Skip to main content
bioRxiv
  • Home
  • About
  • Submit
  • ALERTS / RSS
Advanced Search
New Results

Anti-angiogenic effects of VEGF stimulation on endothelium deficient in phosphoinositide recycling

Amber N. Stratman, Olivia M. Farrelly, Constantinos M. Mikelis, Mayumi F. Miller, Zhiyong Wang, Van N. Pham, Andrew E. Davis, Margaret C. Burns, Sofia A. Pezoa, Daniel Castranova, Joseph J. Yano, Tina M. Kilts, George E. Davis, J. Silvio Gutkind, View ORCID ProfileBrant M. Weinstein
doi: https://doi.org/10.1101/402362
Amber N. Stratman
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Olivia M. Farrelly
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Constantinos M. Mikelis
3Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892
6Department of Pharmaceutical Sciences, School of Pharmacy, Texas Tech University Health Sciences Center, Amarillo, TX, 79106
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mayumi F. Miller
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zhiyong Wang
2Department of Pharmacology, UC San Diego Moores Cancer Center, La Jolla, CA 92093
3Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Van N. Pham
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Andrew E. Davis
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Margaret C. Burns
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sofia A. Pezoa
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Daniel Castranova
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joseph J. Yano
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tina M. Kilts
4Craniofacial and Skeletal Diseases Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
George E. Davis
5Department of Molecular Pharmacology and Physiology, University of South Florida School of Medicine, Tampa, FL 33612
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J. Silvio Gutkind
2Department of Pharmacology, UC San Diego Moores Cancer Center, La Jolla, CA 92093
3Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Brant M. Weinstein
1Division of Developmental Biology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, 20892
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Brant M. Weinstein
  • For correspondence: flyingfish2@nih.gov
  • Abstract
  • Full Text
  • Info/History
  • Metrics
  • Preview PDF
Loading

Abstract

Anti-angiogenic therapies have generated significant interest for their potential to combat tumor growth (1-6). However, the ability of tumors to overproduce pro-angiogenic ligands and overcome targeted inhibitory therapies has hampered this approach (7, 8). A novel way to circumvent this problem might be to target the resynthesis of critical substrates consumed during intracellular transduction of pro-angiogenic signals in endothelial cells, thus harnessing the tumor’s own production of excess stimulatory ligands to deplete adjacent host endothelial cells of the capacity to respond to these signals (9-12). Here we show using zebrafish and human endothelial cells in vitro that endothelial cells deficient in CDP-diacylglycerol synthase 2 are uniquely sensitive to increased VEGF stimulation due to a reduced capacity to re-synthesize phosphoinositides, including phosphatidylinositol 4,5-bisphosphate (PIP2) a key substrate for VEGF signal transduction, resulting in VEGF-exacerbated defects in angiogenesis and angiogenic signaling (9-22). Using murine tumor allograft models (23) we show that either systemic or endothelial cell specific suppression of phosphoinositide recycling results in reduced tumor growth and reduced tumor angiogenesis. Our results suggest that inhibition of phosphoinositide recycling may provide a useful anti-angiogenic approach, and highlights the general potential of targeting the resynthesis of rate limiting signaling substrates as a valuable therapeutic strategy.

SUMMARY STATEMENT Targeting phosphoinositide recycling during tumor angiogenesis provides a potentially uniquely effective anti-cancer therapy.

