAL59, RAL176, RAL737). D) Population frequency of Spoink insertions in long-read assemblies of strains collected in 2003 from Raleigh [Rech et al., 2022]. Note that highly diverged insertions are largely segregating at a high frequency while canonical Spoink insertions mostly segregate at a low frequency.

Next we investigated the abundance of Spoink in long-read assemblies of a strain collected in 1925 (Oregon-R) and a strain collected in 2003 (RAL737). We found solely highly diverged and fragmented copies of sequences with similarity to Spoink in Oregon-R (fig. 2B). These degraded fragments were mostly found near the centromeres of Oregon-R. Investigating the identity of these degraded fragments of Spoink in more detail we found that they largely match with short and highly diverged fragments of Invader6, micropia and the Max-element (Supplementary table S3). In addition to these degraded fragments, the more recently collected strain RAL737 also carries a large number of full-length insertions with a high similarity to the consensus sequence of Spoink (henceforth canonical Spoink insertions; fig. 2B). The canonical Spoink insertions are distributed all over the chromosomes of RAL737 (fig. 2B). This observation is again consistent when several long-read assemblies of old and young D. melanogaster strains are analysed (Supplementary fig. S2).

Finally we used PCR to test whether Spoink recently spread in D. melanogaster. We designed two PCR primer pairs for Spoink and, as a control, one primer pair for vasa (fig. 2C; bottom panel). The Spoink primers amplified a clear band in three strains collected 2003 in Raleigh but no band was found in earlier collected strains, including the reference strain of D. melanogaster, Iso-1 (fig. 2C). We sequenced the fragments amplified by the Spoink primers using Sanger sequencing and found that the sequence of the six amplicons matches with the consensus sequence of Spoink (Supplementary fig. S3).

Finally we investigated the population frequency of canonical and degraded Spoink insertions. Using the long-read assemblies of eight strains collected in 2003 in Raleigh we computed the population frequency of different Spoink insertions. We found that canonical Spoink insertions (< 5% divergence) are largely segregating at a low population frequency, as expected for recently active TEs (fig. 2D). While several degraded fragments that were annotated as Spoink are private, there were many at a higher population frequency as expected for older sequences (fig. 2D).

In summary our data suggest that Spoink recently spread in D. melanogaster and that degraded fragments with some similarity to Spoink are present in all investigated D. melanogaster strains. These degraded fragments may be the remnants of more ancient invasions of TEs sharing some sequence similarity with Spoink.

Timing the Spoink invasion

Next we sought to provide a more accurate estimate of the time when Spoink spread in D. melanogaster. First we generated a rough timeline of the Spoink invasion using D. melanogaster strains sampled during the last two hundred years. We estimated the abundance of Spoink in these strains using DeviaTE [Weilguny and Kofler, 2019]. As reference we also estimated the abundance of the P-element, which is widely assumed as to be the most recent TE that invaded D. melanogaster populations [Schwarz et al., 2021, Anxolabéhère et al., 1988]. Spoink was absent from all strains collected ≥ 1983 but present in strains collected ≥ 1993 (fig. 3A). By contrast our data suggest that the P-element was absent in the strains collected ≥ 1962 but present in strains collected ≥ 1967 (fig. 3A). This is consistent with previous works suggesting that the P-element invaded D. melanogaster between 1950 and 1980 [Kidwell, 1983, Anxolabéhère et al., 1985, Bonnivard and Higuet, 1999, Scarpa et al., 2023]. Our data thus suggest that Spoink invaded D. melanogaster after the P-element invasion. To investigate the timing of the invasion in more detail we estimated the abundance of Spoink in short-read data of 183 strains collected between 1960 and 2015 from different geographic regions using DeviaTE (Supplementary table S4; data from [Grenier et al., 2015, Schwarz et al., 2021, Long et al., 2013, Lange et al., 2021, Rech et al,. 2022]). The analysis of these 183 strains supports the view that Spoink was largely absent in strains collected ≥ 1983 but present in strains collected ≥ 1993 (fig. 3B). However there are two outliers. Spoink is present in one strain collected in 1979 in Providence (USA), which could be due to a contamination of the strain. On the other hand Spoink is absent in one strain collected ≥ 1993 in Zimbabwe (fig. 3B). As Spoink was present in six other strains collected in 1993 from Zimbabwe, it is feasible that Spoink was still spreading in populations from Zimbabwe around 1993. The strains supporting the absence of Spoink prior to 1983 were collected from Europe, America, Asia and Africa while the strains supporting the presence of Spoink after 1993 were collected from all five continents (Supplementary table S4).

Figure 3.
Figure 3.

Spoink invaded D. melanogaster between 1983 and 1993 after the invasion of the P-element. A) Rough timeline of the Spoink and P-element invasion based on different strains sampled during the last two hundred years. B) Timeline of the Spoink and P-element invasion based on 183 strains sampled between 1960 and 2015 C) Abundance of canonical Spoink insertions (> 80% length and < 5% divergence) in long-read assemblies of D. melanogaster strains collected between 1925 and 2018.

Finally we estimated the abundance of Spoink in 49 long-read assemblies of strains collected during the last 100 years (Supplementary table S5; [Chakraborty et al., 2019, Wierzbicki et al., 2021, Hoskins et al., 2015, Rech et al., 2022]). We used RepeatMasker [Smit et al., 1996-2010] to estimate the abundance of canonical Spoink insertions (> 80% length and < 5% divergence) in these strains. Canonical Spoink insertions were absent in strains collected before 1975 but present in all long-read assemblies of strains collected after 2003 (fig. 3C). The strains of the assemblies supporting the absence of canonical Spoink insertions were collected from America, Europe, Asia, and Africa whereas the strains showing the presence of Spoink were largely collected from Europe, though genomes from North America and Africa are also represented (Supplementary table S5).

In summary we conclude that Spoink invaded worldwide populations of D. melanogaster approximately between 1983 and 1993. Moreover, the Spoink invasion is more recent than the P-element invasion.

Geographic heterogeneity in the Spoink composition

Previous work showed that the composition of TEs within a species may differ among geographic regions [Schwarz et al., 2021, Scarpa et al., 2023]. Such geographic heterogeneity could result from founder effects occurring during the geographic spread of a TE. For example, a TE spreading in a species with a cosmopolitan distribution such as D. melanogaster may need to overcome geographic obstacles such as oceans and deserts. The few individuals that overcome these obstacles, thereby spreading the TE into hitherto naive populations, may carry slightly different variants of the TE than the source populations. These distinct variants will than spread in the new population. Such founder effects during the invasion may lead to a geographically heterogeneous composition of a TE within a species. For example, for the retrotransposon Tirant, individuals sampled from Tasmania carry distinct variants, while for Blood and Opus individuals from Zimbabwe are distinct from the other populations. To investigate whether we find such geographic heterogeneity we analysed the Spoink composition in the Global Diversity Lines (GDL), which comprise 85 D. melanogaster strains sampled after 1988 from five different continents (Africa - Zimbabwe, Asia - Beijing, Australia - Tasmania, Europe - Netherlands, America - Ithaca; [Grenier et al., 2015]). Except for a single strain from Zimbabwe all GDL strains harbour Spoink insertions (supplementary fig. S4). We estimated the allele frequency of SNPs in Spoink, where a SNP refers to a variant among dispersed copies of Spoink. The allele frequency estimate thus reflects the composition of Spoink within a particular strain. To summarize differences in the composition among the GDL strains we used UMAP [Diaz-Papkovich et al., 2021]. We found that the composition of Spoink varies among regions where three distinct groups can be distinguished: Tasmania, Bejing/Ithaca and Netherlands/Zimbabwe (supplementary fig. S4). It is interesting that clusters are formed by geographically distant populations such as Bejing (Asia) and Ithaca (America). We speculate that human activity, where flies might for example hitchhike with merchandise, could be responsible for this pattern. In summary, we found a geographically heterogeneous composition of Spoink which is likely due to founder effects occurring during the spread of this TE.

