Abstract
SUMMARY Ionizing radiation stimulates nuclear accumulation of Abl tyrosine kinase that is required for directly irradiated cells to produce microRNA-34c-containing extracellular vesicles, which transfer the microRNA into non-irradiated cells to induce reactive oxygen species and bystander DNA damage.
ABSTRACT Ionizing radiation (IR) activates an array of DNA damage response (DDR) that includes the induction of bystander effects (BE) in cells not targeted by radiation. How DDR pathways in irradiated cells stimulate BE in non-targeted cells is mostly unknown. We show here that extracellular vesicles from irradiated cells (EV-IR) induce reactive oxygen species (ROS) and DNA damage when internalized by un-irradiated cells. We found that EV-IR from Abl-NLS-mutated cells could not induce ROS or DNA damage, and restoration of nuclear Abl rescued those defects. Expanding a previous finding that Abl stimulates miR-34c expression, we show here that nuclear Abl also drives the vesicular secretion of miR-34c. Ectopic miR-34c expression, without irradiation, generated EV-miR-34c capable of inducing ROS and DNA damage. Furthermore, EV-IR from miR34-knockout cells could not induce ROS and raised γH2AX to lesser extent than EV-IR from miR34-wild type cells. These results establish a novel role for the Abl-miR-34c DDR pathway in stimulating radiation-induced bystander effects.
INTRODUCTION
In multicellular organisms, ionizing radiation (IR) causes breakage of cellular DNA to activate a wide range of responses not only in directly irradiated cells but also in neighboring or distant cells not targeted by IR (Mukherjee et al., 2014; Prise and O’Sullivan, 2009; Verma and Tiku, 2017). The non-target, or bystander, effects of IR occur when irradiated cells secrete soluble factors and/or extracellular vesicles (EV) to propagate the damage signal to naïve, non-irradiated cells (Jelonek et al., 2016; Mukherjee et al., 2014; Prise and O'Sullivan, 2009; Verma and Tiku, 2017). The master regulators of DNA damage response (DDR), i.e., ATM and p53, are required for irradiated cells to secrete bystander effectors (Burdak-Rothkamm et al., 2008; Komarova et al., 1998); however, how other DDR pathways stimulate the bystander effects of radiation is mostly unknown.
Previous studies have established that IR stimulates nuclear Abl tyrosine kinase to regulate transcription, DNA repair and microRNA processing (Baskaran et al., 1997; Kaidi and Jackson, 2013; Preyer et al., 2007; Shaul and Ben-Yehoyada, 2005; Tu et al., 2015; Wang, 2014). The ubiquitously expressed Abl has many context-dependent biological functions that are determined by its activating signals, its interacting proteins and its subcellular localization (Wang, 2014). Because DNA damage signal initiates in the nucleus, we investigate how nuclear Abl regulates DDR. Towards this goal, we mutated the three nuclear localization signals (NLS) in the mouse Abl1 gene to create the Abl-µNLS (µ) allele (Preyer et al., 2007). We found that cisplatin-induced apoptosis was reduced in the Ablµ/µ embryonic stem cells and in the renal proximal tubule epithelial cells (RPTC) of the Ablµ/µ mice (Preyer et al., 2007; Sridevi et al., 2013), providing in vivo confirmation for the in vitro finding that cisplatin activates Abl to stimulate p73-mediated and p53-independent apoptosis in human colon cancer cells (Gong et al., 1999). To identify other nuclear Abl-stimulated pro-apoptotic factors, we searched for and found that Abl kinase stimulates the processing of precursor miR-34c, and that the induction of miR-34c by cisplatin is defective in Abl-µNLS mice (Tu et al., 2015). The transcription of primary miR-34a and miR-34b/c is stimulated by p53 (He et al., 2007a); however, p53-dependent apoptotic response to DNA damage is not affected by the knockout of all three members (a, b, c) of the miR-34-family (Concepcion et al., 2012). These mouse genetics results propelled us to consider alternative functions for the Abl-miR34c pathway in DDR.
It has been shown that extracellular vesicles (EV) can transfer microRNAs between cells (Tkach and Thery, 2016; Valadi et al., 2007). Recent results have suggested that EV and microRNA are involved in the communication between irradiated and bystander cells (Chaudhry, 2014; Jelonek et al., 2016). Therefore, we investigated the role of nuclear Abl and miR-34c in EV-mediated bystander effects of radiation.
