Abstract
Aim and hypothesis microRNAs (miRNAs) play an integral role in maintaining beta cell function and identity. Deciphering their targets and precise role, however, remains a challenge. In this study we aimed to identify miRNAs and their downstream targets involved in regeneration of islet beta cells following partial pancreatectomy in mice.
Methods RNA from laser capture microdissected (LCM) islets of partially pancreatectomized and sham-operated mice were profiled with microarrays to identify putative miRNAs implicated in control of beta cell regeneration. Altered expression of selected miRNAs, including miR-132, was verified by RT-PCR. Potential targets of miR-132 were selected through bioinformatic data mining. Predicted miR-132 targets were validated for their changed RNA and protein expression levels and signaling upon miR-132 knockdown or overexpression in MIN6 cells. The ability of miR-132 to foster beta cell proliferation in vivo was further assessed in pancreatectomized miR-132-/- and control mice.
Results Partial pancreatectomy significantly increased the number of BrdU+/insulin+ positive islet cells. Microarray profiling revealed 14 miRNAs, including miR-132 and -141, to be significantly upregulated in LCM islets of partially pancreatectomized compared to LCM islets of control mice. In the same comparison miR-760 was the only miRNA found to be downregulated. Changed expression of these miRNAs in islets of partially pancreatectomized mice was confirmed by RT-PCR only in the case of miR-132 and -141.
Based on previous knowledge of its function, we chose to focus our attention on miR-132. Downregulation of miR-132 in MIN6 cells reduced proliferation while enhancing the expression of pro-apoptotic genes, which were instead reduced in miR-132 overexpression MIN6 cells. Microarray profiling, RT-PCR and immunoblotting of miR-132 overexpressing MIN6 cells revealed their downregulated expression of Pten, with concomitant increased levels of pro-proliferative factors phospho-Akt and phospho-Creb as well as inactivation of pro-apoptotic Foxo3 via its phosphorylation. Finally, we show that regeneration of beta cells following partial pancreatectomy was reduced in miR-132-/- mice compared to control mice.
Conclusions/Interpretations Our study provides compelling evidence for upregulation of miR-132 being critical for regeneration of mouse islet beta cells in vivo through downregulation of its target Pten. Hence, the miR-132/Pten/Akt/Foxo3 signaling pathway may represent a suitable target to enhance beta cell mass.
Research in Context
What is already known?
Several miRNAs, including miR-132, are known to regulate beta cell function and mass in several mouse models of diabetes db/db, ob/ob and high fat-diet.
What is the key question?
Which are the miRNAs implicated in control of beta cell regeneration upon partial pancreatectomy and how?
What are the new findings?
miR-132 is critical to promote regeneration of mouse beta cells in vivo following partial pancreatectomy
In vitro studies in mouse MIN6 cells indicate that miR-132 fosters beta cell proliferation by down-regulating the expression of phosphatase Pten, thereby tilting the balance between anti-apoptotic factor Akt and pro-apoptotic factor Foxo3 activities towards proliferation through regulation of their phosphorylation.
How might this impact on clinical practice in the foreseeable future?
These findings strengthen the rationale for targeting the expression of miR-132 to increase beta cell mass in vivo (type 2 diabetes) or ex-vivo (islet transplantation in type 1 diabetes) for the treatment of diabetes.
