New Results

Heterologous expression and purification of glutamate decarboxylase-1 from the model plant Arabidopsis thaliana: characterization of the enzyme’s in vitro truncation by thiol endopeptidase activity

Brittany S. Menard, Kirsten H. Benidickson, Lee Marie Raytek, Wayne A. Snedden, William C. Plaxton
doi: https://doi.org/10.1101/2024.04.11.589046

ABSTRACT

Plant glutamate decarboxylase (GAD) is a Ca2+-calmodulin activated cytosolic enzyme that produces γ-aminobutyrate (GABA) as the first committed step of the GABA shunt. This pathway circumvents the 2-oxoglutarate to succinate reactions of the mitochondrial tricarboxylic acid cycle. Our prior research established that in vivo phosphorylation of the root-specific AtGAD1 isozyme (AT5G17330) occurs at multiple N-terminal serine residues, following Pi resupply to Pi-starved cell cultures of the model plant Arabidopsis thaliana. The aim of the current investigation was to purify recombinant AtGAD1 following its expression in Escherichia coli to facilitate studies of the impact of site-specific phosphorylation on its kinetic properties. However, in vitro proteolytic truncation of a 5 kDa polypeptide from the C-terminus of 59 kDa AtGAD1 subunits occurred during its purification. Immunoblotting demonstrated that most protease inhibitors or cocktails that we tested were ineffective in suppressing partial AtGAD1 proteolysis during incubation of clarified extracts at 23 °C. Although the thiol modifiers N-ethylmaleimide or 2,2-dipyridyl disulfide negated AtGAD1 proteolysis, they also abolished its GAD activity. This indicates that an essential -SH group is needed for catalytic activity, and that AtGAD1 is susceptible to partial degradation either by an E. coli cysteine endopeptidase, or possibly via autoproteolytic activity. The inclusion of exogenous Ca2+/calmodulin in extraction and chromatography buffers facilitated the purification of non-proteolyzed AtGAD1 to a specific activity of 27 (µmol GABA produced/mg) at optimal pH 5.8, while exhibiting an approximate 3-fold activation by Ca2+/CaM at pH 7.3. By contrast, the purified partially proteolyzed His6-AtGAD1 was >40% less active at both pH values, and only activated 2-fold by Ca2+/CaM at pH 7.3. These results emphasize the need to diagnose and prevent unwanted proteolysis before conducting kinetic studies of purified regulatory enzymes.

1. Introduction

Glutamate decarboxylase (GAD1; EC 4.1.1.31) is a tightly regulated cytosolic enzyme in plants that is also widely distributed in animals and bacteria. GAD catalyzes the irreversible decarboxylation of glutamate to γ-aminobutyrate (GABA) and CO2. This represents the first committed step of the GABA shunt, a pathway that bypasses the 2-oxoglutarate to succinate reactions of the tricarboxylic acid cycle, and that facilitates plant acclimation to various (a)biotic stresses (Benidickson et al., 2023; Bouché et al., 2003; Che-Othman et al., 2020; Joshi et al., 2019). GADs belong to the aspartate aminotransferase superfamily of pyridoxal-5’-P (PLP)-dependent enzymes (Rossignoli et al., 2018). The genome of the model plant Arabidopsis thaliana encodes five closely related GAD isozymes. AtGAD1 (AT5G17330) is the most studied paralog, and is primarily expressed in roots (Benidickson et al., 2023; Bouché et al., 2004; Turano & Fang, 1998). Knockout of AtGAD1 in atgad1 T-DNA mutants decreases root GABA levels by up to 85% while compromising the ability of Arabidopsis to survive various stresses including salinity, excessive heat, or nutritional Pi deprivation (Benidickson et al., 2023; Mekonnen et al., 2016; Shelp, 1999; Su et al., 2019).

Plant GADs are activated by a reduction in cytosolic pH from resting levels (∼pH 7.3), since their pH-activity optimum is about pH 6.0 (Snedden et al., 1995). However, AtGAD1, AtGAD2, and AtGAD4 each contain a calmodulin (CaM) binding domain near their C-terminus that makes them responsive to cytosolic Ca2+, and results in their activation by Ca2+/CaM at pH 7.3 (Baum et al., 1993; Shelp et al., 2012; Snedden et al., 1995). The AtGAD1 crystal structure indicates that it occurs as a homohexamer composed of a trimer of dimers, whereas in solution the enzyme’s 58 kDa subunits exist in a dynamic dimer-hexamer equilibrium (Astegno et al., 2015; Gut et al., 2009). The association of dimers into hexamers is promoted by high AtGAD1 concentrations, Ca2+/CaM binding, or pH values below 6.5. Tight control of AtGAD1 by Ca2+/CaM is critical for ensuring appropriate GABA levels and optimal plant development. Transgenic plants expressing a truncated AtGAD1 mutant lacking its C-terminal CaM binding domain exhibit reduced growth, along with lower glutamate and enhanced GABA levels (Baum et al., 1996; S et al., 2021).

Our recent phosphoproteomic study revealed that AtGAD1 became hyperphosphorylated at several conserved serine residues located near its N-terminus 48 h following resupply of 2 mM Pi to Pi-starved, heterotrophic Arabidopsis suspension cell cultures (Mehta et al., 2021). This highlights a potential link between Pi nutrition and a novel post-translational control mechanism for AtGAD1 via reversible phosphorylation. Preliminary evidence of Raytek (2022) supports the hypothesis that differential phosphorylation inhibits the activity of native AtGAD1 following Pi resupply to Pi-starved Arabidopsis. Phenotypic analyses of atgad1 T-DNA insertional mutants demonstrated that AtGAD1 and the GABA shunt play important adaptive roles during Arabidopsis acclimation to Pi deprivation (Benidickson et al., 2023).

The present study was initiated to purify recombinant AtGAD1 (rAtGAD1) following its heterologous expression in Escherichia coli in order to facilitate further studies of the mechanisms and functions of site-specific AtGAD1 phosphorylation (Mehta et al., 2021; Raytek, 2022). However, the C-terminal CaM-binding domain of rAtGAD1 was determined to be quite susceptible to in vitro proteolytic truncation by co-extracted thiol endopeptidase activity. The objective of the current study was to systematically diagnose approaches to overcome this since even very limited proteolysis can trigger dramatic changes to an enzyme’s kinetic and regulatory properties (Plaxton, 2019; Plaxton & Preiss, 1987). Prevention of unwanted proteolysis during enzyme purification usually involves the addition of protease inhibitors or cocktails to homogenization buffers to block proteolysis in situ, followed by separation of contaminating proteases from the enzyme of interest by column chromatography (Plaxton, 2019). However, despite testing a wide range of protease inhibitors and cocktails, our results indicate that the most effective way to isolate active, non-proteolyzed rAtGAD1 is to extract and purify the enzyme in the presence of exogenous Ca2+/CaM.