Spoink is silenced by the piRNA pathway in natural populations

The host defence against TEs in Drosophila is based on small RNAs termed piRNAs. These piRNAs bind to PIWI clade proteins and silence a TE at the transcriptional as well as the post-transcriptional level [Brennecke et al., 2007, Gunawardane et al., 2007, Sienski et al., 2012, Le Thomas et al., 2013]. To test whether Spoink is silenced in D. melanogaster populations we investigated small RNA data from the GDL lines [Luo et al., 2020]. Small RNA were sequenced for 10 out of the 84 GDL lines such that two strains were picked from each of the five continents [Luo et al., 2020].

We find piRNAs mapping along the sequence of Spoink in the GDL strain I17 which was collected in 2004 but not in the strain Lausanne-S which was sampled around 1938 (fig. 4A; [Lindsley and Grell, 1968]). piRNAs mapping to Spoink we further found for all 10 GDL strains (Supplementary fig. S5).

Figure 4.
Figure 4.

A piRNA based defence against Spoink emerged in D. melanogaster A) piRNAs mapping to Spoink in a strain sampled 1938 (Lausanne-S) and 2004 (I17). The transposon Beagle is included as reference. Solely the 5’ positions of piRNAs are shown and the piRNA abundance is normalized to one million piRNAs. Sense piRNAs are shown on the positive y-axis and antisense piRNAs on the negative y-axis. B) Ping-pong signature for the piRNAs mapping to Spoink and Beagle in the D. melanogaster strain I17 (2004).

An important feature of germline piRNA activity in D. melanogaster is the ping-pong cycle [Brennecke et al., 2007, Gunawardane et al., 2007]. An active ping-pong cycle generates a characteristic overlap between the 5’ positions of sense and antisense piRNAs, i.e. the ping-pong signature. Computing a ping-pong signature thus requires several overlapping sense and antisense piRNAs. Since the amount of piRNAs was too low we could not compute a ping-pong signature for the strain Lausanne-S (collected in 1938; see above). However we found a pronounced ping-pong signature in all 10 GDL samples (fig. 4B; Supplementary fig. S5).

It is an important open question as to which events trigger the emergence of piRNA based host defence. The prevailing view, the trap model, holds that the piRNA based host defence is initiated by a copy of the TE jumping into a piRNA cluster [Bergman et al., 2006, Malone and Hannon, 2009, Zanni et al., 2013, Goriaux et al., 2014, Yamanaka et al., 2014]. If this is true we expect Spoink insertions in piRNA clusters in each of the long-read assemblies of the recently collected D. melanogaster strains [Rech et al., 2022]. We identified the position of piRNA clusters in these long-read assemblies based on unique sequences flanking the piRNA clusters [Wierzbicki et al., 2021]. Interestingly we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters, where some strains (e.g. RAL176) have up to 14 cluster insertions whereas 18 out of 31 strains did not have a single cluster insertion. Three of the cluster insertions were into 42AB, which usually generates the most piRNAs [Brennecke et al., 2007, Srivastav et al., 2023]. It is an important open question whether such a heterogeneous distribution of Spoink insertions in piRNA clusters is compatible with the trap model [Kofler, 2019, Wierzbicki and Kofler, 2023]. In summary we found that Spoink is silenced by the piRNA pathway but the number of Spoink insertions in piRNA cluster is very heterogeneous among strains.

Origin of Spoink

The invasion of Spoink in D. melanogaster was likely triggered by horizontal transfer from a different species. To identify the source of the horizontal transfer we investigated the long-read assemblies of 101 Drosophila species [Kim et al., 2021] and 99 insect species [Kim et al., 2021, Hotaling et al., 2021] (Supplementary table S7). Apart from D. melanogaster we found insertions with a high similarity to Spoink in D. sechellia, and species of the willistoni group, in particular D. willistoni (fig. 5A). Spoink insertions with a somewhat smaller similarity were found in D. cardini and D. repleta. No sequences similar to Spoink were found in the 99 insect species (supplementary fig. S6). To further shed light on the origin of the Spoink invasion we constructed a phylogenetic tree with full-length insertions of Spoink in D. melanogaster, D. sechellia, D. cardini and species of the willistoni group (fig. 5B). We did not find a full-length insertion of Spoink in D. repleta. This tree reveals that Spoink insertions in D. sechellia have very short branches, thus we suggest that the invasion in D. sechellia is also of recent origin.

Figure 5.
Figure 5.

The Spoink invasion in D. melanogaster was likely triggered by a horizontal transfer from a species of the willistoni group. A) Similarity of TE insertions in long-read assemblies of diverse drosophilid species to Spoink. The barplots show for each species the similarity between Spoink and the best match in the assembly. For example, a value of 0.9 indicates that at least one insertion in an assembly has a high similarity (≈ 90%) to the consensus sequence of Spoink. B) Bayesian tree of Spoink insertions in the different drosophilid species. Only full-length insertions of Spoink (> 80% of the length) were considered. Note that Spoink insertions of D. sechellia are nested in insertions of D. melanogaster, while Spoink insertions of D. melanogaster are nested in insertions from the willistoni group (green shades).

However, Spoink insertions in D. melanogaster are nested within insertions from species of the willistoni group (fig. 5B). Our data thus suggest that, similar to the P-element invasion in D. melanogaster [Daniels et al., 1990], the Spoink invasion in D. melanogaster was also triggered by horizontal transfer from a species of the willistoni group. Species of the willistoni group are Neotropical, occurring throughout Central and South America [Burla et al., 1949, Spassky et al., 1971, Zanini et al., 2015]. Therefore horizontal transfer of Spoink only became feasible after D. melanogaster extended its habitat into the Americas approximately 200 years ago [A.H.Sturtevant, 1921, Johnson, 1913, Bock and Parsons, 1981]. Insertions of D. cardini are also nested within species of the willistoni group, suggesting that D. cardini also acquired Spoink by horizontal transfer from the willistoni group, likely independent of D. melanogaster (fig. 5B). D. cardini is also a Neotropical species and its range overlaps many species of the willistoni group, thus horizontal transfer between the species is physically feasible [Heed and Russell, 1971, Brisson et al., 2006].

In summary, similarly to the P-element, horizontal transfer from a species of the willistoni group likely triggered the Spoink invasion in D. melanogaster.

Discussion

Here we showed that the LTR-retrotransposon Spoink invaded D. melanogaster populations between 1983 and 1993, after the spread of the P-element. Similarly to the P-element, the Spoink invasion was likely triggered by horizontal transfer from a species in the willistoni group.

The abundance of sequencing data from strains collected at different time points during the last century allowed us to pinpoint the timing of the invasion in a way that would not have been previously possible. Spoink appears to have rapidly spread throughout global populations of D. melanogaster between 1983 and 1993. The narrow time-window of 10 years is plausible as studies monitoring P-element invasions in experimental populations showed that the P-element can invade populations within 20-60 generations [Kofler et al., 2018, 2022, Selvaraju et al., 2022]. Assuming that natural D. melanogaster populations have about 15 generation per year [Pool, 2015], a TE could penetrate a natural D. melanogaster population within 1 - 3 years. Given this potential rapidness of TE invasions it is likely that Spoink spread quickly between 1983 and 1993. Since there is a gap between strains sampled at 1983 and 1993 we cannot further narrow down the timing of the invasion. Furthermore, the strains used for timing the invasions were sampled from diverse geographic regions and Spoink likely spread at different times in different geographic regions. If horizontal transfer from a willistoni species triggered the invasion, as suggested by our data, than Spoink will have first spread in D. melanogaster populations from South America (the habitat of willistoni species), followed by populations from North America and the other continents. Unfortunately we cannot infer the timing of the geographic spread of the Spoink invasion in different continents as D. melanogaster strains were not sampled sufficiently densely from different regions. Our work thus highlights the importance of efforts such as DrosEU, GDL and DrosRTEC to densely sample Drosophila strains in time and space [Kapun et al., 2020, Grenier et al., 2015, Machado et al., 2021]. It is also interesting to ask as to which extend human activity (e.g. trafficking of goods) contributed to the rapid spread of Spoink. Given that our analysis of the Spoink composition shows that geographically distant populations (Bejing/Ithaca or Netherlands/Zimbabwe) cluster together, human activity may have played a role. Increasing human activity could also explain why Spoink (invasion 1983-1993) seems to have spread faster than the P-element (1950-1980).