Introduction
miRNAs belong to the class of short non-coding RNAs that regulate gene expression by annealing to 3’ untranslated region sequences in target mRNAs and inducing their post-transcriptional repression. The functional importance of miRNAs has been extensively investigated in recent years and their altered expression has been implicated in a wide range of diseases, including cancer [1], cardiovascular disease [2, 3] and diabetes [4]. In pancreatic beta cells, changed expression of miRNAs correlates with profound impairment of glucose metabolism [5] and processing of miRNAs appears to be altered in obesity, diabetes, and aging. Several miRNAs such as miR-7, -21, -29, -34a, -132/-212, -184, -200 and -375 have been found to be relevant for beta cell function [6]. RNA sequencing of human islets detected 346 miRNAs, including 40 which were enriched in comparison to other tissues [7]. miR-375 is the most highly expressed miRNA in human and mouse pancreatic islets. Its down-regulation inhibits pancreatic islet development in Xenopus laevis [8], while its global inactivation in mice leads to decreased beta cell mass and ultimately diabetes [9, 10]. miR-132 also plays a key role in beta cell function. Its expression is dysregulated in different mouse models of type 2 diabetes (T2D) [11-14], with its overexpression being correlated with improved glucose-stimulated insulin release from dissociated rat islet cells [13] as well as with enhanced beta cell proliferation and survival [12-14]. In primary PC12 cells, another endocrine cell model, miR-132 controls cell survival by direct regulation of Pten, Foxo3a and p300 signaling [15]. However, in pancreatic islets, the functional relevance of miR-132 in vivo and its downstream targets remain unknown. To identify the major miRNAs as well as their downstream targets involved in beta cell proliferation, we analyzed the profile of miRNAs differentially expressed after a partial pancreatectomy in comparison to sham-operated mice. We report here that the expression of 14 miRNAs were markedly increased and one miRNA was down-regulated in islets of partially pancreatectomized mice, in which beta cell proliferation was increased. Moreover, we show that down-regulation of miR-132 expression in insulinoma MIN6 cells correlated with decreased proliferation and increased apoptosis by controlling the expression of Pten and its downstream effectors Akt and Foxo3 while its up-regulation had opposite effects, Finally we demonstrate that beta cell proliferation is impaired in miR-132-/-mice.
Methods
Mouse partial pancreatectomy
Mice underwent general anesthesia using a small rodents’ anesthesia unit (Harvard Apparatus Ltd., Holliston, MA, USA) for mask inhalation of isoflurane (Baxter Deutschland GmbH, Unterschleißheim) at the concentration of 4.5-5% for induction and 2-2.5% for maintenance of anesthesia with an airflow rate of 200 ml/min. For perioperative analgesia buprenorphin (0.05 mg/kg bodyweight) was administered subcutaneously. The abdomen was opened through an upper midline incision. The spleen and the entire splenic portion of the pancreas were surgically removed while the mesenteric pancreas between the portal vein and the duodenum was left intact. The remnant was defined as the pancreatic tissue within 1-2 mm of the common bile duct that extends from the duct to the first portion of the duodenum. This remnant was the upper portion of the head of the pancreas. This procedure, as described previously [16] led to approximately 75% pancreatectomy, as confirmed by weighing the removed and remnant portions of the pancreas. Sham operations were performed by removing the spleen while leaving the pancreas intact. At the end of surgery, Alzet 1007D mini-osmotic pumps (Alzet®, Cupertino, CA, USA) were implanted i.p. to deliver 50 μg·μl−1 BrdU (Sigma, St. Louis, MO, USA) in 50% DMSO at a rate of 0.5 μl·h−1 for 7 days. Blood glucose levels were measured daily from the tail vein with a Glucotrend glucometer (Roche Diagnostics, Basel, Switzerland).
miR-132/-212-/- mice were backcrossed into the C57Bl/6N background for at least seven generations, as previously described [17]. Mutant and wild-type male C57Bl/6N mice with an age of 13-19 weeks and a body weight of 28-34 g underwent partial pancreatectomy as described above. All animal protocols were approved by the institutional animal care and use committee at the Faculty of Medicine of TU Dresden and all experiments were performed in accordance with relevant guidelines and regulations.
Intraperitoneal glucose tolerance test (IpGTT)
IpGTT were performed two days before surgery and six days after surgery to assess differences between wild-type and mutant mice and between pancreatectomized and sham-operated animals. After 10 hours overnight fast, mice were injected with 2g/kg body weight of 20% glucose solution. Blood glucose levels were measured from the tail vein at 0, 15, 30, 60, 120 and 180 minutes after glucose injection.