2. Materials and methods

2.1 Heterologous expression of His6-rAtGAD1

A culture stab of XL1 blue Escherichia coli containing pET15b-AtGAD1 carrying an N-terminal His6-tag (Trobacher et al., 2013) was cultured overnight in Luria Bertani (LB) media containing 0.1 mg/ml ampicillin. Plasmid DNA was isolated using the ‘Presto Mini Plasmid Kit’ (Geneaid) according to the manufacturer’s protocol and quantified using a ‘NanoDrop One’ system (Thermo Fischer Scientific). To confirm that the complete AtGAD1 open reading frame was unmutated and in-frame, Taq polymerase-based PCR with gene-specific forward (5’ GCTCTAGACATATGGTGCTCTCCCAC – 3’) and reverse (5’ – CGGGATCCTTAGCAGATACCACTCG – 3’) primers, and Sanger sequencing (TCAG, SickKids) of pET15b-AtGAD1 was completed. PCR reactions were conducted as follows: initial denaturation at 95 °C for 30 s, followed by 35 cycles of, 95 °C for 20 s, 48 °C for 20 s, and 68 °C for 1 min 45 s, and a final extension at 68 °C for 10 min. Amplicons were visualized on a 1% agarose gel stained with RedSafe Nucleic Acid Staining Solution (FroggaBio). pET15b-AtGAD1 was transformed into E. coli BL21 (DE3) CodonPlus-RIL (CP-RIL) or pLysS cells using a standard heat-shock protocol (Green & Sambrook, 2012). Transformants were spread onto LB agar containing 0.1 mg/ml ampicillin and incubated at 37 °C overnight. Individual colonies were selected and cultured overnight at 37 °C, 200 rpm in 5 ml of LB media containing 0.1 mg/ml ampicillin. Plasmids were isolated from individual colonies and confirmed to have the full AtGAD1 open reading frame, as described above. Transformed cells were cultured in 1.5 L of LB media containing 0.1 mg/ml ampicillin and incubated at 37 °C and 200 rpm until an A600 of 0.5-0.7 was reached. His6-rAtGAD1 expression was induced using 0.1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 4 h at 37 °C and 200 rpm. Cells were harvested by centrifuging at 4,400 × g for 15 min, and the resulting pellets frozen in liquid N2 and stored at −80 °C.

2.2 Purification of His6-rAtGAD1

All chromatography steps were performed at 23 °C using an ÄKTA Purifier Fast Protein Liquid Chromatography system (FPLC; Cytiva). Peak FPLC fractions containing purified His6-rAtGAD1 were routinely pooled and adjusted to contain 0.1 mM PLP, concentrated with an Amicon Ultra-15 centrifugal filter unit (30 kDa MWCO), desalted (into 50 mM HEPES-KOH, pH 7.2, containing 10% glycerol, 0.5 mM DTT, and 0.1 mM PLP), divided into 50 μL aliquots, frozen in liquid N2, and stored at −80 °C.

His6-rAtGAD1 was initially purified by following a previously reported procedure (Astegno et al., 2015; Gut et al., 2009; Trobacher et al., 2013). Quick-frozen His6-rAtGAD1 expressing E. coli BL21 (DE3) CP-RIL cells (7.4 gFW) were thawed and resuspended (1:5; w/v) in buffer A (50 mM HEPES-KOH, pH 7.2, containing 150 mM NaCl, 1 mM DTT, 0.1 mM PLP, 1 mM phenylmethylsulfonyl fluoride [PMSF], and 1X SigmaFAST Protease Inhibitor Cocktail [PIC] Tablets; Millipore-Sigma, cat.# S8830), and lysed by passing twice through a French Pressure cell at 20,000 psi. As PMSF is labile in aqueous solutions (Plaxton, 2019), it was added to extraction buffers immediately prior to cell lysis (from a 100 mM stock prepared in 100% ethanol). Extracts were clarified via centrifugation for 20 min at 48,250 × g and 4 °C. The supernatant fluid was adjusted to contain 2 mM CaCl2 and batch adsorbed via end-over-end mixing for 30 min at 4 °C with 2 ml of CaM-Sepharose 4B (Cytiva) pre-equilibrated with buffer A containing 2 mM CaCl2. The resin was packed into a 1 cm diameter column and connected to the FPLC system. Following elution of nonbinding proteins at 1 ml/min, His6-rAtGAD1 was eluted with buffer A containing 2 mM EGTA.

To determine if treatment with 2,2-dipyridyl disulfide (DPDS) suppresses partial rAtGAD1 proteolysis during its extraction and purification, cultures of His6-rAtGAD1 expressing E. coli BL21 (DE3) CP-RIL cells were prepared as described above. IPTG-induced pET15b-AtGAD1 BL21 CP-RIL cells (6 gFW) were resuspended (1:5; w/v) in buffer B (20 mM NaH2PO4, pH 7.4, 300 mM NaCl, 10 mM imidazole, 0.1 mM PLP) containing 2 mM DPDS, lysed using the French press and centrifuged as described above. The supernatant fluid was loaded at 1 ml/min onto a column (1 × 5 cm) of HisPur Ni-NTA Superflow Agarose (Thermo Fisher Scientific) pre-equilibrated with buffer B lacking 0.1 mM PLP. After eluting non-binding proteins with buffer C (20 mM NaH2PO4, pH 7.4, 300 mM NaCl, and 20 mM imidazole), His6-rAtGAD1 was eluted using buffer C containing 300 mM imidazole.

To determine whether Ca2+/CaM addition suppresses in vitro proteolysis of His6-rAtGAD1, cultures of E. coli BL21 (DE3) pLysS cells expressing petunia CaM81 (exhibits 100% sequence identity to Arabidopsis CaM7) in the pET5a expression vector (Fromm & N.-H., 1992; Teresinski et al., 2023) were prepared as described above. IPTG-induced pET15b-AtGAD1 BL21 CP-RIL and pET5a-CaM81 BL21 pLysS cells (6 gFW each) were combined and resuspended (1:5; w/v) in buffer B containing 1 mM CaCl2, lysed using the French press and centrifuged as described above. The supernatant fluid was loaded at 1 ml/min onto a column (1 × 5 cm) of HisPur Ni-NTA Superflow Agarose pre-equilibrated with buffer B containing 0.1 mM CaCl2 and lacking 0.1 mM PLP. After eluting non-binding proteins with buffer C containing 0.1 mM CaCl2, His6-rAtGAD1 and CaM81 were eluted using the same buffer containing 300 mM imidazole.