RESULTS
Isolation and Characterization of Extracellular Vesicles (Fig. 1):
We isolated extracellular vesicles (EV) by differential ultracentrifugation of media conditioned by non-irradiated (C) or irradiated (IR, 10 Gy) mouse embryo fibroblasts (MEFs) and avoided EV from serum by switching cells into serum-free media with 1% BSA before irradiation (Fig. 1A). The total protein content of EV-C and EV-IR was found to be comparable among several independent preparations, showing that IR did not affect the total yield of protein in the EV pellets (Fig. 1C). Nanoparticle tracking analyses showed similar size distributions and particle concentrations among EV preparations from media conditioned by non-irradiated (EV-C) or irradiated (EV-IR) MEFs (Fig. 1B). As the particles ranged from 50 nm to 300 nm in diameter, these EV preparations were likely to contain a mixture of micro-vesicles derived from different intracellular compartments (Cocucci et al., 2009). When added to naïve, non-irradiated responder MEFs, fluorescent-labeled EV-C and EV-IR were internalized by 98-100% of cells at 24 hours (Fig. 1D) and to comparable intracellular levels (Fig. 1E). Thus, the differential response of non-irradiated MEFs to EV-C and EV-IR was unlikely to be due to differential uptake of these vesicles.
EV-IR but not EV-C Inhibited Colony Formation (Fig. 2; Figs. S1, S2)
Inhibition of colony formation is both a direct and a bystander effect of ionizing radiation, for media conditioned by irradiated MEFs (CM-IR) inhibited colony formation when transferred to non-irradiated responder MEFs (Fig. 2A; Fig. S1A). We found that the EV-fraction retained the colony-inhibitory activity of CM-IR whereas the supernatant fraction lost most of that activity (Fig. 2A). Titration experiments showed that EV-IR inhibited colony formation in a dose-dependent manner, reaching saturation at a EV-protein level (25 µg) that was equivalent to several million particles per responder cell (Fig. 2C; Fig. S1C). By contrast, EV-C did not elicit such a dose-response (Fig. 2B; Fig. S1B). We then compared the growth inhibitory activity of IR vs. EV-IR. As expected, direct irradiation of MEFs induced p21Cip1 mRNA and protein (Fig. S2A-D), G2 arrest (Fig. S2E, F), and senescence (Fig. S2G, H). However, treatment with EV-IR did not induce p21Cip1 (Fig. S2A, B), G2 arrest (Fig. S2E, F), or senescence (Fig. S2G, H). These results showed that the colony-inhibitory mechanism of EV-IR differed from that of direct irradiation. Although immortal, the responder MEFs formed colonies at a low frequency of ~5%. It thus appeared that EV-IR inhibited a small fraction of colony-forming cells without causing growth arrest in the general population of responder cells that internalized EV-IR (Fig. 1D).
EV-IR but not EV-C Increased Reactive Oxygen Species (ROS) (Fig. 3; Fig. S3)
IR induces ROS in directly irradiated and non-irradiated bystander cells (Azzam et al., 2012; Klammer et al., 2015). We found that EV-IR, but not EV-C, dose-dependently increased the ROS levels in non-irradiated MEFs (Fig. 3A, B). This EV-IR-induced ROS occurred in the general population of responder cells (Fig. S3D) and was detectable at a EV-IR protein level (3.7 µg) that was equivalent to several hundred thousand particles per responder cell (Fig. 3B). The anti-oxidant N-acetyl-cysteine (NAC) neutralized EV-IR-induced ROS increase (Fig. 3A, EV-IR+NAC; Fig. S3D). NAC also reduced the colony inhibitory activity of EV-IR (Fig. 3C; Fig. S1D), suggesting that ROS was a contributing factor to EV-IR-induced inhibition of colony formation. Treatment with Proteinase K or RNase A did not abolish either the colony-inhibitory or the ROS-inducing activity of EV-IR (Fig. S3E), indicating that these effects were mediated by factors inside the vesicles.
EV-IR but not EV-C Increased γH2AX and RAD51 Foci (Fig. 3; Fig. S3)
Another bystander effect of radiation is the induction of DNA damage in non-irradiated cells (Klammer et al., 2010; Lorimore et al., 2003). We found that addition of EV-IR, but not EV-C, induced γH2AX foci in the non-irradiated responder MEFs (Fig. 3D; Fig. S3C). Quantification of images showed a range of γH2AX levels in MEFs (Fig. S3B, C). Treatment with EV-IR, but not EV-C, raised this range of γH2AX levels in the majority of responder cells (Fig. 3D; Fig. S3B, C). In side-by-side comparisons, we found that IR-induced γH2AX levels to be 2-fold higher than that induced by EV-IR (Fig. S3A, B). Although NAC blocked EV-IR-induced increase in ROS (Fig. 3A; Fig S3D), it did not block the EV-IR effect on γH2AX (Fig. 3D; Fig. S3C), indicating that ROS was not required for EV-IR to stimulate H2AX phosphorylation. Treatment with EV-IR also increased RAD51-foci in non-irradiated MEFs (Fig. 3E, F; Fig. S3F, G). We scored the RAD51-foci by visual inspection and separated the responder MEFs into two categories. The majority of responders (60-70%) showed lower nuclear RAD51-signal (category-1) (Fig. 3E; Fig. S3G); and among category-1 cells, 20% or 4% were positive for RAD51 foci after treatment with EV-IR or EV-C, respectively (Fig. 3F; Fig. S3F). Among category-2 cells that showed higher nuclear RAD51-signal (Fig. 3E; Fig. S3G), 90% or 55% were positive for RAD51-foci after treatment with EV-IR or EV-C, respectively (Fig. 3F; Fig. S3F). These results showed that EV-IR could induce bystander DNA damage in non-irradiated cells. Because EV-IR-induced increases in ROS and γH2AX occurred in a substantial population of responder cells that internalized these vesicles, we focused subsequent studies on these two bystander effects.