BrdU staining of pancreatic tissue sections and MIN6 cells
The pancreatic remnants and the sham-operated pancreata were harvested 7 days post-surgery. Mice were anesthetized with isoflurane as described above and the abdominal incision was re-opened. After fixation by intracardial perfusion with 4% paraformaldehyde, mouse pancreas were removed, further fixed overnight in 10% neutral formalin, embedded in paraffin and cut in ten-micrometer thin serial sections. The core of the islets, containing predominantly beta cells, were obtained using laser capture microdissection (P.A.L.M. MicroBeam Laser Capture System, Zeiss Switzerland) after identifying islets on every fifth serial section by cresyl staining. The BrdU staining of pancreatic tissue sections and MIN6 cells was performed as previously described [16].
Transcriptomic profiling of mouse islets
Total RNA was isolated from the islets of 16-19-week-old wild-type and miR-132-/- mice (6 mice/group) using RNeasy (Qiagen, Hilden, Germany). For microarray analysis, 100 ng of islet RNA was amplified with the Illumina Total Prep RNA Amplification Kit (Ambion, Inc., Austin, TX, USA) and cRNA was labeled with biotin-UTP, as described [18].
Microarray analysis and data mining
Microarray data processing and quality control were done with GeneSpring GX 13. After quantile normalization, significantly differentially expressed genes were obtained by volcano plot filtering for FC≥|1.5| and p<0.05. Functional analysis was assessed using Ingenuity Pathway Analysis (IPA, Qiagen, Hilden, Germany).
Cloning of miR-132 in pacAd5 shuttle vector
To produce the adenovirus over-expressing miR-132 we used the RAPAd® miRNA Adenoviral Expression System (Cellbiolabs, San Diego, CA, USA). Following the Kit’s instructions, the mmu-miR-132 precursor sequence, obtained from www.miRBase.org (GGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACCGGAGGTAACAGTCTACAGCC ATGGTCGCCC), was PCR-amplified from mouse genomic DNA including approximately a 100bp flanking region on each side (Forward: 5’-TCGAGGATCCTCCCTGTGGGTTGCGG TGGG-3’; Reverse: 5’-TCGAGCTAGCACATCGAATGTTGCGTCGCCGC-3’) and cloned into the human β-globin Intron of the Kit’s pacAd5-miR-GFP-Puro vector via BamHI/NheI digestion. This human β-globin intron, containing the mmu-miR-132 precursor, was then subcloned into the Kit’s pacAd5-CMV-eGFP vector via PCR amplification (Forward: 5’-TGCAACCGGTGCCAGAACACAGGTACACATAT-3’; Reverse:5’-TGCAACCGGTCGTGC TTTGCCAAAGTGATG-3’) and AgeI digestion to obtain a miR-132 overexpressing schuttle vector with a CMV promoter. The empty pacAd5-CMV-eGFP vector was used for the production of a control virus.
Cell culture
Mouse MIN6 cells were kind gifts from Dr. Jun-ichi Miyazaki (Osaka University, Japan), and were grown as previously described [19]. MIN6 cells were cultured in 25 mmol/L glucose Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX(TM), pyruvate) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 15% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin, 100 U/mL streptomycin (Sigma-Aldrich, St. Louis, MO, USA) and 70μM β - Mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA), and were incubated at 37°C in a humidified atmosphere containing 95% air and 5% CO2. HEK293T cells used to propagate the adenovirus were cultured in 25 mmol/L glucose Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX(TM), pyruvate) (Gibco), supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin, 100 U/mL streptomycin (Sigma-Aldrich) and 0.1 mM non-essential amino acids (Gibco), and were incubated at 37°C in a humidified atmosphere containing 95% air and 5% CO2.