2.3 Protein concentration determination, electrophoresis, and immunoblotting

Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fischer Scientific) with a bovine γ-globulin standard. SDS-PAGE was performed using a Bio-Rad Mini-PROTEAN 3 Cell mini-gel rig, and stacking and separating gels composed of 4 and 10% (w/v) acrylamide, respectively, unless otherwise indicated. Following electrophoresis, gels were either stained for total protein with Coomassie Brilliant Blue G-250 or R-250, or electroblotted onto a PVDF membrane for immunoblotting. Immunoblots were probed for 1 h at 23 °C with rabbit immune serum raised against petunia GAD (anti-GAD) (Arazi et al., 1995) or mouse anti-recombinant Petunia × hybrida CaM72 monoclonal IgG (anti-CaM) (Baum et al., 1996), or overnight at 4 °C with mouse anti-His-IgG (anti-His, Cell Signaling). Immunoreactive polypeptides were visualized using an alkaline phosphatase-linked secondary antibody and chromogenic detection. For the determination of His6-rAtGAD1 subunit molecular mass during SDS-PAGE a plot of Relative Mobility versus log Mr was constructed using Bio-Rad’s Precision Plus Protein™ Standards (Cat. # 1610394) having the following Mr values: 150, 100, 75, 50, 37 and 25 kDa.

2.4 GAD activity assays

GAD activity was assayed using a coupled GABase spectrophotometric assay as previously described (Miyashita & Good, 2008). GABase was obtained from MilliporeSigma (Product #: G7509) and consists of a mixture of GABA transaminase and succinic semialdehyde dehydrogenase from Pseudomonas fluorescens. Unless otherwise stated, the stopped-time assay was carried out at 25 °C for 30 min in a 200 μL reaction mixture containing 25 mM MES and 25 mM bis-tris propane (pH 5.8 or 7.3), 10% (v/v) glycerol, 10 mM KCl, 20 mM glutamate, 1 mM DTT and 0.5 mM PLP. Assays were terminated by bringing the assay to pH 1.0 with 70% perchloric acid, followed by adjustment to pH 8.6 with 3 M KOH. Samples were centrifuged for 3 min at 17,500 × g, from which up to 100 μL of supernatant fluid was transferred to a 96-well microtiter plate. A 100 μL aliquot of a GABase reaction mixture (100 mM bis-tris-propane, pH 8.6, 10 mM 2-oxoglutarate, 2 mM NADP+, 0.16 units/ml GABase) was added to each well. A Molecular Devices Spectromax Plus Microplate spectrophotometer was used to monitor the increase in A340 owing to the reduction of NADP+ to NADPH. Using a calibration curve generated with various amounts of GABA (Supplemental Fig. S1A), the specific activity of His6-rAtGAD1 was calculated as units/mg protein, where one unit is defined as 1 μmol of GABA produced per min at 25 °C. The assays were validated by showing that the amount of GABA produced was proportional to assay time (Supplemental Fig. S1B) and GAD concentration.

2.5 Statistical analysis

Data was analyzed using two-way ANOVA and Tukey’s multiple comparison tests. Results were deemed statistically significant at p < 0.05.

3. Results and discussion

3.1 The C-terminal region of His6-rAtGAD1 is susceptible to partial in vitro proteolytic truncation

His6-rAtGAD1 was heterologously expressed in E. coli BL21 (DE3) CP-RIL and extracted under denaturing conditions in hot SDS-PAGE sample buffer. Anti-GAD or anti-His immunoblotting following SDS-PAGE of the resulting extract revealed a single immunoreactive 59 kDa polypeptide (Fig. 1A and B), which is consistent with the enzyme’s predicted subunit Mr (i.e., AtGAD1 = 502 amino acids, plus N-terminal His6 tag and linker = 21 amino acids). His6-rAtGAD1 was then extracted and purified under non-denaturing conditions by following a well established protocol (Astegno et al., 2015; Gut et al., 2009; Trobacher et al., 2013). This includes adding 1 mM PMSF and SigmaFAST PIC to the extraction buffer2, and subjecting the resulting soluble extract to CaM-Sepharose affinity FPLC. This purification yielded 1.8 mg of purified His6-rAtGAD1 having a specific activity of 15.3 ±1.1 units/mg (mean ±SEM of n = 3 determinations) at optimal pH 5.8. However, SDS-PAGE and immunoblotting of the final preparation revealed an approximate 1:1 ratio of anti-GAD and anti-His immunoreactive, and protein-staining polypeptides of 59 and 54 kDa (p59 and p54, respectively) (Fig. 1A-C). This indicates that partial degradation of the p59 to p54 occurred in vitro following His6-rAtGAD1 extraction. The anti-His immunoblots also demonstrate that the N-terminal His6-tag of purified, partially degraded His6-rAtGAD1 subunits (i.e. the p54) remained intact (Fig. 1B, lane 2). Thus, in vitro truncation of p59 to p54 (Fig. 1, lane 2) arises from cleavage of a susceptible peptide bond within the enzyme’s C-terminal region, which encompasses its CaM binding domain (Fig. 2). As the partially degraded His6-rAtGAD1 effectively bound to CaM-Sepharose 4B in the presence of Ca2+, this indicates that at least two rAtGAD1 subunits (i.e. the p59) in the multimeric protein remained intact. AtGAD1’s crystal structure revealed that a highly flexible alpha-helical linker region (residues 449–470) connects its autoinhibitory CaM binding domain (residues 471–502) to the enzyme’s core (Gut et al., 2009). The partial proteolysis that we observed likely occurs near the middle of this flexible linker region; i.e., cleavage of His6-rAtGAD1’s p59 subunits around Gln459 (Fig. 2) would yield the p54. It is notable that a similar protein staining ‘doublet’ was reported following SDS-PAGE of purified His6-rAtGAD1 that had been expressed in E. coli or Sf9 insect cells (Trobacher et al., 2013; Zik et al., 1998). By contrast, evidence of proteolytically truncated His6-rAtGAD1 was not presented in several reports concerning its expression in E. coli BL21 (DE3) pLysS and purification (Astegno et al., 2015; Gut et al., 2009; Turano & Fang, 1998). Nevertheless, potential ‘protease issues’ were alluded to by Turano and Fang (1998) who stated that “Crude protein extracts were assayed at pH 5.8 and not 7.3 because there were problems associated with CaM binding, and the effects of proteases on the CaM-binding domain in these extracts”. Similarly, Trobacher et al. (2013) mentioned that: “Assays of GAD activity and determination of spectral properties were simultaneously conducted as soon as possible after the recombinant protein was extracted to minimize proteolysis that seemed to occur even in the presence of several popular protease inhibitors”.