Nuclear Abl not Required for Radiation to Induce ROS and γH2AX (Fig. 4)
To determine the essential function of nuclear Abl in DDR, we constructed the Abl-µNLS allele in the mouse Abl1 gene by mutating the three nuclear localization signals (NLS) in the Abl protein (Fig. 4A) (Preyer et al., 2007). We then established embryo fibroblasts (MEFs) from littermate Abl+/+ (Abl-wt) and Ablµ/µ (Abl-µNLS) mice through serial passages in culture. Irradiation of Abl-wt MEFs induced nuclear accumulation of Abl, whereas irradiation of Abl-µNLS MEFs did not induce nuclear accumulation of Abl-µNLS (Fig. 4B). Thus, mutation of the NLS is sufficient to abolish IR-induced Abl nuclear accumulation. However, IR still increased ROS and γH2AX in the Abl-µNLS MEFs (Fig. 4C-F), showing that nuclear Abl is not required for IR to cause these effects in directly irradiated MEFs.
Nuclear Abl Required for ROS- and γH2AX-Inducing Activities of EV-IR (Figs. 4, 5, 6)
Although IR induced ROS and γH2AX in directly irradiated Abl-µNLS MEFs, we found that EV from irradiated Abl-µNLS MEFs (µEV-IR) did not induce ROS (Fig. 4G, H) or increase γH2AX (Fig. 4I, J) in responder MEFs (Abl-wt). To determine if restoration of nuclear Abl could rescue these µEV-IR defects, we stably expressed AblWT or AblµNLS proteins in Abl-µNLS MEFs through retroviral-mediated gene transfer (Fig. 5A) without significantly raising the overall levels of Abl protein (Fig. 5B). After irradiation (10 Gy IR), we found nuclear accumulation of AblWT but not AblµNLS in the Abl-µNLS MEFs (Fig. 5C). The expression of AblWT or AblµNLS did not alter the direct effects of IR in the Abl-µNLS MEFs (Fig. 5D-G), again showing that nuclear Abl did not make significant contributions to ROS and γH2AX in irradiated MEFs. However, expression of AblWT but not AblµNLS restored the ROS-and γH2AX-inducing activities of µEV-IR (Fig. 6). Together, these results establish that nuclear entry of Abl in irradiated cells is required for the formation of EV-IR with ROS-and γH2AX-inducing activities.
Abl Kinase Inhibitor Abolished the ROS- and γH2AX-Inducing Activities of EV-IR (Fig. 7)
Ionizing radiation not only induces Abl nuclear accumulation but it also activates Abl kinase activity (Baskaran et al., 1997; Kaidi and Jackson, 2013). To assess the role of Abl kinase, we pre-treated MEFs with the Abl kinase inhibitor imatinib before irradiation (Fig. 7A) and compared the bystander effects of EV-IR with EV-(IM+IR). We found that the ROS-and γH2AX-inducing activities of EV-(IM+IR) were significantly reduced when compared to EV-IR (Fig. 7B-E). Thus, Abl kinase activity is also required for irradiated cells to produce EV-IR with ROS-and γH2AX-inducing activities.