Our investigation of Spoink insertions in different drosophilid species suggests that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group. Although it is possible that we did not analyse the true donor species, we consider it unlikely to be a species outside of the willistoni group given the wide distribution of Spoink in all species in the willistoni group. In addition, the phylogenetic tree of Spoink has deep branches within the willistoni group, suggesting that Spoink is ancestral in this group. A related open question is when Spoink first entered D. melanogaster populations. Since a TE may initially solely spread in some isolated subpopulations there could be a considerable lag time between the horizontal transfer of a TE and its spread in worldwide population. Nevertheless, the horizontal transfer of Spoink must have happened between the spread of D. melanogaster into the habitat of the willistoni group, about 200 years ago, and the invasion of Spoink in worldwide populations between 1983 and 1993. In addition to the P-element, Spoink is the second TE that invaded D. melanogaster populations following horizontal transfer from a species of the willistoni group. Species from the willistoni group are very distantly related with D. melanogaster (about 100my [Obbard et al., 2012]) and we were thus wondering whether it is a coincidence that a species of the willistoni group is again acting as donor of a TE invasion in D. melanogaster. The recent habitat expansion of D. melanogaster into the Americas resulted in novel contacts with many species, in addition to species of the willistoni group, that might have acted as donors of novel TEs such as D. pseudoobscura or D. persimilis. Apart from mere chance, there are several feasible possibilities for this observation. First, it is feasible TEs of the willistoni group are exceptionally compatible with D. melanogaster at a molecular level. Second, some parasites targeting both D. melanogaster and species of the willistoni group could be efficient vectors for horizontal transfer of TEs. Third, the physical contact between D. melanogaster and some species of the willistoni group might be unusually tight, facilitating horizontal transfer of TEs by an unknown vector. Fourth, species of the willistoni group might be excepionally numerous resulting in elevated probability for horizontal transfer of a TE.

The Spoink invasion is the eighth identified TE invasion in D. melanogaster during the last two hundred years. As we argued previously, such a high rate of TE invasions is likely unusual during the evolution of the D. melanogaster lineage since the number of TE families in D. melanogaster is much smaller than what would be expected if this rate of invasions would persist [Scarpa et al., 2023]. One possible explanation for this high rate of TE invasions during the last two hundred years is that human activity contributed to the habitat expansion of D. melanogaster. Due to this habitat expansion D. melanogaster spread into the habitat of D. willistoni which enabled the horizontal transfer of Spoink. This raises the possibility that other species with recent habitat expansions also experienced unusually high rates of TE invasions. It is also interesting to ask whether the rate of TE invasions differs among species. For example cosmopolitan species, such as D. melanogaster, may generally experience higher rates of horizontal transfer than more locally confined species. The cosmopolitan distribution will bring species into contact with many diverse species, thereby increasing the opportunities for horizontal transfer of a TE.

The Spoink invasions also opens up several novel opportunities for research. First, the broad availability of strains with and without Spoink will enable testing whether Spoink activity induces phenotypic effects, similarly to hybrid dysgenesis described for the P-element, I-element and hobo, but not for Tirant [Bucheton et al., 1976, Kidwell et al., 1977, Blackman et al., 1987, Schwarz et al., 2021]. Second, it will be interesting to investigate whether some Spoink insertions participated in rapid adaptation of D. melanogaster populations, similar to a P-element insertion which contribute to insecticide resistance [Schmidt et al., 2010]. Third, it will enable studying Spoink invasions in experimental populations, shedding light on the dynamics of TE invasions, much as other recent studies investigating the invasion dynamics of the P-element [Kofler et al., 2018, 2022, Wang et al., 2023]. Fourth, investigation into the distribution of species that have been infected with Spoink will shed light on the networks of horizontal transfer in drosophild species. Fifth, the Spoink invasion provides an opportunity to study the establishment of the piRNA based host defence [similar to [Zhang et al., 2020, Selvaraju et al., 2022]]. For example we found that none of the piRNA cluster insertions are shared between individuals, suggesting there is no or solely weak selection for piRNA cluster insertions. Furthermore we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters where we could not find a single cluster insertions of Spoink in several strains. It is an important open question whether such a heterogeneous distribution is compatible with the trap model [Wierzbicki and Kofler, 2023]. One possibility is that a few cluster insertions in populations are sufficient to trigger the paramutation of regular Spoink insertions into piRNA producing loci [Scarpa and Kofler, 2023, Le Thomas et al., 2014b, Hermant et al., 2015]. These paramutated Spoink insertions may than compensate for the low number of Spoink insertions in piRNA-clusters [Scarpa and Kofler, 2023]. Paramutations could thus explain why several studies found that stand-alone insertions of TEs can nucleate their own piRNA production [Shpiz et al., 2014, Mohn et al., 2014, Wierzbicki and Kofler, 2023, Srivastav et al., 2023].

The war between transposons and their hosts is constantly raging, with potentially large fitness effects for the individuals in populations. Over the last two hundred years there have been at least eight invasions of TEs into D. melanogaster, each of which could disrupt fertility for example by inducing some form of hybrid dysgenesis. TEs are responsible for > 80% of visible spontaneous mutations in D. melanogaster, and produce more variation than all SNPs combined [Ashburner and Bergman, 2005, Green, 1988, Sankaranarayanan, 1988]. In the long read assemblies considered here, more than half of insertions of Spoink were into genes [Rech et al., 2022]. The recent Spoink invasion could thus have a significant impact on the evolution of D. melanogaster lineage.

Materials and Methods

Discovery of the recent Spoink invasion

We identified TE insertions in different long-read assemblies using RepeatMasker [Smit et al., 1996-2010] and the TE library from Chakraborty et al. [2021]. When comparing the TE composition between strains collected in the 1950’s and 1960’s [King et al., 2012, Chakraborty et al., 2019] and more recently collected strains (≥ 2003 [Rech et al., 2022] we noticed an element labeled ‘gypsy-7 DEl’ which was only present in short degraded copies in the older genomes but was present in full length copies in the more recent genomes (Supplementary table S1).

Characterisation of Spoink

To generate a consensus sequence of Spoink we extracted the sequence of full-length matches of ‘gypsy-7 DEl’ plus some flanking sequences from long-read assemblies [Ten-15, RAL91, RAL176, RAL732, RAL737, Sto-22; [Rech et al., 2022]] and made a consensus sequence by performing multiple sequence alignment (MSA) with MUSCLE (v3.8.1551) [Edgar, 2004] and then choosing the most abundant nucleotide in each position of the MSA with a custom Python script (MSA2consensus).

The consensus sequence of the LTR was used to identify the TSD with our new tool LTRtoTE (https://github.com/Almo96/LTRtoTE). We used LTRdigest to identify the PBS of Spoink [Steinbiss et al., 2009]. We picked several sequences from each of the known LTR superfamily/groups using the consensus sequences of known TEs [Kapitonov and Jurka, 2003, Quesneville et al., 2005]. We performed a blastx search against the NCBI database to identify the RT domain in the consensus sequences of the TE [Wheeler et al., 2007]. We then performed a multiple sequence alignment of the amino-acid sequences of the RT domain using MUSCLE (v3.8.1551)[Edgar, 2004]. We obtained the xml file using BEAUti2[Bouckaert et al., 2019] (v2.7.5) and generated the trees with BEAST (v2.7.5)[Bouckaert et al., 2019]. The maximum credibility tree was built using TreeAnnotator (v2.7.5)[Bouckaert et al., 2019] and visualized with FigTree (v1.4.4, http://tree.bio.ed.ac.uk/software/figtree/).