Fig. 1.
Fig. 1. rAtGAD1 is susceptible to in vitro proteolytic truncation following its heterologous expression in E. coli.

SDS-PAGE was followed by anti-GAD (A, D) or anti-His (B) immunoblotting, or (C) total protein staining with Coomassie Brilliant Blue R-250 (CBB-R250). Lane 1 of panels A-C contains 2 µL of a 10-fold diluted (A, B) or undiluted (C) pET15b-AtGAD1 BL21 CP-RIL extract prepared under denaturing conditions in hot SDS-PAGE sample buffer. Lane 2 of panels A-C contains 50 ng (A, B) or 1 µg (C) of His6-rAtGAD1 extracted under non-denaturing conditions from pET15b-AtGAD1 BL21 CP-RIL cells in presence of 1 mM PMSF and 1X SigmaFAST PIC, and purified via CaM-Sepharose affinity chromatography as previously described (Astegno et al., 2015; Gut et al., 2009; Trobacher et al., 2013). ‘M’ denotes various Mrstandards. (D) Clarified extracts were prepared from pET15b-AtGAD1 BL21 CP-RIL or pLysS cells in 50 mM HEPES-KOH (pH 7.2) containing 150 mM NaCl, 1 mM DTT, 0.1 mM PLP, 1 mM PMSF and 1X SigmaFAST PIC, and incubated at 23 °C. Aliquots were removed at the indicated times and subjected to SDS-PAGE and immunoblotting using anti-GAD (10 µg protein loaded/lane). The ‘+’ lane of panel D contains 2 µL of a 10-fold diluted pET15b-AtGAD1 BL21 CP-RIL extract prepared under denaturing conditions in hot SDS-PAGE sample buffer.

Fig. 2.
Fig. 2. Amino acid sequence alignment of AtGAD1 with its paralogs and several orthologs, highlighting residues and domains critical to GAD function.

The PLP-binding Lys277 residue of AtGAD1 is highlighted in yellow, whereas its conserved Cys166 residue that aligns with the PLP-anchoring Cys168 of Lactobacillus GAD (Huang et al., 2018; Sun et al., 2021) is highlighted in green and marked by an asterisk. The regions corresponding to AtGAD1’s C-terminal CaM-binding domain and its adjacent flexible ‘linker region’ (Gut et al., 2009) are underlined with solid and dotted lines, respectively. A key tryptophan residue of the CaM-binding domain is highlighted in light blue, and flanking CaM-anchoring lysine residues (Snedden et al., 1995) highlighted in dark blue. AtGAD1’s N-terminal phosphoserine residues identified during LC-MS/MS analysis of Pi-resupplied Arabidopsis cell cultures (Mehta et al., 2021) are highlighted in purple. The deduced GAD sequences were aligned using ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index.html). Identical and similar amino acids are indicated by black and grey shading, respectively. Inset: schematic diagram of AtGAD1 functional domains (Gut et al., 2009).

To further assess the apparent inability of PMSF or the SigmaFAST PIC to suppress partial in vitro proteolysis of His6-rAtGAD1 (Fig. 1A-C), clarified extracts from His6-rAtGAD1-expressing E. coli BL21 (DE3) CP-RIL or pLysS cells were prepared in their presence and incubated at 23 °C. Aliquots were removed at 0, 3 and 5 h, boiled in SDS-PAGE sample buffer, and subjected to immunoblotting with anti-GAD. Initially, a prominent immunoreactive p59 corresponding to non-degraded His6-rAtGAD was observed (Fig. 1D). However, incubation at 23 °C led to the progressive disappearance of the p59 and concomitant appearance of the p54, similar to that observed for the purified, partially proteolyzed His6-rAtGAD1 preparation. The combined results of Fig. 1 demonstrate that His6-rAtGAD1 is vulnerable to partial proteolysis of its C-terminal, CaM-binding domain by co-extracted protease activity that: (i) is insensitive to either PMSF, or any of the protease inhibitors present in SigmaFAST PIC tablets, and (ii) occurs irrespective of the particular His6-rAtGAD1expressing E. coli BL21 (DE3) strain being employed (i.e. CP-RIL or pLysS).

3.2 The thiol modifiers 2,2’-dipiridyl disulfide and N-ethylmaleimide block in vitro His6-rAtGAD1 proteolysis, but also abolish its GAD activity

Various class-specific protease inhibitors and commercially available PICs (Supplemental Table S1) were tested for their ability to prevent in vitro proteolysis of His6-rAtGAD1 during incubation of pET15b-AtGAD1 BL21 (DE3) CP-RIL E. coli extracts at 23 °C. As occurred with PMSF and the SigmaFAST PIC (Fig. 1), the following substances were ineffective as judged by anti-GAD immunoblotting of extracts incubated for up to 24 h: 1 mM p-hydroxymecuribenzoate, 1 mM iodoacetamide, 10 µM E-64, 100 µM tosyl phenylalanyl chloromethyl ketone, 100 µM tosyl lysyl chloromethyl ketone, 5 mM 1,10-phenanthroline, 5 mM EDTA, 10 µg/mL leupeptin, 10 µg/mL chymostatin, 10 µg/mL pepstatin A, 5 µL/mL ProteCEASE-100 PIC (G-Biosciences), or 1x Roche Complete PIC tablet (MilliporeSigma) (Supplemental Fig. S2). In contrast, in vitro p59 proteolysis was blocked when E. coli extraction was performed in the presence of the thiol modifiers DPDS (2 mM) or N-ethylmaleimide (NEM) (10 mM) (Fig. 3A; Supplemental Fig. S2). Unlike NEM which is a non-specific thiol modifier (Plaxton, 2019), DPDS was reported to specifically react with active site thiol groups of native, but not denatured, papain or peptidase A (well characterized cysteine proteases from papaya fruit) ((Baines & Brocklehurst, 1982; Brocklehurst & Little, 1973). We therefore extracted His6-rAtGAD1 with 2 mM DPDS, and purified 1.4 mg of the enzyme via Ni2+-affinity FPLC. SDS-PAGE and anti-GAD immunoblotting of the final preparation indicated that the His6-rAtGAD1 was purified to near homogeneity, and that DPDS conferred long-term protection of the enzyme’s p59 subunits to partial in vitro proteolysis (Fig. 3B and 3C). However, spectrophotometric GAD activity assays unexpectedly revealed that the purified, non-proteolyzed His6-rAtGAD1 that had been extracted in presence of 2 mM DPDS was catalytically inactive. We also assessed the impact of 2 mM DPDS or 10 mM NEM inclusion in the extraction buffer on GAD activity in the resulting clarified extracts. DPDS or NEM addition caused a complete loss of GAD activity, as opposed to control extracts prepared in the absence of either reagent that exhibited a GAD specific activity of 0.45 ±0.01 units/mg (mean ±SEM of n = 3 determinations) at pH 5.8.