Nuclear Abl Raised miR-34c Levels in EV-IR for Transfer into Responder Cells (Fig. 8)
IR stimulates the expression of many miRs in directly irradiated cells (Chaudhry, 2014; He et al., 2007a). We have previously shown that Abl kinase stimulates the processing of pri-miR34b/c to pre-miR-34b and pre-miR-34c (Tu et al., 2015). Since the majority of intracellular miRs are found in EV (Shurtleff et al., 2016), we measured the levels of miR-34c in MEFs and in EV. With Abl-wt MEFs, irradiation increased the intracellular miR-34c by 3-fold (Fig. 8A), and the EV-IR miR-34c by 20-fold (Fig. 8D). With Abl-µNLS MEFs, radiation increased the intracellular miR-34c by 2-fold (Fig. 8B). However, this 2-fold intracellular increase did not raise the miR-34c levels in µEV-IR (Fig. 8E). In the responder MEFs, we found a 2-fold increase in miR-34c after treatment with EV-IR, but not with EV-C, µEV-C or µEV-IR (Fig. 8G, H). Expression of AblWT in Abl-µNLS MEFs raised IR-induced miR-34c levels (Fig. 8C) and restored the miR-34c increase in µEV-IR by 2-fold (Fig. 8F). Although the rescue of miR-34c increase in µEV-IR by AblWT did not reach the 20-fold level found with EV-IR, treatment with µEV-IR from AblWT expressing Abl-µNLS cells did cause a 2-fold increase in the intracellular miR-34c levels in responder MEFs (Fig. 8I). We also measured the mRNA levels of three previously confirmed miR-34c target genes (Cannell et al., 2010; Garofalo et al., 2013), namely Pdgfra, Pdgfrb and Myc, in responder cells after treatment with EV-C or EV-IR. We found that EV-IR treatment reduced Myc RNA in responder cells, indicating that the miR-34c transferred by EV-IR was functional in targeting Myc but not Pdgfra or Pdgfrb for down-regulation (Fig. 8J). Together, these results show that nuclear Abl not only contributes to IR-induced miR-34c expression, but also drives the secretion of functional miR-34c in EV-IR for transfer into responder cells.
Ectopically Produced EV-miR34c with ROS-and γH2AX-Inducing Activities (Fig. 9; Fig. S4)
To ectopically produce EV with miR-34c from non-irradiated cells, we transfected HEK293T cells with a miR-34c-minigene and a constitutively activated Abl kinase (AblPPn) (Fig. 9A, B). The miR-34c-minigene raised miR-34c levels in transfected cells (Fig. 9C) and in EV isolated from the media of those transfected cells (Fig. 9D). Co-expression with AblPPn further increased the intracellular and the EV levels of miR-34c (Fig. 9C, D). When added to responder MEFs, EV-miR-34c and EV-miR-34c+AblPPn increased the intracellular levels of miR-34c proportional to miR-34c levels in the EVs (Fig. 9E). Furthermore, EV-miR-34c and EV-miR-34c+AblPPn increased the ROS and the γH2AX levels in responder MEFs proportional to miR-34c levels (Fig. 9F, G, Fig. S4A, B, C, D). These results showed that ectopically expressed miR-34c is secreted in EV by HEK293T cells, that activated Abl kinase stimulates the EV-levels of miR-34c, that EV-miR34c transfers miR-34c into responder cells, and that the levels of miR-34c correlate with the levels of ROS and γH2AX in responder cells.
Defects of EV-IR from miR-34-Triple Knockout MEFs in Inducing ROS and γH2AX (Fig. 9; Fig. S4)
To determine if miR-34c is necessary for EV-IR to induce ROS and γH2AX, we isolated EV-IR-miR34TKO from media conditioned by irradiated primary MEFs derived from the miR34-family (a, b, c) triple knockout mice, and EV-IR-miR34WT from irradiated primary MEFs derived from littermate wild-type mice (Concepcion et al., 2012). We found that EV-IR-miR34WT induced ROS in the responder MEFs, showing that EV-IR from primary (miR34WT) and established (Abl-wt) MEFs had similar ROS-inducing activity. However, EV-IR-miR34TKO did not induce ROS in responder MEFs (Fig. 9H; Fig. S4E, G). By contrast, EV-IR-miR34TKO was able to cause γH2AX increase in responder cells, but to a significantly lower level than that caused by EV-IR-miR34WT(Fig. 9I; Fig.S4 F,H). These results suggest that miR-34-family is required for the ROS-inducing activity of EV-IR; and that this family of microRNAs contribute to, but are not the only inducers of, γH2AX increase in non-irradiated bystanders.
Roscovitine Inhibited EV-IR-Induced γH2AX (Fig. 10; Fig. S5)
The induction of bystander DNA damage is a detrimental side effect of radiation therapy as it is associated with secondary malignancy (Burtt et al., 2016; Lorimore et al., 2008). Previous studies have linked the induction of bystander DNA damage to oxidative stress (Havaki et al., 2015). However, we found that NAC neutralized EV-IR-induced ROS without affecting the increase in γH2AX (Fig. 3). Because EV-IR stimulated γH2AX and RAD51 foci in only a subpopulation of responder cells (Fig. 3; Fig. S3), and because γH2AX and RAD51 foci can occur during DNA replication (Scully et al., 1997; Tashiro et al., 1996), we inhibited DNA replication by treating synchronized populations of responder cells with the Cdk-inhibitor Roscovitine (Rosc) (Fig. 10A). In the absence of Rosc, treatment of synchronized responders with EV-IR again caused an increase in γH2AX (Fig. 10B; Fig. S5A, G). However, in the presence of Rosc, EV-IR failed to increase γH2AX (Fig. 10B; Fig. S5A, G). Similar results were obtained with EV-miR-34c isolated from miR-34c-minigene transfected HEK293T cells (Fig. 10C; Fig. S5B, H). Thus, EV-IR and EV-miR-34c might cause replication stress to induce bystander DNA damage.