Distribution of Spoink insertions

Genes were annotated in each of the 31 genomes from [Rech et al., 2022] using the annotation of the reference genome of D. melanogaster (6.49; Flybase) and liftoff 1.6.3 [Shumate and Salzberg, 2021, Gramates et al., 2022]. The 1kb regions upstream of each gene were classified as putative promotors. The location of canonical D. melanogaster piRNA clusters was determined using CUSCO, which lifts over the flanks of known clusters in a reference genome to locate the homologous region in a novel genome [Wierzbicki et al., 2021]. The location of Spoink insertions within genes or clusters was determined with bedtools intersect [Quinlan and Hall, 2010]. To determine if genic insertions were shared or independent, the sequence of the insertion was extracted from each genome along with an extra 1 kb of flanking sequence on each end. Insertions purportedly in the same gene were then aligned, and if the flanks aligned they were considered shared insertions. To determine if cluster insertions were shared the flanking TE regions were aligned using Manna, which aligns TE annotations rather than sequences, to determine if there was any shared synteny in the surrounding TEs [Wierzbicki et al., 2023].

Abundance of Spoink insertions in different D. melanogaster strains

We investigated the abundance of Spoink in multiple publicly available short-read data sets [Grenier et al., 2015, Schwarz et al., 2021, Long et al., 2013, Lange et al., 2021, Rech et al., 2022]. These data include genomic DNA from 183 D. melanogaster strains sampled at different geographic locations during the last centuries. For an overview of all analysed short-read data see Supplementary table S4. We mapped the short reads to a database consisting of the consensus sequences of TEs [Quesneville et al., 2005], the sequence of Spoink and three single copy genes (rhino, trafficjam, rpl32) with bwa bwasw (version 0.7.17-r1188) [Li and Durbin, 2009]. We used DeviaTE (v0.3.8)[Weilguny and Kofler, 2019] to estimate the abundance of Spoink. DeviaTE estimates the copy number of a TE (e.g. Spoink) by normalizing the coverage of the TE by the coverage of the single copy genes. We also used DeviaTE to visualize the abundance and diversity of Spoink as well as to compute the frequency of SNPs in Spoink (see below).

To identify Spoink insertions in 49 long-read assemblies of D. melanogaster strains collected during the last 100 years we used RepeatMasker [Smit et al., 1996-2010] (open-4.0.7; -no-is -s -nolow). For an overview of all analysed assemblies see Supplementary table S5[Chakraborty et al., 2019, Wierzbicki et al., 2021, Hoskins et al., 2015, Rech et al., 2022]. For estimating the abundance of Spoink in the long-read assemblies we solely considered canonical Spoink insertions (> 80% of length, < 5% sequence divergence).

Population frequency of Spoink insertions

For every putative Spoink insertion (including degraded ones) in the eight long-read assemblies of individuals from Raleigh [Rech et al., 2022], we extracted the sequence of the insertion plus 1 kb of flanking sequence with bedtools [Quinlan and Hall, 2010]. The sequence of the Spoink insertion was removed with seqkit [Shen et al., 2016] and the flanking sequences were mapped to the AKA017 genome (i.e. the common coordinate system) with minimap2 allowing for spliced mappings [Li, 2018, Shen et al., 2016, Rech et al., 2022]. The mapping location of each read was extracted and if they overlapped between strains they were considered putative shared sites. Regions with overlapping reads were visually inspected in IGV (v2.4.14) and if the mapping location was shared they were considered shared insertions sites [Robinson et al., 2010, Thorvaldsdóttir et al., 2012].

PCR

To validate whether Spoink is absent in old D. melanogaster strains but present in recent strains we used PCR. We designed two primers pairs for Spoink and one for vasa as a control. We extracted DNA from different strains of D. melanogaster (Lausanne-S, Hikone-R,iso-1,RAL59, RAL176, RAL737) using a high salt extraction protocol [Miller et al., 1988]. We designed two primers pairs for Spoink (P1,P2) and one for the gene Vasa (P1 FWD TCAGAAGTGGGATCGGGCTCGG, P1 REV CAGTAGAGCACCATGCCGACGC, P2 FWD ATGGACCGTAATGGCAGCAGCG, P2 REV ACACTCCGCGCCAGAGTCAAAC, Vasa FWD AACGAGGCGAGGAAGTTTGC, Vasa REV GCGATCACTACATGGCAGCC) We used the following PCR conditions: 1 cycle of 95°C for 3 minutes; 33 cycles of 95°C for 30 seconds, 58°C for 30 seconds and 72°C for 20 seconds; 1 cycle of 72°C for 6 minutes.

Small RNAs

To identify piRNAs complementary to Spoink we analysed the small-RNA data from 10 GDL strains [Luo et al., 2020]. The adaptor sequence GAATTCTCGGGTGCCAAGG was removed using cutadapt (v4.4 [Martin, 2011]). We filtered for reads having a length between 18 and 36nt and aligned the reads to a database consisting of D. melanogaster miRNAs, mRNAs, rRNAs, snRNAs, snoRNAs, tRNAs [Thurmond et al., 2019], and TE sequences [Quesneville et al., 2005] with novoalign (v3.09.04). We used previously developed Python scripts [Selvaraju et al., 2022] to compute ping-pong signatures and to visualize the piRNA abundance along the sequence of Spoink.

UMAP

We used the frequencies of SNPs in the sequence of Spoink to compute the UMAP. This frequencies reflect the Spoink composition in a given sample. For example if a specimen has 20 Spoink insertions and a biallelic SNP with a frequency of 0.8 at a given site in Spoink than about 16 Spoink insertions will have the SNP and 4 will not have it. The frequency of the Spoink SNPs was estimated with DeviaTE [Weilguny and Kofler, 2019]. Solely bi-allelic SNPs were used and SNPs only found in few samples were removed (≤ 3 samples) UMAPs were created in R (umap package; v0.2.10.0 [McInnes et al., 2018]).

Origin of horizontal transfer

To identify the origin of the horizontal transfer of Spoink we used RepeatMasker [Smit et al., 1996-2010] (open-4.0.7; -no-is -s -nolow) to identify sequences with similarity to Spoink in the long-read assemblies of 101 drosophilid species and in 99 different insect species [Kim et al., 2021, Hotaling et al., 2021] (Supplementary table S7). We included the long-read assembly of the D. melanogaster strain RAL737 in the analysis [Rech et al., 2022]. We used a Python script to identify in each assembly the best hit with Spoink (i.e. the highest alignment score) and than estimated the similarity between this best hit and Spoink. The similarity was computed as s = rmsbest/rmsmax, where rmsbest is the highest RepeatMasker score (rms) in a given assembly and rmsmax the highest score in any of the analysed assemblies. A s = 0 indicates no similarity to the consensus sequence of Spoink whereas s = 1 represent the highest possible similarity. To generate a phylogenetic tree we identified Spoink insertions in the assemblies of the 101 drosophilid species and RAL737 using RepeatMasker. We extracted the sequences of full-length insertions (> 80% of the length) from species having at least one full-length insertion using bedtools [Quinlan and Hall, 2010](v2.30.0). A multiple sequence alignment of the Spoink insertions was generated with MUSCLE (v3.8.1551)[Edgar, 2004] and a tree was generated with BEAST (v2.7.5)[Bouckaert et al., 2019].

Author contributions

SS discovered Spoink. RK and SS conceived the study. RP, AS, SS and RK analysed the data and generated the figures. AS performed PCR. RK and SS wrote the first draft. RP and AS contributed to writing. PN assisted with data collection.

Funding

This work was supported by the National Science Foundation Established Program to Stimulate Competitive Research grants NSF-EPSCoR-1826834 and NSF-EPSCoR-2032756 to SS, and by the Austrian Science Fund (FWF) grants P35093 and P34965 to RK.

Conflicts of Interest

The author(s) declare(s) that there is no conflict of interest regarding the publication of this article.

Data Availability

The consensus sequence of Spoink as well as the sequences of the six PCR amplicons are available at https://github.com/rpianezza/Dmel-Spoink/tree/main/releasedseqs. The tool LTRtoTE is available on GitHub (https://github.com/Almo96/LTRtoTE). The analysis performed in this work have been documented with RMarkdown and have been made publicly available, together with the resulting figures, at GitHub (https://github.com/rpianezza/Dmel-Spoink; see *.md files).