Fig. 3.
Fig. 3. The thiol modifiers DPDS and NEM prevent in vitro proteolysis of His6-rAtGAD1.

(A) Clarified extracts from pET15b-AtGAD1 BL21 CP-RIL cells were incubated at 23 °C in the absence and presence of 2 mM DPDS or 10 mM NEM. Aliquots were removed at the indicated times and subjected to SDS-PAGE and immunoblotting using anti-GAD (10 µg protein loaded/lane). (B, C) SDS-PAGE and immunoblot analysis of purified, non-proteolyzed His6-rAtGAD1. His6-rAtGAD1 was extracted from pET15b-AtGAD1 BL21 CP-RIL cells in presence of 2 mM DPDS and purified via Ni2+-affinity FPLC as described in the Materials and Methods. SDS-PAGE of 1 µg and 50 ng of the final preparation was respectively followed by (B) protein staining with Coomassie Brilliant Blue G-250 (CBB-G250) and (C) immunoblotting with anti-GAD. The ‘+’ lanes of panels A-C contain 2 µL of a 10-fold diluted pET15b-AtGAD1 BL21 CP-RIL extract prepared under denaturing conditions in hot SDS-PAGE sample buffer, whereas ‘M’ denotes various Mr standards.

These results indicate that DPDS and NEM modified a key sulfhydryl group of His6-rAtGAD1 that is essential for catalytic activity, resulting in inactivation. This is supported by the observation that thiol-directed reagents inactivate a purified potato GAD (Satyanarayan & Nair, 1985). Furthermore, structural studies revealed that Cys168 participates in anchoring the PLP cofactor to the active site of Lactobacillus brevis GAD, thereby supporting catalytic activity (Huang et al., 2018). Sequence alignment indicated that Cys166 may be the site of rAtGAD1 modification in the presence of DPDS or NEM, since it aligns with Cys168 of the Lactobacillus GAD, while being conserved in AtGAD1’s paralogs and orthologs (Fig. 2). Although DPDS-inactivated papain or peptidase A could be reactivated following treatment with 50 mM β-mercaptoethanol at pH 8.0 (Baines & Brocklehurst, 1982; Brocklehurst & Little, 1973), we were unable to recover any GAD activity following incubation of the purified, DPDS-treated His6-rAtGAD1 with 50 mM β-mercaptoethanol or 10 mM DTT for up to 30 min at pH 8.0 and 23 °C.

3.3. Ca2+/CaM addition blocks in vitro proteolytic truncation of His6-rAtGAD1

As the C-terminal CaM-binding domain of His6-rAtGAD1 is prone to truncation by co-extracted E. coli protease activity (Fig. 1), and ligand addition can protect certain enzymes from in vitro proteolysis (Plaxton, 2019), we assessed whether Ca2+/CaM addition to the extraction buffer might be an effective strategy to obtain non-proteolyzed, active His6-rAtGAD1. Structural studies show that Ca2+/CaM activates AtGAD1 in a distinctive way by relieving two C-terminal autoinhibitory domains of adjacent active sites, forming a 393 kDa AtGAD1–CaM heterohexameric complex with an unusual 1:3 CaM:AtGAD1 stoichiometry (Gut et al., 2009).

Anti-GAD immunoblotting demonstrated that in vitro p59 proteolysis was largely nullified when pET15b-AtGAD1 BL21 CP-RIL E. coli cells were co-extracted with an equivalent amount of pET5a-CaM81 BL21 pLysS cells and 1 mM CaCl2, and the resulting clarified extract incubated at 23 °C for up to 5 h (Fig. 4A). SDS-PAGE and anti-GAD immunoblotting of His6-rAtGAD1 extracted and purified via Ni2+-affinity FPLC in the presence of Ca2+/CaM81 revealed a single prominent protein-staining and immunoreactive p59 (Fig. 4B and 4C). This indicates that the His6-rAtGAD1 was purified to near homogeneity, and that its co-extraction and purification in the presence of CaM81-expressing E. coli cells and CaCl2 is an efficient approach to impede its proteolytic truncation. This purification yielded 2.3 mg of non-proteolyzed His6-rAtGAD1 having a specific activity of 26.6 ±1.1 units/mg (mean ±SEM of n = 3 determinations) at pH 5.8 (Fig. 5). Anti-CaM immunoblotting confirmed the presence of a 15 kDa immunoreactive CaM81 polypeptide (lacks His-tag) in the Ni2+-affinity FPLC-purified His6-rAtGAD1 preparation (Fig. 4D).

Fig. 4.
Fig. 4. Ca2+/CaM addition inhibits proteolytic truncation of His6-rAtGAD1.

Equivalent amounts of pET15b-AtGAD1 BL21 CP-RIL and pET5a-CaM81 BL21 pLysS cells were co-extracted in the presence of 1 mM CaCl2. (A) The clarified extract was incubated at 23 ℃, and aliquots removed at the indicated times and subjected to SDS-PAGE and immunoblotting using anti-GAD (10 µg protein loaded/lane). (B-D) The His6-rAtGAD1:CaM81 complex was purified via Ni2+-affinity FPLC and analyzed by SDS-PAGE followed by: (B) Coomassie Brilliant Blue R-250 (CBB R-250) protein staining (1 µg/lane), and immunoblotting with (C) anti-GAD (50 ng/lane) or (D) anti-CaM (200 ng/lane). The ‘+’ lanes of panels A-C denote non-proteolyzed His6-rAtGAD1 (100 ng for panel A, 1 µg for panel B, 50 ng for panel C) extracted in the presence of 2 mM DPDS and purified via Ni2+-affinity FPLC, whereas the ‘+’ lane of panel D was purified recombinant Arabidopsis CaM7 (50 ng) (Vanderbeld & Snedden, 2007). ‘M’ of panels B and D denotes various Mr standards. The SDS-PAGE resolving gel acrylamide concentration was increased from 10 to 15% for the anti-CaM immunoblot shown in panel D.

Fig. 5.
Fig. 5. Partial proteolysis reduces the activity and Ca2+/CaM sensitivity of His6-rAtGAD1.