Persistence of EV-IR-Induced γH2AX Increase (Fig. 10; Fig. S5)
An interesting hallmark of bystander DNA damage induced by radiation is the epigenetic propagation of this response (Koturbash et al., 2006). Because EV-IR could increase γH2AX and RAD51 foci in responder cells without causing growth arrest (Fig. 3; Fig. S2), we determined the stability of the ROS and γH2AX responses through serial passages after EV removal (Fig. 10D). The ROS increase detected at the time of EV-IR removal was lost after culturing in full media (Fig. 10E; Fig. S5C). Interestingly, however, the EV-IR-induced increase in γH2AX was stable through two passages in fresh media without EV-IR (Fig. 10F; Fig. S5D, I). The persistence of γH2AX increase was similarly observed when responder cells were treated with EV-miR-34c (Fig. 10 G, H; Fig. S5E, F, J). These results showed that EV-IR-and EV-miR34c-induced increase in γH2AX was a stable response that could be propagated to progeny cells.
DISCUSSION
EV from Irradiated Cells Induce Multiple Bystander Effects
This study investigated the role of extracellular vesicles (EV) in radiation-induced bystander effects on colony formation, redox homeostasis and DNA damage. We found that EV isolated from media conditioned by irradiated cells (EV-IR) induced each of those three biological effects in non-irradiated bystander cells but with different efficacies. Although EV-IR was internalized by virtually all responder cells, we found no evidence for cell cycle arrest or senescence in the general population. Rather, EV-IR appeared to only inhibit the colony-forming potential of a small fraction of the responder cells. By contrast, EV-IR did cause ROS levels to rise in virtually all of responder cells. This ROS increase contributed to colony inhibition because an anti-oxidant NAC neutralized the ROS response and reduced the colony-inhibitory activity of EV-IR. However, NAC did not affect EV-IR-induced DNA damage, measured by increases in γH2AX and RAD51 foci and occurring in a sub-population of responder cells. Furthermore, the ROS increase was not maintained after removal of EV-IR whereas the γH2AX increase was propagated to progeny responder cells up to 6 days after EV-IR removal. Together, these results suggest that EV-IR induced multiple biological effects in responder cells by different mechanisms.
Nuclear Abl Requirement in EV-Mediated Bystander Effects
Results from this study have uncovered a previously unknown function of nuclear Abl in DNA damage response, that is, nuclear Abl is required for irradiated cells to produce miR-34c-containing EV with ROS-and γH2AX-inducing activities. We created the Abl-µNLS allele in mice to investigate the physiological role of nuclear Abl in DDR. We show here that IR-induced increase in ROS and DNA damage occurred in the Abl-µNLS MEFs despite the lack of nuclear Abl. This may not be a surprising observation since the ROS increase occurs in the cytoplasm through the mitochondria, and the DNA breaks result from physical-chemical reactions. In other studies, we found that nuclear Abl does contribute to the induction of p53-target genes by IR (unpublished), confirming previous results that nuclear Abl activates the p53-family of transcription factors in DNA damage response (Gong et al., 1999; Shaul, 2000). We have also shown that Abl kinase phosphorylates DCGR8 to stimulate precursor miR-34c processing (Tu et al., 2015). In this study, we have identified a previously unknown function of the nuclear Abl-miR34c pathway in EV-mediated bystander effects of radiation. Results shown here establish that irradiated cells require nuclear Abl kinase to include miR-34c in EV for transfer to responder cells. The Abl kinase may passively stimulate miR-34c inclusion as the outcome of its stimulation of miR-34c expression. Alternatively, Abl kinase may actively stimulate miR-34c secretion by targeting this microRNA to micro-vesicles.
MicroRNA in Radiation-Induced Bystander Effects
Previous studies have found IR to increase the intracellular abundance of many microRNAs by regulating their biogenesis (He et al., 2007a; Mao et al., 2014). Previous studies have also shown that microRNAs affect an array of cellular responses to radiation (Chaudhry, 2014). Results from this study show for the first time that IR-induced miR-34c is secreted in extracellular vesicles to induce ROS and γH2AX in non-irradiated cells. The miR-34-family of microRNAs can target many pro-mitogenic and pro-survival genes to cause growth arrest and apoptosis (He et al., 2007b; Maroof et al., 2014). However, we found that EV-IR and EV-miR-34c did not cause growth arrest or apoptosis in the responder cells, indicating that the previously validated pro-mitogenic and pro-survival mRNAs may not be sufficiently reduced by EV-mediated delivery of miR-34c. Computational analyses have predicted hundreds of other miR-34c targets that could be involved in the observed induction of ROS or γH2AX. Furthermore, miR-34c may trigger a cascade of gene expression alterations or it may collaborate with other EV-delivered factors to increase ROS and γH2AX in responder cells. Our findings that nuclear Abl is essential for irradiated cells to produce EV-IR with ROS-and γH2AX-inducing activities, but the miR34-family is essential only for the ROS-inducing activity suggest that EV-IR must contain other nuclear-Abl-dependent DNA damage-inducers that remain to be identified.