Acknowledgments

We thank Matthew Beaumont for the idea to call the here described transposon Spoink. We thank Neda Barghi and Claudia Ramirez Lanzas for providing fly strains used for PCR. SS would like to thank J. B. Signor for helpful comments on the manuscript. RK, RP, and AS thank all members of the Institute of Population Genetics for feedback and support.

Footnotes

References

  1. ↵
    A.H. Sturtevant. The North American species of Drosophila. Nature, 107:1476–4687, 1921.
    OpenUrl
  2. ↵
    V. Andreev, C. Yu, and e. a. Wang, J. Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery. Nat Struct Mol Biol, 29:130–142, 2022.
    OpenUrlCrossRef
  3. ↵
    D. Anxolabéhère, D. Nouaud, G. Périquet, and P. Tchen. P-element distribution in Eurasian populations of Drosophila melanogaster : a genetic and molecular analysis. Proceedings of the National Academy of Sciences, 82(16):5418–5422, 1985.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    D. Anxolabéhère, M. G. Kidwell, and G. Periquet. Molecular characteristics of diverse populations are consistent with the hypothesis of a recent invasion of Drosophila melanogaster by mobile P elements. Molecular Biology and Evolution, 5(3):252–269, 1988.
    OpenUrlCrossRefPubMedWeb of Science
  5. ↵
    M. Ashburner and C. M. Bergman. Drosophila melanogaster : A case study of a model genomic sequence and its consequences. Cold Spring Harbor perspectives in biology, 15:1661–1667, 2005. doi: 10.1101/gr.3726705.15.
    OpenUrlCrossRef
  6. ↵
    C. M. Bergman, H. Quesneville, D. Anxolabéhère, and M. Ashburner. Recurrent insertion and duplication generate networks of transposable element sequences in the Drosophila melanogaster genome. Genome Biology, 7(11):R112, 2006.
    OpenUrlCrossRefPubMed
  7. ↵
    R. K. Blackman, R. Grimaila, M. Macy, D. Koehler, and W. M. Gelbart. Mobilization of hobo elements residing within the decapentaplegic gene complex: Suggestion of a new hybrid dysgenesis system in Drosophila melanogaster. Cell, 49(4):497–505, 1987.
    OpenUrlCrossRefPubMedWeb of Science
  8. ↵
    J. P. Blumenstiel. Birth, school, work, death, and resurrection: The life stages and dynamics of transposable element proliferation. Genes, 10(5):336, 2019.
    OpenUrlCrossRef
  9. ↵
    1. M. Ashburner,
    2. L. Carson, and
    3. J. J. Thompson
    I. Bock and P. Parsons. Species of Australia and New Zealand. In M. Ashburner, L. Carson, and J. J. Thompson, editors, The genetics and biology of Drosophila, volume 3a, pages 349–393. Academic Press, Oxford, 1981.
    OpenUrl
  10. ↵
    E. Bonnivard and D. Higuet. Stability of European natural populations of Drosophila melanogaster with regard to the P-M system: a buffer zone made up of Q populations. Journal of Evolutionary Biology, 12 (4):633–647, 1999.
    OpenUrlCrossRef
  11. ↵
    R. Bouckaert, T. G. Vaughan, J. Barido-Sottani, S. Duchêne, M. Fourment, A. Gavryushkina, J. Heled, G. Jones, D. Kühnert, N. D. Maio, M. Matschiner, F. K. Mendes, N. F. Müller, H. A. Ogilvie, L. du Plessis, A. Popinga, A. Rambaut, D. Rasmussen, I. Siveroni, M. A. Suchard, C.-H. Wu, D. Xie, C. Zhang, T. Stadler, and A. J. Drummond. BEAST 2.5: An advanced software platform for bayesian evolutionary analysis. PLOS Computational Biology, 15(4):e1006650, Apr. 2019.
    OpenUrl
  12. ↵
    J. Brennecke, A. A. Aravin, A. Stark, M. Dus, M. Kellis, R. Sachidanandam, and G. J. Hannon. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell, 128(6):1089–1103, 2007.
    OpenUrlCrossRefPubMedWeb of Science
  13. ↵
    J. Brennecke, C. D. Malone, A. A. Aravin, R. Sachidanandam, A. Stark, and G. J. Hannon. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science, 322(5906):1387–1392, 2008.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    J. A. Brisson, J. Wilder, and H. Hollocher. Phylogenetic analysis of the cardini group of Drosophila with respect to changes in pigmentation. Evolution, 60(6):1228–1241, 2006.
    OpenUrlPubMed
  15. ↵
    A. Bucheton, J. Lavige, G. Picard, and P. L’heritier. Non-mendelian female sterility in Drosophila melanogaster : quantitative variations in the efficiency of inducer and reactive strains. Heredity, 36(3): 305–314, 1976.
    OpenUrlCrossRefPubMedWeb of Science
  16. ↵
    H. Burla, A. B. da Cunha, A. R. Cordeiro, T. Dobzhansky, C. Malogolowkin, and C. Pavan. The Willistoni Group of Sibling Species of Drosophila. Evolution, 3(4):300–314, 1949.
    OpenUrlCrossRefPubMedWeb of Science
  17. ↵
    M. Chakraborty, J. J. Emerson, S. J. Macdonald, and A. D. Long. Structural variants exhibit widespread allelic heterogeneity and shape variation in complex traits. Nature Communications, 10(1):4872, 2019.
    OpenUrl
  18. ↵
    M. Chakraborty, C. Chang, D. Khost, J. A. J Vedanayagam, Y. Liao, K. Montooth, C. Meiklejohn, A. Larracuente, and J. Emerson. Evolution of genome structure in the Drosophila simulans species complex. Genome Research, 31:380–396, 2021.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    S. B. Daniels, K. R. Peterson, L. D. Strausbaugh, M. G. Kidwell, and A. Chovnick. Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics, 124(2):339–55, 1990.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    A. Diaz-Papkovich, L. Anderson-Trocmé, and S. Gravel. A review of UMAP in population genetics. Journal of Human Genetics, 66(1):85–91, 2021.
    OpenUrl
  21. ↵
    R. C. Edgar. Muscle: multiple sequence alignment with high accuracy and high throughput. Nucleic acids research, 32(5):1792–1797, 2004.
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    D. G. Eickbush and T. H. Eickbush. Vertical transmission of the retrotransposable elements R1 and R2 during the evolution of the Drosophila melanogaster species subgroup. Genetics, 139(2):671–684, 1995.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    T. H. Eickbush and H. S. Malik. Origins and evolution of retrotransposons, volume 93. ASM Press, 2002.
  24. ↵
    S. F. Elena, L. Ekunwe, N. Hajela, S. A. Oden, and R. E. Lenski. Distribution of fitness effects caused by random insertion mutations in Escherichia coli. Genetica, 102-103:349–358, 1998.
    OpenUrlCrossRef
  25. ↵
    C. E. Ellison and W. Cao. Nanopore sequencing and Hi-C scaffolding provide insight into the evolutionary dynamics of transposable elements and piRNA production in wild strains of Drosophila melanogaster. Nucleic Acids Research, 48(1):1–14, 2020.
    OpenUrl
  26. ↵
    D. J. Finnegan. Eukaryotic transposable elements and genome evolution. Trends in Genetics, 5(4):103–107, 1989.