Spectrophotometric (GABase coupled) activity assays were conducted as outlined in the Materials and Methods with 130 and 260 ng of non-proteolyzed and partially proteolyzed rAtGAD1, respectively, at pH 5.8 and pH 7.3. Ca2+/CaM-sensitivity was tested at pH 7.3 by the addition 1 µM petunia CaM81 in the presence of either 1 mM CaCl2 (+Ca2+/+CaM) or 5 mM EGTA (-Ca2+/+CaM). Proteolyzed and non-proteolyzed His6-rAtGAD1 respectively correspond to the final preparations shown in Fig. 1A-C and Fig. 4B and C. All values represent mean ±SEM of n = 3 separate assays; different letters indicate significant differences (p < 0.05; two-way ANOVA) between the proteolyzed and non-proteolyzed rAtGAD1 preparations.

3.4. Partial proteolysis reduces the activity and Ca2+/CaM sensitivity of purified His6-rAtGAD1

Activities of purified partially proteolyzed and non-proteolyzed His6-rAtGAD1 were compared at optimal pH 5.8, and at pH 7.3 in the presence of 0.1 µM petunia CaM81 ±1 mM CaCl2 (Fig. 5). Partial in vitro proteolysis of p59 to p54 His6-rAtGAD1 subunits (Fig. 1) significantly reduced the enzyme’s specific activity at both pH values by at least 40%. Furthermore, although both preparations were activated by Ca2+/CaM at pH 7.3, this was significantly more pronounced for non-proteolyzed relative to the partially proteolyzed His6-rAtGAD1 which were respectively activated 283 ±19% and 202 ±14% (means ±SEM of n = 3 determinations) by Ca2+/CaM, relative to control assays containing CaM that lacked Ca2+ (Fig. 5).

4. Concluding remarks

The detection and prevention of proteolysis during native or recombinant enzyme purification is a concern for all biochemists, particularly when the enzyme of interest has been only partially degraded and retains catalytic activity. Limited proteolysis can result in erroneous conclusions regarding an enzyme’s kinetic and regulatory properties, as documented in the current manuscript (Fig. 5) and numerous prior studies (Plaxton, 2019). The E. coli BL21 (DE3) strain employed in the present study is widely used for recombinant protein expression owing to its deficiency in the cytoplasmic serine protease lon, and the outer membrane aspartyl protease ompT, which may help reduce proteolysis of the target protein (Francis & Page, 2010). However, a co-extracted E. coli cysteine endopeptidase appears to be responsible for the in vitro truncation of an approximate 5 kDa polypeptide from the C-terminus of His6-rAtGAD1’s p59 subunits, since this was prevented when extraction was performed in the presence of the thiol modifiers NEM or DPDS (Fig. 3). NEM irreversibly and non-specifically alkylates protein thiol groups, including active site thiol groups of cysteine proteases such as papain and papain-like proteases (Clementz et al., 2010; Nakajima et al., 1991; Saha et al., 2018). Inactivation of His6-rAtGAD1 by NEM was not surprising since prior studies have established the requirement of a key thiol group for plant and microbial GAD catalysis (Huang et al., 2018; Satyanarayan & Nair, 1985). However, His6-rAtGAD1 inactivation by DPDS was quite unexpected since unlike NEM, DPDS was reported to function as a substrate analogue that specifically results in covalent (thiopyridone) modification of active site thiol groups of native, but not denatured, papain or peptidase A from papaya fruit (Baines & Brocklehurst, 1982; Brocklehurst & Little, 1973). DPDS has since been successfully employed to block partial proteolysis of active allosteric regulatory enzymes from various plant and green algal sources (e.g., phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, pyruvate kinase) by co-extracted cysteine endopeptidase activity (Martín et al., 2007; Plaxton, 2019). However, the current results indicate that caution should be exerted using DPDS as a routine cysteine protease inhibitor since it can apparently not only modify thiol groups at the active site of ‘papain-like’ cysteine proteases, but can also modify thiol groups of the target enzyme being investigated. As DPDS simultaneously inactivated His6-rAtGAD1 while protecting the enzyme from proteolysis (Fig. 3), it will be interesting to assess the intriguing possibility that p59 to p54 conversion arises from AtGAD1 autoproteolytic activity, as opposed to a co-extracted E. coli cysteine endopeptidase. Autoproteolysis is a known regulatory mechanism for certain enzymes, allowing them to switch between active and inactive states or to modulate their activity in response to specific cellular signals or environmental conditions.

Extraction and Ni2+-affinity FPLC in the presence of Ca2+/CaM81 proved to be an unconventional, yet effective strategy for the isolation of non-proteolyzed and catalytically active His6-rAtGAD1 (Figs. 4 and 5). These results are expected to facilitate studies of the mechanisms and functions of multisite AtGAD1phosphorylation (Mehta et al., 2021; Raytek, 2022). Purified His6-rAtGAD1 could be employed as a substrate for assaying and characterizing the protein kinase that phosphorylates AtGAD1 following Pi resupply to Pi-starved Arabidopsis suspension cells (Mehta et al., 2019). Moreover, comparing the kinetic and regulatory properties of non-proteolyzed wild-type His6-rAtGAD1 with the corresponding site-directed phosphomimetic mutant could provide invaluable information on the functions of in vivo multisite AtGAD1 phosphorylation. This may, in turn, expedite biotechnological approaches to bioengineer Pi-efficient crops, promoting agricultural sustainability and ecosystem preservation, while contributing to future food security.

Footnotes

  • ↵1 Abbreviations: CaM, calmodulin; CP-RIL; CodonPlus-RIL; DPDS, 2,2′-dipyridyl disulfide; DTT, dithiothreitol; FPLC, fast protein liquid chromatography; GABA, γ-aminobutyrate; GAD, glutamate decarboxylase; IPTG, isopropyl β-d-1-thiogalactopyranoside; LB, Luria Bertani; NEM, N-ethylmaleimide; p54 and p59, 55 and 59 kDa polypeptides, respectively; PIC, protease inhibitor cocktail; PLP, pyridoxal-5’-phosphate; PMSF, phenylmethylsulfonyl fluoride; rAtGAD1, recombinant Arabidopsis GAD1.

  • ↵2 PMSF irreversibly inactivates serine and certain cysteine proteases (Plaxton, 2019), whereas the SigmaFAST PIC is intended to inhibit serine, cysteine, aspartic and metalloproteases as it contains 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride, bestatin, L-(trans)-epoxysuccinyl-leucylamido (4-guanidino) butane (E-64), pepstatin A, phosphoramidon, leupeptin, and aprotinin.