MATERIALS & METHODS
Cell Lines
Fibroblasts were derived from Abl+/+ (Abl-wt) or littermate Ablµ/µ(Abl-µNLS) mouse embryos. The Abl-µNLS allele was generated by knock-in mutations to substitute the eleven lysines and arginines in the three nuclear localization signals (NLS) with glutamine (Preyer et al., 2007). The Abl-wt and Abl-µNLS mouse embryo fibroblasts (MEFs) were immortalized by serial passages, and these MEFs do not express p53. Primary, non-immortalized, MEFs from miR-34a, b, c-triple knockout mice (miR34TKO) and wild-type littermates (miR34WT) (Concepcion et al., 2012) were irradiated between passages 3 and 6. MEFs and HEK293T cells (Thermo Fisher Scientific) were cultured in DMEM high glucose media with 10% fetal bovine serum (FBS) and antibiotics.
Irradiation
Cells were exposed to 10 Gy of gamma-irradiation using Mark I model 50 irradiator with Cesium 137 isotope as source (Maker: J.L. Shepherd & Associates).
Isolation of Extracellular Vesicles (EV)
To avoid EV from fetal bovine serum (FBS), 107 cells (in ten 10-cm dishes) were switched to FBS-free media with 1% BSA two hours before irradiation. At 24 hours after irradiation, the media were collected for EV isolation by differential ultracentrifugation as previously described (Thery et al., 2006) (Fig. 1A). The pelleted EV fraction was washed and re-suspended in 300 µl of phosphate buffered saline (PBS) and stored in 50 µl aliquots at −80°C. For isolation of EV from HEK293T cells, supernatant-1 collected after the 2000xg spin (Fig. 1A) was filtered through a 0.45-micron filter (Corning) before continuing onto the next steps of ultracentrifugation. Protein content of EV was determined by the Lowry method.
Nanoparticle Tracking Analysis
Nanosight LM-10HS was used for nanoparticle tracking analysis. This analysis uses the diffraction measurement of Brownian motion of particles. The EV suspension was diluted 300 fold in PBS and 1 µl of the diluted suspension was video taped by Nanosight to determine the size distribution and the concentration of particles. Each EV preparation was analyzed in triplicates as previously described (Akers et al., 2016).
Uptake of Extracellular Vesicles
EV suspensions were incubated with PKH26, a fluorescent membrane-binding dye (Sigma Aldrich, St. Louis) for 5 min at room temperature, followed by addition of 1% BSA, and then centrifuged at 100,000×g for 70 min to isolate PKH26-labeled EV as previously described (Mineo et al., 2012). Responder MEFs were incubated with PKH26 in PBS, or PKH26-labeled EV-C or PKH26-labeled EV-IR (25 µg each). After 3 or 24 hours, cells were fixed with 4% para-formaldehyde (PFA) for 20 min at room temperature and counterstained with Hoechst 33342. Cells were viewed using an Olympus FV1000 Spectral Confocal microscope. No fluorescence was detected in cells incubated with PKH in PBS. Using FIJI (ImageJ), we measured the PKH26 mean gray values from at least 200 cells per treatment and calculated the mean and standard deviations. The number of PKH26-positive cells was counted by eye, and percentages were calculated from PKH26-positive cells over total number of nuclei.
Colony Formation Assay
Responder cells (Abl-wt MEFs) were seeded at 1000 cells per 6-cm plate. Media was changed to 1% BSA without FBS before incubation with EV. After 24 hours, cells were switched back to media with 10% FBS and cultured for 15 days with media refreshed every other day. The colonies were fixed with 100% methanol and stained with 0.05% crystal violet. Excess dye was removed & plates were left to dry over-night. Cluster of more than 50 cells were considered as colonies. Survival fraction was calculated as colonies/cells seeded with the survival fraction in PBS treated plates set to 1. Images of the colonies were acquired using Alpha imager HP System.