Adenovirus production in HEK293T cells
The adenoviral backbone vector pacAd5-9.2-100 from the RAPAd miRNA Adenoviral Expression System (Cellbiolabs, San Diego, CA, USA) and both shuttle vectors pacAd5-CMV-eGFP and pacAd5-CMV-mir132-eGFP were PacI linearized, and co-transfected into HEK293T cells using the X-tremeGENE 9 DNA Transfection Reagent (Roche, Basel, Switzerland) and amplified, until a sufficient amount of virus supernatant was available for experiments, which was then aliquoted and stored at −80°C. Virus titers were determined with the Adeno-XTM Rapid Titer Kit (Clontech, Mountain View, CA, USA) All steps were carried out according to the manufacturer’s instructions.
Alteration of miR-132 expression in MIN6 cells with siRNAs or adenoviruses
The single-stranded RNA used in to silence miR-132 consisted of 24-nucleotide length oligo: 5’-CGACCAUGGCUGUAGACUGUUACC-3’ and as control, we used a scrambled oligonucleotide. MIN6 cells were seeded in a 6-well plate as described above on day 1. For the silencing of miR-132, cells were transfected with 100 nM of anti-miR-132 or control siRNAs using Dharmafect4 as transfection reagent on day 2. For the overexpression of miR-132, MIN6 cells were transduced with an adenovirus in which miR-132 was driven by the CMV promoter at MOI of 6,400. On day 4 post RNA silencing or adenoviral transduction, cells were harvested, proceeded for BrdU labeling or western blotting as described below.
Cell extraction and immunoblotting
MIN6 cells were harvested at 4°C in RIPA buffer [50 mM Tris·HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, and protease inhibitor mixture (Sigma)] for total protein extraction. Insoluble material was removed by centrifugation. Aliquots of 20 ug were separated by SDS PAGE, as described ([16]. The source, species and dilutions of antibodies used for immunoblotting are listed in ESM Table 1.
RNA Isolation from MIN6 Cells for microRNA measurement
Cells were harvested after washing them once in Dulbecco’s PBS (Sigma, St. Louis, MO, USA) by scraping and pelleting them 5 min at 300 x g at 4°C. Cell pellets were immediately stored at −80°C. miRNA isolation was performed with the mirVana miRNA Isolation Kit (Ambion, Foster City, CA, USA) according to the manufacturer’s instructions. Both, the total RNA and the microRNA-enriched fraction were isolated. RNA concentrations were measured at the Nanodrop ND-1000 Spectrophotometer (PEQLAB / VWR, Darmstadt, Germany). Samples were stored at −80°C.
Taqman microRNA Assay
Reverse transcription of 15 ng miRNA per reaction of the miRNA-enriched fraction into cDNA was performed with the TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems) using the mir-132-specific or the U6 snRNA-specific stem-looped RT-Primer of the Taqman® Micro RNA Assay hsa-miR-132 (Applied Biosystems, Cat.# 4427975, Assay# 000457 / Thermo Fisher Scientific, Waldham, MA, USA) or the Taqman® Micro RNA Control Assay U6 snRNA (Applied Biosystems, Cat.# 4427975, Assay# 001973 / Thermo Fisher Scientific, Waldham, MA, USA). Both transcriptions were performed from each sample. Real time-PCR was then performed with the TaqMan® Universal PCR Master Mix (Applied Biosystems / Thermo Fisher Scientific, Waldham, MA, USA) on the Aria MX Real-Time PCR System (Agilent Technologies) using the small RNA-specific Primer mixes of the TaqMan® Assays described above. All steps were carried out according to the manufacturer’s instructions.
Real Time-PCR
cDNA samples were obtained by reverse transcription of 1ug total RNA using the M-MLV Reverse Transcriptase (Promega, USA, WI, Madison). Quantitative real time-PCR was then performed with the GoTaq qPCR Master Mix (Promega, USA, WI, Madison) according to the manufacturers instruction using the oligonucleotides listed in ESM Table 2.