LITERATURE CITED

  1. ↵
    Arazi, T., Baum, G., Snedden, W. A., Shelp, B. J., & Fromm, H. (1995). Molecular and biochemical analysis of calmodulin interactions with the calmodulin-binding domain of plant glutamate decarboxylase. Plant Physiology, 108, 551–561.
    OpenUrlAbstract
  2. ↵
    Astegno, A., Capitani, G., & Dominici, P. (2015). Functional roles of the hexamer organization of plant glutamate decarboxylase. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics, 1854, 1229–1237. doi:10.1016/j.bbapap.2015.01.001
    OpenUrlCrossRef
  3. ↵
    Baines, B. S., & Brocklehurst, K. (1982). Characterization of papaya peptidase A as a cysteine proteinase of Carica papaya L. with active-centre properties that differ from those of papain by using 2,2′-dipyridyl disulphide and 4-chloro-7-nitrobenzofurazan as reactivity probes. Use of two-protonic-state electrophiles in the identification of catalytic-site thiol groups. Biochemical Journal, 205, 205–211. doi:10.1042/bj2050205
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Baum, G., Chen, Y., Arazi, T., Takatsuji, H., & Fromm, H. (1993). A plant glutamate decarboxylase containing a calmodulin binding domain. Cloning, sequence, and functional analysis. Journal of Biological Chemistry, 268, 19610–19617. doi:10.1016/s0021-9258(19)36560-3
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Baum, G., Lev-Yadun, S., Fridmann, Y., Arazi, T., Katsnelson, H., Zik, M., & Fromm, H. (1996). Calmodulin binding to glutamate decarboxylase is required for regulation of glutamate and GABA metabolism and normal development in plants. The EMBO Journal, 15, 2988–2996. doi:10.1002/j.1460-2075.1996.tb00662.x
    OpenUrlCrossRefPubMedWeb of Science
  6. ↵
    Benidickson, K. H., Raytek, L. M., Hoover, G. J., Flaherty, E. J., Shelp, B. J., Snedden, W. A., & Plaxton, W. C. (2023). Glutamate decarboxylase-1 is essential for efficient acclimation of Arabidopsis thaliana to nutritional phosphorus deprivation. New Phytologist, 240, 2372–2385. doi:10.1111/nph.19300
    OpenUrlCrossRef
  7. ↵
    Bouché, N., Fait, A., Bouchez, D., Moller, S. G., & Fromm, H. (2003). Mitochondrial succinic-semialdehyde dehydrogenase of the γ-aminobutyrate shunt is required to restrict levels of reactive oxygen intermediates in plants. Proceedings of the National Academy of Sciences, 100, 6843–6848. doi:10.1073/pnas.1037532100
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Bouché, N., Fait, A., Zik, M., & Fromm, H. (2004). The root-specific glutamate decarboxylase (GAD1) is essential for sustaining GABA levels in Arabidopsis. Plant Molecular Biology, 55, 315–325. doi:10.1007/s11103-004-0650-z
    OpenUrlCrossRefPubMedWeb of Science
  9. ↵
    Brocklehurst, K., & Little, G. (1973). Reactions of papain and of low-molecular-weight thiols with some aromatic disulphides. 2,2′-dipyridyl disulphide as a convenient active-site titrant for papain even in the presence of other thiols. Biochemical Journal, 133, 67–80. doi:10.1042/bj1330067
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Che-Othman, M. H., Jacoby, R. P., Millar, A. H., & Taylor, N. L. (2020). Wheat mitochondrial respiration shifts from the tricarboxylic acid cycle to the GABA shunt under salt stress. New Phytologist, 225, 1166–1180. doi:10.1111/nph.15713
    OpenUrlCrossRef
  11. ↵
    Clementz, M. A., Chen, Z., Banach, B. S., Wang, Y., Sun, L., Ratia, K., Baez-Santos, Y. M., Wang, J., Takayama, J., Ghosh, A. K., Li, K., Mesecar, A. D., & Baker, S. C. (2010). Deubiquitinating and interferon antagonism activities of coronavirus papain-like proteases. Journal of Virology, 84, 4619–4629. doi:10.1128/JVI.02406-09
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Francis, D. M., & Page, R. (2010). Strategies to optimize protein expression in E. coli. Curr Protoc Protein Sci, 61, 5241–52429. doi:10.1002/0471140864.ps0524s61
    OpenUrlCrossRef
  13. ↵
    Fromm, H., & N.-H. C. (1992). Cloning of plant cDNAs encoding calmodulin binding proteins using 35S-labeled recombinant calmodulin as a probe. Plant Molecular Biology Reporter, 10, 199–206.
    OpenUrlCrossRef
  14. ↵
    Green, M. R., & Sambrook, J. (2012). Molecular cloning: a laboratory manual (4th ed ed., Vol. 1). Cold Spring Harbor Laboratory Press.
  15. ↵
    Gut, H., Dominici, P., Pilati, S., Astegno, A., Petoukhov, M. V., Svergun, D. I., Grütter, M. G., & Capitani, G. (2009). A common structural basis for pH- and calmodulin-mediated regulation in plant glutamate decarboxylase. Journal of Molecular Biology, 392, 334–351. doi:10.1016/j.jmb.2009.06.080
    OpenUrlCrossRefPubMed
  16. ↵
    Huang, J., Fang, H., Gai, Z. C., Mei, J. Q., Li, J. N., Hu, S., Lv, C. J., Zhao, W. R., & Mei, L. H. (2018). Lactobacillus brevis CGMCC 1306 glutamate decarboxylase: Crystal structure and functional analysis. Biochem Biophys Res Commun, 503, 1703–1709. doi:10.1016/j.bbrc.2018.07.102
    OpenUrlCrossRef
  17. ↵
    Joshi, J., Folz, J. S., Gregory, J. F., McCarty, D. R., Fiehn, O., & Hanson, A. D. (2019). Rethinking the PDH bypass and GABA shunt as thiamin-deficiency workarounds. Plant Physiology, 181, 389–393. doi:10.1104/pp.19.00857
    OpenUrlFREE Full Text
  18. ↵
    Martín, M., Plaxton, W. C., & Podestá, F. E. (2007). Activity and concentration of non-proteolyzed phosphoenolpyruvate carboxykinase in the endosperm of germinating castor oil seeds: effects of anoxia on its activity. Physiologia Plantarum, 130, 484–494. doi:10.1111/j.1399-3054.2007.00917.x
    OpenUrlCrossRef