Previously, we reported the discovery of a zebrafish mutant in the CDP-diacylglycerol synthase (cds2) gene with defects in angiogenesis (9). CDS activity is required for resynthesis of phosphoinositides, including phosphatidylinositol-(4,5)-bisphosphate, or PIP2 (9-11, 24) (Fig. 1A). Phosphoinositides are utilized as “second messengers” or substrates for a wide variety of different intracellular signaling pathways. In endothelial cells (EC), PIP2 serves as a key substrate for both phospholipase C-gamma 1 (PLCg1) and phosphoinositide 3-kinase (PI3K) dependent signaling downstream from the VEGF-A receptor VEGFR2 (12, 15-18, 20-22) (Fig. 1B). To regenerate PIP2 consumed during VEGF/PLCg1 signaling, diacylglycerol (DAG) is recycled to CDP-diacyglycerol (CDP-DAG) through the activity of the two vertebrate CDP-diacyglycerol synthase genes, CDS1 and CDS2 (9-22). Loss or knockdown of either one of the two CDS genes in endothelial cells in vitro or in zebrafish embryos in vivo results in reduced angiogenesis that can be rescued by artificial elevation of PIP2 levels (9). Importantly, vascular defects are observed in cds2y54 mutant zebrafish embryos in the absence of other obvious developmental abnormalities, suggesting ECs are more sensitive to partial reduction in phosphoinositide recycling capacity than other cells and tissues.

Figure 1.
  • Download figure
  • Open in new tab
Figure 1. CDS2 dependent angiogenic sprouting defects in vitro and in vivo are exacerbated by exogenous VEGF-A addition.

(A) Schematic diagram of phosphoinositide recycling. CDS1, CDS2, and IMP enzymes facilitate regeneration of phosphoinositol after PLCg-dependent consumption of PIP2 (see Fig. S10 for details). (B) VEGFR2 signaling schematic (modified from (26, 33)). (C-G) Confocal images (C-F) and quantitation (G) of trunk intersegmental vessels (ISV) in 32hpf Tg(fli-egfp)y1 WT siblings (C,E) or cds2y54 mutants (D,F) injected with control (C,D) or CMV:vegfaa (E,F) DNA. Bars in G measure ISV that have not sprouted (red), grown halfway up the trunk (blue), or formed a complete ISV (green). (H-J) HUVEC 3D invasion assay used to model angiogenesis in vitro (H), with representative images from control and CDS2 siRNA treated cultures (I,J). (K) Quantification of HUVEC cellular invasion into collagen gels at rhVEGF-A doses indicated. (L) Quantification of CDS2 siRNA HUVEC cellular invasion normalized to rhVEGF-A dose-matched controls (see methods); *Significance from control; +Significance from individual VEGF-A doses. (M-O) Phosphoinositide recycling, CDS2, and angiogenesis. (M) Under normal conditions phosphoinositide recycling maintains PIP2 levels and VEGF signal transduction. (N) Endothelium defective for CDS2 has a reduced capacity to recycle phosphoinositides, but under conditions of initial or low-level VEGF stimulation sufficient PIP2 is regenerated to maintain VEGF signal transduction. (O) During sustained and/or high-level VEGF stimulation, however, PIP2 levels cannot be maintained, leading to a collapse of VEGF signal transduction. (P) ELISA quantitation of PIP2 levels in control or CDS2 siRNA treated HUVECs incubated with 0, 40, or 200 ng/ml rhVEGF-A over a 16 hour time course, normalized to levels in initial control siRNA-treated HUVEC without added rhVEGF-A. (Q) Diagram illustrating procedure for measurement of phospho-Erk1/2 in trunk endothelial nuclei by immunofluorescence. (R) Quantitation of trunk endothelial phospho-Erk1/2 in 30 hpf cds2y54 mutants and WT siblings +/- CMV:vegfaa DNA. *Significance from control; +Significance from cds2y54 mutant - CMV:vegfaa DNA condition.

To further explore the role of phosphoinositide recycling in VEGF signaling, we injected a Tg(cmv:vegfaa) transgene (25) driving ubiquitous expression of VEGF-A into cds2y54 mutant zebrafish. Instead of promoting increased vessel growth, VEGF-A overexpression in cds2y54 null mutants or cds2 morpholino (MO) treated embryos results in dramatically reduced angiogenesis-including in the trunk intersegmental vessels, central arteries in the brain, and sub-intestinal vascular plexus (Fig. 1C-G, Fig. S1). Longitudinal imaging beginning at 24 hpf reveals that vessels fail to sprout and extend properly (Fig. S2). Sensitivity to VEGF is highly specific to cds2 mutants, as other zebrafish vascular mutants including plcg1y10, flk1y17, and etsrpy11 do not show reduced angiogenesis when injected with Tg(cmv:vegfaa) transgene (Fig. S3).