Statistical analysis
Statistical analyses were performed by using the unpaired Student’s t test unless otherwise stated. Results are presented as mean SE unless otherwise stated. A value of p < 0.05 was considered significant. Error bars show standard deviations from at least three independent experiments unless otherwise stated. Histograms were prepared with Microsoft Excel (Microsoft, Redmont, WA, USA) or GraphPad Prism.
Results
miR-132 is upregulated in proliferating islet cells of pancreatectomized mice
To identify key miRNAs involved in beta cell proliferation, we used partially pancreatectomized mice (n=3) as a model for beta cell regeneration (Fig. 1a). The removal of 70-80% of the pancreas is a well-established procedure for inducing the replication of beta cells in the remaining pancreas [16, 20]. Proliferating cells were stained with 25μg/hr BrdU continuously delivered by an osmotic mini-pump implanted in the abdomen at the time of pancreatectomy. This approach ensures the labeling of every dividing cell [16]. As controls, 4 mice were similarly implanted with an osmotic mini-pump for BrdU delivery, but only underwent total splenectomy. Seven days post-surgery, all mice were sacrificed, their remnant pancreas excised for serial sectioning (40 sections/mouse) and staining with cresyl-violet to locate the islets. Adjacent, unstained sections were then used to count BrdU+ cells in the islet cores, which in rodents consists mainly of beta cells [21] (Fig. 1b) prior to islet core excision by laser capture microdissection (LCM) (Fig. 1 a and b). As expected, in partially pancreatectomized mice the fraction of islet core BrdU+ cells/total islet core cells, as determined by nuclear counting, was significantly higher than in sham-operated mice (Fig. 1c). RNA extracted from LCM islet cores was then profiled using microarrays. Fourteen miRNAs were found to be differently expressed (cut-off values: p= 0.05; FC≥1.5) in the islet cores of partially pancreatectomized mice compared to sham operated mice (Table 1). All these miRNAs were up-regulated, except miR-760, which was reduced by 2.28 fold. Expression levels of all 14 differentially expressed miRNAs were further quantified by real-time PCR (RT-PCR). With this analysis, only the significant changed expression of miR-132 and miR-141 could be validated (ESM Table 3). Given the role of miR-132 in the cell replication in vitro of primary islet cells [13], and other cell types, including glioma cells [22] and epidermal keratinocytes [23], we focus our attention on the potential involvement and mode of action of this miRNA in the regulation of beta cell proliferation.
miR-132 promotes proliferation and survival of mouse insulinoma MIN6 cells
At first, we down-regulated miR-132 expression in mouse insulinoma MIN6 cells using an anti-microRNA approach. Reduced expression of miR-132 by 90% (n=3, Fig. 2a), as assessed by RT-PCR, correlated with a slight, but significant reduction in the percentage of BrdU+ MIN6 cells in comparison to cells [n=6, 24.48±1.78 % (6,088 BrdU+ out of 25,246 cells) vs. 27.35±2.23% (7,271 BrdU+ cells out of 27,413 cells), p-value= 0.039], which had been transfected with a control oligonucleotide (Fig. 2b-d). miR-132 depletion correlated also with increased detection of cleaved Caspase-9 (n= 6; Fig. 2e and f), while the levels of cleaved Caspase-3 were not significantly changed. Conversely, overexpression of miR-132 with a bi-cistronic adenovirus vector encoding also for eGFP (n= 3 Fig. 2g) was not associated with a further increase in the proliferation of MIN6 cells, presumably due to their neoplastic state (n= 3, Fig. 2h-j). However, overexpression of miR-132 correlated with reduced levels of pro- and cleaved Caspase-9 (n= 6, Fig. 2k and l), consistent with miR-132 being anti-apoptotic.