  19. ↵
    Mehta, D., Ghahremani, M., Pérez-Fernández, M., Tan, M., Schläpfer, P., Plaxton, W. C., & Uhrig, R. G. (2021). Phosphate and phosphite have a differential impact on the proteome and phosphoproteome of Arabidopsis suspension cell cultures. The Plant Journal, 105, 924–941. doi:10.1111/tpj.15078
    OpenUrlCrossRef
  20. ↵
    Mekonnen, D. W., Flugge, U. I., & Ludewig, F. (2016). Gamma-aminobutyric acid depletion affects stomata closure and drought tolerance of Arabidopsis thaliana. Plant Sci, 245, 25–34. doi:10.1016/j.plantsci.2016.01.005
    OpenUrlCrossRef
  21. ↵
    Miyashita, Y., & Good, A. G. (2008). Contribution of the GABA shunt to hypoxia-induced alanine accumulation in roots of Arabidopsis thaliana. Plant and Cell Physiology, 49, 92–102. doi:10.1093/pcp/pcm171
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Nakajima, T., Kaibara, M., Irisawa, H., & Giles, W. (1991). Inhibition of the muscarinic receptor-activated K+ current by N-ethylmaleimide in rabbit heart. Naunyn-Schmiedeberg’s Arch Pharmacol 343, 14–19.
    OpenUrlPubMedWeb of Science
  23. ↵
    Plaxton, W. C. (2019). Avoiding proteolysis during the extraction and purification of active plant enzymes. Plant and Cell Physiology, 60, 715–724. doi:10.1093/pcp/pcz028
    OpenUrlCrossRef
  24. ↵
    Plaxton, W. C., & Preiss, J. (1987). Purification and properties of nonproteolytic degraded ADPglucose pyrophosphorylase from maize endosperm. Plant Physiology, 83, 105–112.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Raytek, L.-M. (2022). What is the role of phosphorylation of the Ca2+/calmodulin-dependent glutamate decarboxylase isozyme, AtGAD1, in response to phosphate nutrition of Arabidopsis thaliana? [MSc, Queen’s University].
  26. ↵
    Rossignoli, G., Phillips, R. S., Astegno, A., Menegazzi, M., Voltattorni, C. B., & Bertoldi, M. (2018). Phosphorylation of pyridoxal 5′-phosphate enzymes: an intriguing and neglected topic. Amino Acids, 50, 205–215. doi:10.1007/s00726-017-2521-3
    OpenUrlCrossRef
  27. ↵
    S, R. M., Bedair, M. F., Li, H., & Duff, S. M. G. (2021). Phenotypic effects from the expression of a deregulated AtGAD1 transgene and GABA pathway suppression mutants in maize. PLOS ONE, 16, e0259365. doi:10.1371/journal.pone.0259365
    OpenUrlCrossRef
  28. ↵
    Saha, A., Acharya, B. N., Priya, R., Tripathi, N. K., Shrivastava, A., Rao, M. K., Kesari, P., Narwal, M., Tomar, S., Bhagyawant, S. S., Parida, M., & Dash, P. K. (2018). Development of nsP2 protease based cell free high throughput screening assay for evaluation of inhibitors against emerging Chikungunya virus. Scientific Reports, 8, 10831. doi:10.1038/s41598-018-29024-2
    OpenUrlCrossRef
  29. ↵
    Satyanarayan, V., & Nair, P. M. (1985). Purification and characterization of glutamate decarboxylase from Solanum tuberosum. European Journal of Biochemistry, 150, 53–60. doi:10.1111/j.1432-1033.1985.tb08987.x
    OpenUrlCrossRefPubMed
  30. ↵
    Shelp, B. (1999). Metabolism and functions of gamma-aminobutyric acid. Trends in Plant Science, 4, 446–452. doi:10.1016/S1360-1385(99)01486-7
    OpenUrlCrossRefPubMedWeb of Science
  31. ↵
    Shelp, B. J., Bozzo, G. G., Trobacher, C. P., Chiu, G., & Bajwa, V. S. (2012). Strategies and tools for studying the metabolism and function of γ-aminobutyrate in plants. I. Pathway structure. Botany, 90, 651–668. doi:10.1139/b2012-030
    OpenUrlCrossRefWeb of Science
  32. ↵
    Snedden, W. A., Arazi, T., Fromm, H., & Shelp, B. J. (1995). Calcium/calmodulin activation of soybean glutamate decarboxylase. Plant Physiology, 108, 543–549.
    OpenUrlAbstract
  33. ↵
    Su, N., Wu, Q., Chen, J., Shabala, L., Mithofer, A., Wang, H., Qu, M., Yu, M., Cui, J., & Shabala, S. (2019). GABA operates upstream of H+-ATPase and improves salinity tolerance in Arabidopsis by enabling cytosolic K+ retention and Na+ exclusion. J Exp Bot, 70, 6349–6361. doi:10.1093/jxb/erz367
    OpenUrlCrossRef
  34. ↵
    Teresinski, H. J., Hau, B., Symonds, K., Kilburn, R., Munro, K. A., Doner, N. M., Mullen, R., Li, V. H., & Snedden, W. A. (2023). Arabidopsis calmodulin-like proteins CML13 and CML14 interact with proteins that have IQ domains. Plant Cell Environ, 46, 2470–2491. doi:10.1111/pce.14616
    OpenUrlCrossRef
  35. ↵
    Trobacher, C. P., Zarei, A., Liu, J., Clark, S. M., Bozzo, G. G., & Shelp, B. J. (2013). Calmodulin-dependent and calmodulin-independent glutamate decarboxylases in apple fruit. BMC Plant Biology, 13, 144. doi:10.1186/1471-2229-13-144
    OpenUrlCrossRefPubMed
  36. ↵
    Turano, F. J., & Fang, T. K. (1998). Characterization of two glutamate decarboxylase cDNA clones from Arabidopsis. Plant Physiology, 117, 1411–1421. doi:10.1104/pp.117.4.1411
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Zik, M., Arazi, T., Snedden, W. A., & Fromm, H. (1998). Two isoforms of glutamate decarboxylase in Arabidopsis are regulated by calcium/calmodulin and differ in organ distribution. 37, 967–975.
    OpenUrl
Back to top
Posted April 11, 2024.
Download PDF

Supplementary Material

Email
Heterologous expression and purification of glutamate decarboxylase-1 from the model plant Arabidopsis thaliana: characterization of the enzyme’s in vitro truncation by thiol endopeptidase activity
Brittany S. Menard, Kirsten H. Benidickson, Lee Marie Raytek, Wayne A. Snedden, William C. Plaxton
bioRxiv 2024.04.11.589046; doi: https://doi.org/10.1101/2024.04.11.589046
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area