Human ECs in vitro also exhibit this seemingly paradoxical sensitivity to VEGF stimulation when CDS2 activity is reduced. Two independent siRNA targets were validated in Human Umbilical Vein Endothelial Cells (HUVECs), confirming that both suppressed CDS2 protein levels, disrupted HUVEC invasive capacity in vitro, and suppressed p-Erk1/2 and p-Akt signaling downstream of VEGF-A stimulation (Fig. S4A-C). CDS2 siRNA treatment reduces HUVEC proliferative capacity but does not induce apoptosis (Fig. S4D,E). Exposing CDS2-deficient HUVECs to increasing levels of VEGF stimulation results in decreased migratory capacity in 3-D endothelial invasion assays compared to controls (Fig. 1H-L), similar to the reduced angiogenesis noted upon VEGF stimulation in CDS2-deficient zebrafish.

Defects in CDS2 reduce the capacity of ECs to regenerate PIP2 for VEGF signal transduction (Fig. 1A,B,M,N) (9, 10, 12, 16-18, 21, 26, 27). We hypothesized that while initial and/or low-level VEGF-A stimulation of CDS2-deficient ECs might not substantially affect PIP2 levels (Fig. 1M,N), while higher levels and/or sustained VEGF-A stimulation would gradually deplete PIP2 levels, halting VEGF signal transduction (Fig. 1O). To examine this directly we measured endogenous PIP2 levels over time in control and CDS2-deficient HUVECs in vitro challenged with VEGF-A (Fig. 1P). VEGF-A stimulation does not alter endogenous PIP2 levels over a 16-hour time course in control siRNA-treated HUVECs. PIP2 levels are also not significantly reduced over 16 hours in CDS2 siRNA-treated HUVECs in the absence of exogenously added VEGF-A, although the baseline level of PIP2 is lower than in controls. In contrast, however, exogenous VEGF stimulation of CDS2 siRNA-treated HUVECs results in a time-dependent decrease in PIP2 levels, with more rapid reduction in PIP2 observed at higher VEGF-A concentrations.

If PIP2 is similarly reduced in cds2-deficient zebrafish we predicted that exogenously supplied PIP2 substrate would rescue the aberrant vascular phenotypes in ECs in vivo. Indeed, delivery of a single ‘bolus’ of PIP2 substrate supplied by intravascular injection of PIP2-loaded liposomes largely reverses the angiogenic defects in 48 hpf cds2y54 mutant zebrafish embryos (Fig. S5) (9).

VEGF signaling downstream from VEGFR2 and PLCg1 is transduced via activation (phosphorylation) of Erk1/2 (Fig. 1B). Injection of a Tg(cmv:vegfaa) transgene into control zebrafish embryos results in a modest increase in phospho-Erk1/2 levels as assessed by western blot analysis of excised zebrafish trunk tissue (Fig. S6), or a more marked increase by immunostaining analysis examining phospho-ERK1/2 specifically in trunk ECs (Fig. 1Q,R). CDS-deficient animals show somewhat decreased phospho-Erk1/2, but injection of Tg(cmv:vegfaa) transgene into CDS2-deficient zebrafish results in a more dramatic decrease in phospho-Erk1/2, both by western blot (Fig. S6) and by immunostaining analysis (Fig. 1R). Strikingly, the reduced phospho-Erk1/2 levels in VEGF-overexpressing CDS2-deficient zebrafish are comparable to those in animals injected with vegfaa morpholino (Fig. S6).