miR-132 regulates the expression of Pten and Mapk1 in MIN6 cells
Next, we aimed to uncover down-stream targets of miR-132 in MIN6 cells. Microarray gene expression analysis of miR-132 overexpressing MIN6 cells identified 345 unique differentially expressed genes (cut-off values: p<0.05, FC ≥1.5), with 194 (56.2%) being down regulated and 151 (43.8%) up-regulated (Fig. 3a and ESM Table 4). Querying the TargetScan Mouse 7.1 database 35 of the down- and 2 of the up-regulated genes were predicted to contain highly conserved binding sites for miR-132 (Fig. 3a and ESM Table 5). Further analysis of regulated genes with Ingenuity Pathway Analysis revealed 8 regulated pathways (Fig. 3b and ESM Table 6), which included 26 of the 345 differentially expressed genes, all related to cell proliferation and survival (Fig. 3c). Among these 26 genes, the top 10 most represented genes in the 8 signaling pathways were further selected for validation of their mRNA levels by RT-PCR (ESM Table 7). As control, we also assessed the mRNA expression levels of Rasa1, an established target of miR-132 [24]. As shown in Fig. 3d, 6 out of 10 of the selected genes, namely Mapk1/Erk2, Pten, Nras, Pik3r1, Gnb1 and Gnb5 were confirmed to be downregulated upon miR-132 overexpression. Three of them, Mapk1, Pten and Gnb1, were also among the 37 predicted targets for miR-132 binding (ESM Table 5). Notably, Mapk1, also known as Erk2, is a serine-threonine kinase located downstream of the tumor-suppressor phosphatase Pten and both genes play a critical role in control of cell proliferation and survival [25, 26].
miR-132 regulates Pten signaling in MIN6 cells
Next, we tested whether overexpression of miR-132 affected the protein levels of the Pten and Mapk1/Erk2. Immunoblotting of MIN6 cells transduced with the miR-132/eGFP viral vector confirmed the down-regulation of Pten in parallel with up-regulation of its targets Akt and phospho-Akt (S473) (Fig. 4a and b), while Akt mRNA levels were unchanged (ESM Fig. 1). Furthermore, levels of the Akt1 substrate Creb and phospho-Creb (S133) were unchanged, but the phospho-Creb/Creb ratio was also increased. Likewise, overexpression of miR-132 correlated with reduced expression of Mapk1/Erk2, phospho-Mapk1/Erk2 and Rasa1/RasGAP, but not of Erk1 and phospho-Erk1 (Fig. 4c and d). As down-regulation of miR-132 correlated with elevated cleaved Caspase-9 levels, we further tested whether its overexpression affected the expression of Foxo3a, a key mediator of apoptosis. Immunoblotting for Foxo3a showed that its phosphorylation, which inhibits its activity, was increased (Fig. 4e-f), although the overall levels of its mRNA (ESM Fig. 1) and protein (Fig. 4e-f) were not changed.
miR-132 deletion impairs islet beta cell proliferation in pancreatectomized mice
Finally, to verify that miR-132 positively affects beta cell regeneration in vivo, we investigated beta cell proliferation in partially pancreatectomized or sham operated miR-132-/- mice and control littermates (6 mice/group), as described previously [16]. Intraperitoneal glucose tolerance test prior and 6 days after surgery showed no difference between control and miR-132-/- mice (Fig. 5a and b). Daily blood glucose measurements, in particular, showed a comparable slight decrease of glycaemia in partially pancreatectomized wild-type and miR-132-/- mice relative to sham operated mice in the first day post-surgery, followed by a complete normalization of glycaemia by the end of the 1-week-long protocol (ESM Fig. 2). Seven days after surgery, the mice were sacrificed, the remnant pancreas excised, and BrdU+/insulin+ beta cells were counted (Fig. 5c-f and ESM Table 8). As assessed by immunostaining for insulin, the average number of beta cells/islet in wt (31,9 beta cells/islet) and miR-132-/- (31,7 beta cells/islet) was increased in partially pancreatectomized mice relative to their sham-operated counterparts (wt: 23,8 beta cells/islet; miR-132-/-: 26,8 beta cells/islet). Likewise, the number BrdU+ insulin+ beta cells was increased in both groups of partially pancreatectomized mice compared to sham operated mice (Fig. 5g, ESM Table 8). However, in partially pancreatectomized miR-132-/-mice there were fewer BrdU+/insulin+ cells than in partially pancreatectomized wt mice (Fig. 5g, ESM Table 8). These data provide conclusive evidence for miR-132 exerting a positive role for beta cell regeneration in-vivo.