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    C. Goriaux, E. Théron, E. Brasset, and C. Vaury. History of the discovery of a master locus producing piRNAs: The flamenco/COM locus in Drosophila melanogaster. Frontiers in Genetics, 5:257, 2014.
    OpenUrl
  28. ↵
    L. S. Gramates, J. Agapite, H. Attrill, B. R. Calvi, M. A. Crosby, G. Dos Santos, J. L. Goodman, D. Goutte-Gattat, V. K. Jenkins, T. Kaufman, et al. Flybase: a guided tour of highlighted features. Genetics, 220 (4):iyac035, 2022.
    OpenUrl
  29. ↵
    M. M. Green. Mobile DNA elements and spontaneous gene mutation. Banbury Rep, 30:41–50, 1988.
    OpenUrl
  30. ↵
    J. K. Grenier, J. R. Arguello, M. C. Moreira, S. Gottipati, J. Mohammed, S. R. Hackett, R. Boughton, A. J. Greenberg, and A. G. Clark. Global diversity lines–a five-continent reference panel of sequenced Drosophila melanogaster strains. G3: Genes, Genomes, Genetics, 5(4):593–603, 2015.
    OpenUrl
  31. ↵
    L. S. Gunawardane, K. Saito, K. M. Nishida, K. Miyoshi, Y. Kawamura, T. Nagami, H. Siomi, and M. C. Siomi. A slicer-mediated mechanism for repeat-associated siRNA 5’ end formation in Drosophila. Science, 315(5818):1587–1590, 2007.
    OpenUrlAbstract/FREE Full Text
  32. ↵
    W. B. Heed and J. S. Russell. Phylogeny and population structure in island and continental species of the cardini group of Drosophila studied by inversion analysis. Stud Genet, 1971.
  33. ↵
    C. Hermant, A. Boivin, L. Teysset, V. Delmarre, A. Asif-Laidin, M. Van Den Beek, C. Antoniewski, and S. Ronsseray. Paramutation in Drosophila requires both nuclear and cytoplasmic actors of the piRNA pathway and induces cis-spreading of piRNA production. Genetics, 201(4):1381–1396, 2015.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    R. A. Hoskins, J. W. Carlson, K. H. Wan, S. Park, I. Mendez, S. E. Galle, B. W. Booth, B. D. Pfeiffer, R. A. George, R. Svirskas, et al. The Release 6 reference sequence of the Drosophila melanogaster genome. Genome Research, 25(3):445–458, 2015.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    S. Hotaling, J. S. Sproul, J. Heckenhauer, A. Powell, A. M. Larracuente, S. U. Pauls, J. L. Kelley, and P. B. Frandsen. Long Reads Are Revolutionizing 20 Years of Insect Genome Sequencing. Genome Biology and Evolution, 13(8):evab138, 06 2021.
    OpenUrl
  36. ↵
    C. Johnson. The distribution of some species of Drosophila. Psyche, 20:202–205, 1913.
    OpenUrlCrossRef
  37. ↵
    V. V. Kapitonov and J. Jurka. Molecular paleontology of transposable elements in the Drosophila melanogaster genome. Proceedings of the National Academy of Sciences of the United States of America, 100(11):6569–74, 2003. ISSN 0027-8424.
    OpenUrlAbstract/FREE Full Text
  38. ↵
    M. Kapun, M. G. Barrón, F. Staubach, D. J. Obbard, R. A. W. Wiberg, J. Vieira, C. Goubert, O. Rota-Stabelli, M. Kankare, M. Bogaerts-Márquez, et al. Genomic analysis of European Drosophila melanogaster populations reveals longitudinal structure, continent-wide selection, and previously unknown DNA viruses. Molecular Biology and Evolution, 37(9):2661–2678, 2020.
    OpenUrlCrossRef
  39. ↵
    M. G. Kidwell. Evolution of hybrid dysgenesis determinants in Drosophila melanogaster. Proceedings of the National Academy of Sciences, 80(6):1655–1659, 1983.
    OpenUrlAbstract/FREE Full Text
  40. ↵
    M. G. Kidwell, J. F. Kidwell, and J. A. Sved. Hybrid dysgenesis in Drosophila melanogaster : A syndrome of aberrant traits including mutations, sterility and male recombination. Genetics, 86(4):813–833, 1977.
    OpenUrlAbstract/FREE Full Text
  41. ↵
    B. Y. Kim, J. R. Wang, D. E. Miller, O. Barmina, E. Delaney, A. Thompson, A. A. Comeault, D. Peede, E. R. D’Agostino, J. Pelaez, J. M. Aguilar, D. Haji, T. Matsunaga, E. E. Armstrong, M. Zych, Y. Ogawa, M. Stamenković -Radak, M. Jelić, M. S. Veselinović, M. Tanasković, P. Erić, J.-J. Gao, T. K. Katoh, M. J. Toda, H. Watabe, M. Watada, J. S. Davis, L. C. Moyle, G. Manoli, E. Bertolini, V. Koštál, R. S. Hawley, A. Takahashi, C. D. Jones, D. K. Price, N. Whiteman, A. Kopp, D. R. Matute, and D. A. Petrov. Highly contiguous assemblies of 101 drosophilid genomes. eLife, 10:e66405, 2021.
    OpenUrl
  42. ↵
    E. G. King, C. M. Merkes, C. L. McNeil, S. R. Hoofer, S. Sen, K. W. Broman, A. D. Long, and S. J. Mac-donald. Genetic dissection of a model complex trait using the Drosophila Synthetic Population Resource. Genome Research, 22(8):1558–1566, 2012.
    OpenUrlAbstract/FREE Full Text
  43. ↵
    R. Kofler. Dynamics of Transposable Element Invasions with piRNA Clusters. Molecular Biology and Evolution, 36(7):1457–1472, 2019.
    OpenUrlCrossRef
  44. ↵
    R. Kofler, T. Hill, V. Nolte, A. Betancourt, and C. Schlötterer. The recent invasion of natural Drosophila simulans populations by the P-element. PNAS, 112(21):6659–6663, 2015.
    OpenUrlAbstract/FREE Full Text
  45. ↵
    R. Kofler, K.-A. Senti, V. Nolte, R. Tobler, and C. Schlötterer. Molecular dissection of a natural transposable element invasion. Genome Research, 28(6):824–835, 2018.
    OpenUrlAbstract/FREE Full Text
  46. ↵
    R. Kofler, V. Nolte, and C. Schlötterer. The Transposition Rate Has Little Influence on the Plateauing Level of the P-element. Molecular Biology and Evolution, 39(7):msac141, 2022.
    OpenUrlCrossRef
  47. ↵
    J. D. Lange, H. Bastide, J. B. Lack, and J. E. Pool. A Population Genomic Assessment of Three Decades of Evolution in a Natural Drosophila Population. Molecular Biology and Evolution, 39(2), 2021.
  48. ↵
    A. Le Thomas, A. K. Rogers, A. Webster, G. K. Marinov, S. E. Liao, E. M. Perkins, J. K. Hur, A. A. Aravin, and K. F. Tóth. Piwi induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state. Genes and Development, 27(4):390–399, 2013.
    OpenUrlAbstract/FREE Full Text
  49. ↵
    A. Le Thomas, G. K. Marinov, and A. A. Aravin. A transgenerational process defines piRNA biogenesis in Drosophila virilis. Cell Reports, 8(6):1617–1623, 2014a.
    OpenUrl
  50. ↵
    A. Le Thomas, E. Stuwe, S. Li, J. Du, G. Marinov, N. Rozhkov, Y. C. A. Chen, Y. Luo, R. Sachidanandam, K. F. Toth, D. Patel, and A. A. Aravin. Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing. Genes and Development, 28(15):1667–1680, 2014b.
    OpenUrlAbstract/FREE Full Text
  51. ↵
    H. Li. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34(18):3094–3100, 2018.
    OpenUrlCrossRefPubMed
  52. ↵
    H. Li and R. Durbin. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics, 25(14):1754–1760, 2009.
    OpenUrlCrossRefPubMedWeb of Science
  53. ↵
    D. H. Lindsley and E. H. Grell. Genetic variations of Drosophila melanogaster. Carnegie Institute of Washington Publication, 1968. ISBN 0099-4936.