Based on our findings in zebrafish and HUVECs, we hypothesized that phosphoinositide recycling might provide an effective target for anti-angiogenic anti-tumor treatment, as the increased VEGF-A secreted by tumors responding to therapy-induced vascular insufficiency and hypoxia might facilitate anti-angiogenic effects, rather than help to overcome them (Fig. 1O, Fig. 4). We used two different murine tumor allograft models, Lewis Lung Carcinoma (LLC) (23, 28) and B16-F10 melanoma (23), to determine whether systemic or endothelial cell specific suppression of phosphoinositide recycling could specifically inhibit tumor growth and tumor angiogenesis. We employed five different experimental paradigms to target phosphoinositide recycling in these tumor models: direct targeting of CDS2 using separate translation or splice blocking vivoMorpholinos (vMO) (29), inhibition of inositol monophosphatase (IMP) activity by the potent chemical inhibitor L-690,488 (30), inhibition of IMP activity by lithium chloride (LiCl) treatment, and inducible endothelial-specific genetic deletion of Cds2 via the Cre/Lox system.

We administered murine CDS2 translation-blocking (vMO #1) or splice-blocking (vMO #2) vivo Morpholinos (vMO) (29), versus a control vMO, into mice allografted with LLC (Fig. 2A) or B16 (Fig. S7A) tumors. The vMOs were introduced directly into the circulation via tail vein or retro-orbital injection to ensure their bioavailability, beginning two days prior to the implantation of tumor cells into each flank and continuing daily throughout the time course of tumor growth (12-18 days). LLC (Fig. 2B,C) or B16-F10 (Fig. S7B-D) allografted mice treated with either of the two CDS2 vMOs show decreased tumor volume and decreased final tumor weight compared to control vMO-injected mice. Exposure of isolated B16 or LLC cells to comparable doses of CDS2 vMOs in vitro does not alter the proliferation of these cells, suggesting this is not a direct effect on the tumor cells (Fig. S7E and S8A). Quantitation of tumor vessel density in CD31 immunostained sections revealed approximately 60-80% reduction in vessel area in either LLC (Fig. 2D) or B16 (Fig. S7F-I) tumor allografts from CDS2 vMO treated animals compared to controls. Treatment with the vMOs does not change the overall mass of the mice (Fig. S8B), and liver tissue from CDS2 vMO treated mice showed no increase in Caspase 3-positive apoptotic cells or decrease in vascularization compared to livers from control vMO treated animals (Fig. S8C-E). To further address the specificity of the vMO treatment, we carried out “rescue” experiments using daily intravascular administration of PIP2 liposomes in conjunction with the vMO injections in LLC tumor allograft assays (Fig. 2E,F; following a similar logic to that applied to the zebrafish studies in Fig. S5). Daily co-injection of PIP2 liposomes into LLC allografted mice treated with the CDS2 vMO reverses the tumor growth defects noted with CDS2 vMO treatment alone (Fig. 2E,F; Fig. S8F,G).

Figure 2.
  • Download figure
  • Open in new tab
Figure 2. Anti-PIP2 recycling therapies suppress tumor growth.