Discussion
miR-132 is known to control many cellular processes in various tissues including neuronal morphogenesis and regulation of circadian rhythm. miR-132 altered expression correlated with several neurological disorders, such as Alzheimer’s and Huntington’s diseases [15, 27] Thus, most of our acknowledge about miR-132 regulation and biological functions emerged from studies performed on neural cells, while not much is already known about the downstream target of miR-132 in pancreatic beta cells. miR-132 and miR-212 have identical seed sequences and potentially have targets in common. Here we have identified miR-132 as one of the mostly up-regulated miRNAs with a 5-fold expression change in pancreatectomized mice, a condition known to induce beta cell proliferation. This finding is in agreement with previous data showing induced miR-132 expression in different models of type 2 diabetes, including db/db, high-fat diet-fed [13] and ob/ob mice [10, 28]. Among our list of differentially expressed miRNAs in islets of partially pancreatectomized mice, miR-205 showed the greatest change (5 fold). Interestingly, miR-205 has also been described to be the miRNA with the highest expression change in hepatocytes of mice with obesity-induced type 2 diabetes [28]. On the other hand, our analysis did not reveal a significant change in the expression of miR-375, a miRNA abundant in pancreatic islets known to regulate insulin secretion and beta cell proliferation [10].
Previous work has shown that miR-132 is highly expressed in neurons and may regulate their differentiation [29, 30]. More recent work on primary neurons and PC12 cells has shown that miR-132 controls cell survival by direct regulation of Pten, Foxo3a and p300 -, proteins involved in Alzheimer’s disease [15]. To uncover the down stream target of miR-132 in beta cells, we first investigated whether miR-132 has a proliferative role in insulinoma MIN6 cells. We found that miR-132 down-regulation with anti - miR-132 correlated with slight but significant inhibition of MIN6 cells proliferation. The inhibition of the expression of miR-132 showed also an increase in cleaved Caspase-9-mediated apoptosis. Conversely, its up-regulation has a protective effect by reducing Caspase-9 processing. However, the increase in the expression of miR-132 did not correlate with an enhancement in the proliferative rate of MIN6 cells, presumably due to their higher proliferative fate. To uncover the downstream targets of miR-132, we analyzed the expression pattern of differentially expressed genes in cells over-expressing miR-132. Pten expression which is known to inversely correlate with cell survival, was significantly down-regulated in agreement with our data showing decreased apoptosis upon overexpression of miR-132. The reduced expression of Pten upon overexpression of miR-132 was confirmed at the protein level. Importantly, reduction of Pten correlated with increased phosphorylation of Akt (P-Akt) and Foxo3. P-Akt is a major activator of Foxo family proteins, which are members of the Forkhead superfamily of winged helix transcription factors controlling cellular metabolism, stress responses, DNA damage repair and cell death. P-Foxo3 can be phosphorylated on Thr32, Ser253 and Ser315 which promotes its and association with 14-3-3 proteins for retention in the cytoplasm, and thereby inhibition of its transcriptional activity [31].
Mapk1/Erk2 (mitogen-activated protein kinase 1) expression is reduced in cells over-expressing miR-132 and survey of Erk2 activation reveals reduced phosphorylation of Erk2 without change in its activation state (as shown by the ratio of p-Erk2/Erk2) suggesting that the Ras/Raf/Erk1/2 pathway is not preponderant in this biological process.