  54. ↵
    R. S. Linheiro and C. M. Bergman. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster. PloS one, 7(2):e30008, 2012.
    OpenUrlCrossRefPubMed
  55. ↵
    Q. Long, F. A. Rabanal, D. Meng, C. D. Huber, A. Farlow, A. Platzer, Q. Zhang, B. J. Vilhjálmsson, A. Korte, V. Nizhynska, et al. Massive genomic variation and strong selection in Arabidopsis thaliana lines from Sweden. Nature genetics, 45(8):884–890, 2013.
    OpenUrlCrossRefPubMed
  56. ↵
    E. L. S. Loreto, C. M. A. Carareto, and P. Capy. Revisiting horizontal transfer of transposable elements in Drosophila. Heredity, 100(6):545–54, 2008.
    OpenUrlCrossRefPubMedWeb of Science
  57. ↵
    S. Luo, H. Zhang, Y. Duan, X. Yao, A. G. Clark, and J. Lu. The evolutionary arms race between transposable elements and piRNAs in Drosophila melanogaster. BMC Evolutionary Biology, 20(1):1–18, 2020.
    OpenUrlCrossRef
  58. ↵
    H. E. Machado, A. O. Bergland, R. Taylor, S. Tilk, E. Behrman, K. Dyer, D. K. Fabian, T. Flatt, J. González, T. L. Karasov, et al. Broad geographic sampling reveals the shared basis and environmental correlates of seasonal adaptation in drosophila. Elife, 10:e67577, 2021.
    OpenUrlCrossRef
  59. ↵
    C. D. Malone and G. J. Hannon. Small RNAs as Guardians of the Genome. Cell, 136(4):656–668, 2009.
    OpenUrlCrossRefPubMedWeb of Science
  60. ↵
    M. Martin. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. journal, 17(1):10–12, 2011.
    OpenUrl
  61. ↵
    L. McInnes, J. Healy, and J. Melville. Umap: Uniform manifold approximation and projection for dimension reduction. arXiv preprint arXiv:1802.03426, 2018.
  62. ↵
    S. A. Miller, D. D. Dykes, and H. F. Polesky. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research, 16(3):1215, 1988.
    OpenUrlCrossRefPubMedWeb of Science
  63. ↵
    F. Mohn, G. Sienski, D. Handler, and J. Brennecke. The rhino-deadlock-cutoff complex licenses noncanonical transcription of dual-strand piRNA clusters in Drosophila. Cell, 157(6):1364–1379, 2014.
    OpenUrlCrossRefPubMedWeb of Science
  64. ↵
    J. Nelson, A. Slicko, and Y. Yamashita. The retrotransposon R2 maintains Drosophila ribosomal DNA repeats. PNAS, 120(23):e2221613120, 2023.
    OpenUrlCrossRef
  65. ↵
    D. J. Obbard, J. Maclennan, K.-W. Kim, A. Rambaut, P. M. O’Grady, and F. M. Jiggins. Estimating divergence dates and substitution rates in the Drosophila phylogeny. Molecular Biology and Evolution, 29 (11):3459–3473, 2012.
    OpenUrlCrossRefPubMedWeb of Science
  66. ↵
    E. Pasyukova, S. Nuzhdin, T. Morozova, and T. Mackay. Accumulation of transposable elements in the genome of Drosophila melanogaster is associated with a decrease in fitness. Journal of Heredity, 95(4): 284–290, 2004.
    OpenUrlCrossRefPubMedWeb of Science
  67. ↵
    J. Peccoud, V. Loiseau Cordaux, and C. Gilbert. Massive horizontal transfer of transposable elements in insects. Proc Natl Acad Sci U S A, 114(18):4721–26, 2017.
    OpenUrlAbstract/FREE Full Text
  68. ↵
    G. Periquet, M. H. Hamelin, Y. Bigot, and A. Lepissier. Geographical and historical patterns of distribution of hobo elements in Drosophila melanogaster populations. Journal of Evolutionary Biology, 2(3):223–229, 1989.
    OpenUrl
  69. ↵
    J. E. Pool. The Mosaic Ancestry of the Drosophila Genetic Reference Panel and the D. melanogaster Reference Genome Reveals a Network of Epistatic Fitness Interactions. Molecular biology and evolution, page msv194, 2015.
  70. ↵
    H. Quesneville, C. M. Bergman, O. Andrieu, D. Autard, D. Nouaud, M. Ashburner, and D. Anxolabéhère. Combined evidence annotation of transposable elements in genome sequences. PLoS Computational Biology, 1(2):166–175, 2005.
    OpenUrl
  71. ↵
    A. R. Quinlan and I. M. Hall. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics (Oxford, England), 26(6):841–842, 2010.
    OpenUrlCrossRefPubMedWeb of Science
  72. ↵
    P. Rangan, C. D. Malone, C. Navarro, S. P. Newbold, P. S. Hayes, R. Sachidanandam, G. J. Hannon, and R. Lehmann. piRNA production requires heterochromatin formation in Drosophila. Current Biology, 21 (16):1373–1379, 2011.
    OpenUrlCrossRefPubMed
  73. ↵
    G. E. Rech, S. Radío, S. Guirao-Rico, L. Aguilera, V. Horvath, L. Green, H. Lindstadt, V. Jamilloux, H. Quesneville, and J. González. Population-scale long-read sequencing uncovers transposable elements associated with gene expression variation and adaptive signatures in drosophila. Nature Communications, 13(1):1948, 2022.
    OpenUrl
  74. ↵
    M. D. Robinson, D. J. McCarthy, and G. K. Smyth. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics, 26(1):139–140, 2010.
    OpenUrlCrossRefPubMedWeb of Science
  75. ↵
    K. Sankaranarayanan. Mobile genetic elements, spontaneous mutations, and the assessment of genetic radiation hazards in man. Cold Spring Harbor, 1988.
  76. ↵
    P. Sarkies, M. E. Selkirk, J. T. Jones, V. Blok, T. Boothby, B. Goldstein, B. Hanelt, A. Ardila-Garcia, N. M. Fast, P. M. Schiffer, C. Kraus, M. J. Taylor, G. Koutsovoulos, M. L. Blaxter, and E. A. Miska. Ancient and novel small RNA pathways compensate for the loss of piRNAs in multiple independent nematode lineages. PLoS Biol., 13(2):1–20, 2015.
    OpenUrlCrossRefPubMed
  77. ↵
    A. Scarpa and R. Kofler. The impact of paramutations on the invasion dynamics of transposable elements. Genetics, page iyad181, 2023.
  78. ↵
    A. Scarpa, R. Pianezza, F. Wierzbicki, and R. Kofler. Genomes of historical specimens reveal multiple invasions of ltr retrotransposons in drosophila melanogaster populations during the 19th century. bioRxiv, 2023. doi: 10.1101/2023.06.06.543830.
    OpenUrlAbstract/FREE Full Text
  79. ↵
    S. Schaack, C. Gilbert, and C. Feschotte. Promiscuous DNA: horizontal transfer of transposable elements and why it matters for eukaryotic evolution. Trends in ecology & evolution, 25(9):537–46, 2010.
    OpenUrl
  80. ↵
    J. M. Schmidt, R. T. Good, B. Appleton, J. Sherrard, G. C. Raymant, M. R. Bogwitz, J. Martin, P. J. Daborn, M. E. Goddard, P. Batterham, et al. Copy number variation and transposable elements feature in recent, ongoing adaptation at the cyp6g1 locus. PLoS genetics, 6(6):e1000998, 2010.
    OpenUrl
  81. ↵