Reactive Oxygen Species (ROS) Assay
ROS was measured using the ROS-ID kit (Enzo Life Sciences, Farmingdale) according to manufacturer’s protocol. Live cells were also stained with Cell Tracker Red (CTR) (Molecular Probe) as a control for cell volume. Responder cells were seeded into chamber slides, incubated with EV in serum-free media containing 1% BSA for 24 hours, then stained with CTR and DCFDA. Immediately after dye addition, live cell images were captured using an Olympus FV1000 Spectral Confocal Microscope for CTR (Channel 3) & DCFDA (Channel 1). FIJI (ImageJ) software was used to create masks from channel 3 (CTR), and then the masks were transferred onto channel 1 (DCFDA). The mean gray values (MGVs) in channels 1 and 3 were recorded within the masks, and the DCFDA/CTR MGV ratio was calculated for each mask. See Figs. S3D; S4C, G for plots of ranked DCFDA/CTR ratio of individual cell from representative experiments. From each experiment, we collected the ratio from at least 200 cells per sample. We then determined the median and the interquartile range of ratios collected from one to three experiments (200-600 cells) as indicated in the figure legends.
Immunofluorescence
Acid-washed coverslips stored in 100% ethanol were placed in 24-well plates and approximately 20,000 MEFs were seeded per well. After incubation with EV for 24 hours in serum-free media containing 1% BSA, cells were fixed in 4% PFA for 15 min, washed with 0.02% Tween-20 in Tri-buffered saline (TBS) twice (5 min each), permeablized with 1% Triton X-100 in TBS for 15 min and then blocked with 5% BSA for 30 min at room temperature. The coverslips were incubated with primary antibody for 1 hour in 37°C: anti-Abl (8E9) (6µg/ml) from ThermoFisher Scientific, anti-phospho-Ser139-H2AX (anti-γH2AX, 1/400) from Cell Signaling, anti-RAD51 (1/50) from Santa Cruz. Coverslips were washed twice with 0.02% Tween-20 in TBS twice (5 min each) and then incubated with ALEXA fluor-488 (Invitrogen)-chicken anti-mouse (1/500) or ALEXA fluor-594 (Invitrogen)-donkey anti-rabbit (1/500) at 37°C for 30 min. Nuclei were stained with Hoechst 33342. Coverslips were mounted with Prolong Gold Antifade Reagent and sealed with nail polish before imaging. Images were captured using an Olympus FV1000 Spectral Confocal Microscope.
Quantification of γH2AX
FIJI (ImageJ) software was used to create masks from channel 0 (Hoechst 33342), the masks were then transferred onto channel 1 (anti-γH2AX), and the channel 1 mean gray value (MGV) within each mask was recorded. See Figs. S3B, C; S4D, H; S5G, H, I, J for plots of ranked γH2AX MGV of individual cell from representative experiments. From each experiment, we collected the MGV from at least 200 cells per sample. We then determined the median and the interquartile range of MGV collected from one to three experiments (200-600 cells) as indicated in the figure legends.
Senescence-Associated β-Galactosidase Staining
Irradiated (10 Gy) or EV-treated (25µg, 24 hours) MEFs were cultured for additional 5 days in serum-supplemented media and counterstained with Hoechst 33342 and the Senescence Cells Histochemical Staining Kit (Sigma-Aldrich). The number of nuclei was counted in images captured by the KEYENCE BZ-X700 All-in-One Fluorescence Microscope at a magnification of 20X, with 50% transmitted light, and white balance red-blue-green areas of 1.46, 0.98, and 1.24, respectively. The β-galactosidase positive blue cells were counted under Phase contrast microscope. At least 200 cells were scored per sample per experiment to calculate the percentage of positive senescent cells.
Immunoblotting
Cell pellets were lysed in RIPA buffer (25mM Tris-HCl pH 7.6, 10% Glycerol, 1% NP40, 0.5% sodium deoxycholate, 1x Protease inhibitors (Roche), 150mM Sodium chloride, 50mM Sodium fluoride, 10mM Sodium beta-glycerophosphate, 10mM Sodium orthovandate, 10mM sodium pyrophosphate, 1mM PMSF). Proteins were separated using SDS-PAGE & transferred onto Nitrocellulose membranes (Millipore). Membranes were blocked for 1 hour at room temperature, incubated with anti-Abl (8E9) (1/500) & anti-actin (1/2000) from Sigma Aldrich for 1 hour, washed and incubated with secondary antibody (Anti-mouse: HRP-linked) & developed using ECL reagents (Pierce).
Cell Cycle Analysis
Cells were collected at 24 hours post irradiation or EV treatment by trypsinization, followed by centrifugation at 1400 RPM for 6 min. Cell-pellets were fixed in ice cold 70% ethanol overnight and stained with 40 µg/ml propidium iodide (PI) (Sigma) and 100 µg/ml RNaseA (Sigma) for 30 min at 37oC in the dark. PI staining was analyzed using Sony SH800 FACS sorter and software.