A considerable number of miRNAs have been associated with pancreatic beta cell development by affecting proliferation or differentiation (e.g., miR-375 [10], miR-7 [32], miR-124a [33], miR-24 [34], let-7a [31], miR-26a [35], miR-184 [14], miR-195, miR-15, miR-16 [37] and miR-132 [13, 28]. Among those miRNAs, miR-132 was consistently differentially expressed in various T2D models in which beta cells were challenged by increased metabolic demand, condition known to promote beta cell proliferation, including obesity induced diabetes [28]. In mouse model, constitutive deletion of miR-132 resulted in mice with deficient endocrine development [17]. A specific deletion of miR-13/212 locus in adult hippocampus with a retrovirus expressing Cre recombinase caused a dramatic decrease in dendrite length, arborization and spine density, suggesting that miR-132/212 is required for normal dendritic maturation in adult hippocampal neurons [38]. Here we demonstrate that regeneration of beta cells in pancreatectomized miR-132-/- mice is reduced, conceivably through its control of the Pten/Pi3K/Akt signaling.
In conclusion, we have identified miR-132 as a critical epigenetic factor for replication of beta cell after injury, such as partial pancreatectomy, and shed light about its mechanism of action in beta cells. Targeted therapies for beta cell regeneration in type 1 and type 2 diabetes are actively sought, and in this context miR-132 appears to be a worthy candidate to be considered. Along these lines, it would be especially interesting in the future to determine which and how extracellular signals promotes its expression in beta cells.
Data availability
Original microarray data will be accessible through the GEO database (https://www.ncbi.nlm.nih.gov/geo/).
Funding
This study was partially supported with funds from the German Center for Diabetes Research (DZD e.V.) by the German Ministry for Education and Research to MS and SK; and by a MeDDrive grant from the Carl Gustav Carus Faculty of Medicine at TU Dresden to SW.
Duality of interest statement
The authors do not have duality of interest associated with this manuscript.
Contribution statement
HM, MS and SK conceived the study and the experimental design; GH profiled gene expression, performed the data mining and validated the target genes with the help of KG, JM, KPK and SW; SH and JM performed the pancreatectomy, implanted the BrdU pump and immunostained pancreatic islets under the supervision of SK. KC generated and provided the miR-132-/- mice. HM, MS and SK wrote the manuscript. HM, MS and SK are responsible for the integrity of the study.
Acknowledgements
We are grateful to Julia Jarrells in the Sequencing Facility at the Max Planck Institute for Molecular Cell Biology and Genetics, Dresden, Germany; Anke Sönmez (Dresden, Germany) for help with cell culture, Katja Pfriem (Dresden, Germany) for administrative assistance and all the colleagues in the Department of General, Thoracic and Vascular Surgery in the Faculty of Medicine at TU Dresden for their support.
Footnotes
- Abbreviations
- miRNA
- microRNA
- miR-132
- microRNA 132
- Pten
- Phosphatase and Tensin homolog
- Akt
- proteine kinase B
- Foxo3
- Forkhead box O3
- RT-PCR
- Reverse transcription polymerase chain reaction
- T2D
- type 2 diabetes
- BrdU
- bromodeoxyuridine
- LCM
- laser capture microscopy
- IPA
- Ingenuity Pathway Analysis
- Pi3k
- Phosphatidylinositol-4,5-bisphosphate 3-kinase
- Ras
- Rat sarcoma
- Raf
- rapidly accelerated fibrosarcoma
- Mapk
- mitogen-activated protein kinase
- Sos1
- Son of sevenless homolog 1
- Gnb1
- G Protein Subunit Beta 1
- Nras
- Neuroblastoma RAS viral oncogene homolog
- Pik3r1
- Phosphoinositide-3- Kinase Regulatory Subunit 1
- Gnb
- G Protein Subunit Beta
- Fgfr3
- fibroblast growth factor receptor 3
- Creb
- cAMP response element-binding protein