    P. S. Schnable, S. Pasternak, C. Liang, J. Zhang, L. Fulton, T. A. Graves, P. Minx, A. D. Reily, L. Courtney, S. S. Kruchowski, C. Tomlinson, C. Strong, K. Delehaunty, C. Fronick, B. Courtney, S. M. Rock, E. Belter, F. Du, K. Kim, R. M. Abbott, M. Cotton, A. Levy, P. Marchetto, K. Ochoa, S. M. Jackson, B. Gillam, W. Chen, L. Yan, J. Higginbotham, M. Cardenas, J. Waligorski, E. Applebaum, L. Phelps, J. Falcone, K. Kanchi, T. Thane, A. Scimone, N. Thane, J. Henke, T. Wang, J. Ruppert, N. Shah, K. Rotter, J. Hodges, E. Ingenthron, M. Cordes, S. Kohlberg, J. Sgro, B. Delgado, K. Mead, A. Chinwalla, S. Leonard, K. Crouse, K. Collura, D. Kudrna, J. Currie, R. He, A. Angelova, S. Rajasekar, T. Mueller, R. Lomeli, G. Scara, A. Ko, K. Delaney, M. Wissotski, G. Lopez, D. Campos, M. Braidotti, E. Ashley, W. Golser, H. Kim, S. Lee, J. Lin, Z. Dujmic, W. Kim, J. Talag, A. Zuccolo, C. Fan, A. Sebastian, M. Kramer, L. Spiegel, L. Nascimento, T. Zutavern, B. Miller, C. Ambroise, S. Muller, W. Spooner, A. Narechania, L. Ren, S. Wei, and S. Kumari. The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science, 326(5956):1112–1115, 2009.
    OpenUrlAbstract/FREE Full Text
  82. ↵
    F. Schwarz, F. Wierzbicki, K.-A. Senti, and R. Kofler. Tirant Stealthily Invaded Natural Drosophila melanogaster Populations during the Last Century. Molecular Biology and Evolution, 38(4):1482–1497, 2021.
    OpenUrlCrossRef
  83. ↵
    D. Selvaraju, F. Wierzbicki, and R. Kofler. P-element invasions in Drosophila erecta shed light on the establishment of host control over a transposable element. bioRxiv, 2022.
  84. ↵
    W. Shen, S. Le, Y. Li, and F. Hu. Seqkit: A cross-platform and ultrafast toolkit for fasta/q file manipulation. PLOS ONE, 11(10):1–10, 10 2016.
    OpenUrlCrossRefPubMed
  85. ↵
    S. Shpiz, S. Ryazansky, I. Olovnikov, Y. Abramov, and A. Kalmykova. Euchromatic transposon insertions trigger production of novel pi-and endo-siRNAs at the target sites in the Drosophila germline. PLoS Genetics, 10(2):e1004138, 2014.
    OpenUrl
  86. ↵
    A. Shumate and S. Salzberg. Liftoff: accurate mapping of gene annotations. Bioinformatics, 37(12):1639–1643, 2021.
    OpenUrl
  87. ↵
    G. Sienski, D. Dönertas, and J. Brennecke. Transcriptional silencing of transposons by Piwi and maelstrom and its impact on chromatin state and gene expression. Cell, 151(5):964–980, 2012.
    OpenUrlCrossRefPubMedWeb of Science
  88. ↵
    S. Signor, J. Vedanayagam, B. Kim, F. Wierzbicki, R. Kofler, and E. Lai. Rapid evolutionary diversification of the flamenco locus across simulans clade drosophila species. PLoS Genet, 19, 2023.
  89. ↵
    G. Simmons. Horizontal transfer of hobo transposable elements within the Drosophila melanogaster species complex: evidence from dna sequencing. Molecular biology and evolution, 9(6):1050–1060, 1992.
    OpenUrlPubMedWeb of Science
  90. F. A. Smit, R. Hubley, and P. Green. RepeatMasker Open-3.0, 1996-2010. URL http://www.repeatmasker.org.
  91. ↵
    Spassky, R. C. Richmond, S. Perez-Salas, O. Pavlovsky, C. A. Mourao, A. S. Hunter, H. Hoenigsberg, T. Dobzhansky, and F. J. Ayala. Geography of the Sibling Species Related to Drosophila willistoni, and of the Semispecies of the Drosophila Paulistorum Complex. Evolution, 25(1):129–143, 1971.
    OpenUrlCrossRefWeb of Science
  92. ↵
    S. Srivastav, C. Feschotte, and A. G. Clark. Rapid evolution of piRNA clusters in the Drosophila melanogaster ovary. bioRxiv, 2023.
  93. ↵
    S. Steinbiss, U. Willhoeft, G. Gremme, and S. Kurtz. Fine-grained annotation and classification of de novo predicted LTR retrotransposons. Nucleic acids research, 37(21):7002–7013, 2009.
    OpenUrlCrossRefPubMedWeb of Science
  94. ↵
    H. Thorvaldsdóttir, J. T. Robinson, and J. P. Mesirov. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics, 2012.
  95. ↵
    J. Thurmond, J. L. Goodman, V. B. Strelets, H. Attrill, L. S. Gramates, S. J. Marygold, B. B. Matthews, G. Millburn, G. Antonazzo, V. Trovisco, et al. Flybase 2.0: the next generation. Nucleic acids research, 47(D1):D759–D765, 2019.
    OpenUrlCrossRefPubMed
  96. ↵
    L. Wang, S. Zhang, S. Hadjipanteli, L. Saiz, L. Nguyen, E. Silva, and E. Kelleher. P-element invasion fuels molecular adaptation in laboratory populations of Drosophila melanogaster. Evolution, 77(4):980–994, 2023.
    OpenUrl
  97. L. Weilguny and R. Kofler. DeviaTE: Assembly-free analysis and visualization of mobile genetic element composition. Molecular Ecology Resources, 19(5):1346–1354, 2019.
    OpenUrl
  98. ↵
    D. L. Wheeler, T. Barrett, D. A. Benson, S. H. Bryant, K. Canese, V. Chetvernin, D. M. Church, M. DiCuccio, R. Edgar, S. Federhen, et al. Database resources of the national center for biotechnology information. Nucleic acids research, 35(suppl 1):D5–D12, 2007.
    OpenUrlCrossRefPubMedWeb of Science
  99. ↵
    T. Wicker, F. Sabot, A. Hua-Van, J. L. Bennetzen, P. Capy, B. Chalhoub, A. Flavell, P. Leroy, M. Morgante, O. Panaud, et al. A unified classification system for eukaryotic transposable elements. Nature Reviews Genetics, 8(12):973–982, 2007.
    OpenUrlCrossRefPubMed
  100. ↵
    F. Wierzbicki and R. Kofler. The composition of piRNA clusters in Drosophila melanogaster deviates from expectations under the trap model. BMC Biology, 2023.
  101. ↵
    F. Wierzbicki, F. Schwarz, O. Cannalonga, and R. Kofler. Novel quality metrics allow identifying and generating high-quality assemblies of piRNA clusters. Molecular Ecology Resources, 2021. doi: 10.1111/1755-0998.13455.
    OpenUrlCrossRef
  102. ↵
    F. Wierzbicki, R. Kofler, and S. Signor. Evolutionary dynamics of piRNA clusters in Drosophila. Molecular Ecology, 32(6):1306–1322, 2023.
    OpenUrl
  103. ↵
    S. Yamanaka, M. C. Siomi, and H. Siomi. piRNA clusters and open chromatin structure. Mobile DNA, 5(1): 22, 2014.
    OpenUrl
  104. ↵
    R. Zanini, M. Deprá, and V. Valante. On the geographic distribution of the Drosophila willistoni group (Diptera, Drosophilidae) - updated geographic distribution of the Neotropical willistoni subgroup. 98: 39–43, 01 2015.
    OpenUrl
  105. ↵
    V. Zanni, A. Eymery, M. Coiffet, M. Zytnicki, I. Luyten, H. Quesneville, C. Vaury, and S. Jensen. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters. Proceedings of the National Academy of Sciences, 110(49):19842–19847, 2013.
    OpenUrlAbstract/FREE Full Text
  106. ↵
    S. Zhang, B. Pointer, and E. S. Kelleher. Rapid evolution of piRNA-mediated silencing of an invading transposable element was driven by abundant de novo mutations. Genome Research, 30(4):566–575, 2020.
    OpenUrlAbstract/FREE Full Text
Back to top
Posted November 02, 2023.
Download PDF

Supplementary Material

Data/Code
Email
Spoink, a LTR retrotransposon, invaded D. melanogaster populations in the 1990s
Riccardo Pianezza, Almorò Scarpa, Prakash Narayanan, Sarah Signor, Robert Kofler
bioRxiv 2023.10.30.564725; doi: https://doi.org/10.1101/2023.10.30.564725
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area