Retrovirus Packaging and Infection
AblWT & AblµNLS were stably expressed in Abl-µNLS MEFs by retroviral infection. BOSC23 cells were transfected with retroviral vector pMSCV expressing AblWT or AblµNLS. Culture media collected at 48 hours after transfection was filtered and added to Abl-µNLS MEFs with polybrene (4µg/ml). Infected cells were then selected for resistance to hygromycin (150 µg/ml).
Transfection
Genetran (Biomiga) was used to transfect HEK239T cells with miR-34cminigene and pCDNA3-AblPPn plasmid DNA (Tu et al., 2015). Transfected cells and their media (for EV isolation) were collected 24 hours after transfections.
RNA measurements
The SeraMir Exosome RNA amplification kit (System Biosciences) was used to extract RNA from EV pellets. Total cellular RNA was extracted using TRIzol (Life Technologies). Synthesis of cDNA was carried out using ABI reverse Transcription kit (Life Technologies). For measurements of mature miR-34c, stem-loop primer was used for reverse transcription (Tu et al., 2015). U6 was used as the reference gene for normalization of miR-34c abundance. GAPDH was used as reference gene for normalization of p21Cip1, Pdgfrb, Pdgfra & Myc abundance. Realtime PCR reactions were carried out using StepOnePlus system. Subtraction of the reference gene CT value from the experimental gene CT value generated the normalized ΔCT. Relative abundance was then calculated as 2-ΔΔCT, where ΔCT values were ΔCT of sample subtracted by ΔCT of vehicle-treated or vector transfected cells. Primer sequences: U6-F: CTCGCTTCGGCAGCACA, U6-R: AACGCTTCACGAATTTGCGT, Stem-loop miR34c: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCAATC, q-miR34c-F: AGGCAGTGTAGTTAGCTG, q-miR-R: GTGCAGGGTCCGAGGT, p21-F: CCATGTGGACCTGTCACTGTCTT, p21-R: AGAAATCTGTCATGCTGGTCT, Pdgfrb F: GTTGTTGCTGTCCGTGTTATG, Pdgfrb R: GGCCCTAGTGAGTTGTTGTAG, Myc F: CGACTCTGAAGAAGAGCAAGAA, Myc R: AGCCAAGGTTGTGAGGTTAG, Pdgfra F: CTCAGAGAGAATCGGCCCCA, Pdgfra R: CACCAGCCTCCCGTTATTGT
Statistical Analysis
The statistical analyses were performed using Graph-Pad Prism 6. For clonogenic survival & qRT-PCR measurements, the mean ± SD from three independent experiments were analyzed using ONE WAY ANOVA. For ROS and γH2AX measurements, the ratios(ROS)or the mean gray values (γH2AX)from 200-600 cells from one to three independent experiments per sample were ranked across samples and the mean ranks analyzed using the non-parametric Kruskal-Wallis test. For each statistical test, ns: not significant; *P≤0.05, **P≤0.01, *** P≤0.001, **** P≤0.0001.
SUMMARY
Ionizing radiation stimulates nuclear accumulation of Abl tyrosine kinase that is required for directly irradiated cells to produce microRNA-34c-containing extracellular vesicles which transfer the microRNA into non-irradiated cells to induce reactive oxygen species and bystander DNA damage.
ACKNOWLEDGEMENTS
We thank Chenhui Bian, Neal Shah and Louis Nguyen for excellent technical assistance. We thank Dr. Andrea Ventura, Memorial Sloan Kettering Cancer Centre, New York for the miR34WT and miR34TKO primary MEFs. We thank Dr. Clarke Chen & Dr. Johnny Akers for helping with the Nanoparticle Tracking Analysis.
AUTHOR CONTRIBUTIONS
SR designed and performed the experiments, analyzed the data, and wrote the paper. A.H, J.C, performed experiments and analyzed the data. JYJW conceived of the idea,designed the experiments, analyzed the data and wrote the paper.
SUPPLEMENTAL MATERIAL
Nuclear Abl Drives miR-34c Transfer by Extracellular Vesicles to Induce Radiation Bystander Effects
S. Rastogi et al
Figure S1. Representative Images of Clonogenic Assay Results (supporting Figs. 2 & 3).
Figure S2. Extracellular Vesicles from Irradiated Cells Did Not Induce p21Cip1, Cell Cycle Arrest or Senescence (supporting Fig. 2).
Figure S3. Treatment with EV-IR but not EV-C Induced ROS, γH2AX, and RAD51 Foci in Responder Cells (supporting Fig. 3).
Figure S4. ROS- and γH2AX-Inducing Activities of EV Preparations from Transfected HEK293T cells (supporting Fig 9).
Figure S5. Effects of Roscovitine and Cell Passage on γH2AX (supporting Fig 10).