(A) Schematic of Lewis Lung Carcinoma (LLC) tumor allograft assay with representative tumor images. Bar = 1 cm. (B-F) CDS2 vMO treatment. (G-K) L-690,488 small molecule inhibitor treatment. (L-O) Endothelial-specific genetic deletion of CDS2. Quantitation of average tumor volume (B,G,L), final tumor weight (C,H,M) and final tumor vascular density (D,I) at 12-15 days post-tumor implantation, in control versus CDS2 vMO or L-690,488 treated animals (B-D vs. G-I) or control or endothelial-specific CDS2 “knockout” animals (L-M). (E,F) PIP2 “rescues” CDS2 vMO tumor inhibition. Quantitation of LLC average tumor volume (E) and final tumor weight (F) at 18 days post-tumor implantation in control vMO, CDS2 #2 vMO (no liposomes), CDS2 #2 vMO + carrier liposome (no PIP2), or CDS2 #2 vMO + PIP2 loaded liposome-treated, LLC-allografted mice. Data in (E,F) are normalized to the average starting size of each individual tumor group at day 4, and shown as a percentage of the starting day 4 control (the PIP2 liposome injection start date). (J,K) Myo-inositol “rescues” L-690,488 tumor inhibition. Quantitation of LLC average tumor volume (J) and final tumor weight (K) at 15 days post-tumor implantation in control (untreated), myo-inositol-, L-690,488-, or L-690,488 + myo-inositol-treated LLC-allografted mice. Data in (J,K) are normalized to the control condition. (L-O) Endothelial-specific genetic deletion of CDS2 promotes tumor growth inhibition. Quantitation of LLC average tumor volume (L) and final tumor weight (M) at 14 days post-tumor implantation in the eight genetic conditions tested. Data in (L) are normalized to the starting day 4 tumor volume of Wild Type + TMX controls. (N) Representative tumor images of Vehicle Control (Cad5(PAC)- CreERT2;Cds2lox/lox); Cre, TMX Control (Cad5(PAC)-CreERT2 +TMX); and endothelial specific Cds2 genetic deletion mice (Cad5(PAC)-CreERT2;Cds2lox/lox+TMX). (O) Representative western blot images of EC protein isolated from tumors for each indicated genetic condition, probed for CDS2 and tubulin as a loading control. Blots demonstrate suppression of the Cds2 protein following TMX treatment in ECs isolated from tumors grown in Cad5(PAC)-CreERT2;Cds2lox/lox mice. p ≤ 0.05, ± SEM. *Significance from control. All tumor measurements are ≥ 8 tumors per treatment group. Naming key: Wild type + TMX (no Cre, no Cds2 lox cassette); Cad5(PAC)-CreERT2 +TMX (CreiECΔ only, +TMX); Cad5(PAC)-CreERT2 (CreiECΔ only, no TMX vehicle control); Cds2lox/lox +TMX (only homozygous Cds2 lox cassette, +TMX, no Cre); Cds2lox/lox (only homozygous Cds2 lox cassette, no TMX vehicle control); Cad5(PAC)- CreERT2;Cds2lox/+ +TMX (CreiECΔ, Cds2 heterozygous lox cassette, +TMX); Cad5(PAC)-CreERT2;Cds2lox/lox +TMX (homozygous lox cassette, CreiECΔ, +TMX-experimental deletion group); Cad5(PAC)-CreERT2;Cds2lox/lox (homozygous lox cassette, CreiECΔ, no TMX vehicle control)

A similar experimental paradigm was carried out using the potent inositol monophosphatase (IMP) small molecule inhibitor L-690,488 (30) in mice with LLC allografted tumors. IMP catalyzes removal of the phosphate group from inositol-1-phosphate to generate myo-inositol, which is then combined with CDP-DAG (the product of the reaction catalyzed by CDS) to regenerate phosphatidylinositol (Fig. 1A). LLC tumors from mice treated with L-690,488 show decreased tumor volume and final tumor weight compared to control DMSO-injected mice (Fig. 2G,H). Examination of tumor vessel density by CD31 immunostaining of sections revealed approximately 50-60% reduction in vessel area compared to controls (Fig. 2I). Treatment with L-690,488 does not affect the overall mass of the mice nor does it decrease normal vessel density in the liver (Fig. S9). We carried out “rescue” experiments by co-injecting myo-inositol, the downstream product of the reaction catalyzed by IMP (9, 24, 30), along with injections of L-690,488 (Fig. 2J,K). Myo-inositol administration effectively reverses tumor growth inhibition caused by L-690,488, suggesting the effects of this drug on tumor growth are specific to inhibition of IMP activity (Fig. 2J,K). To further validate our L-690,488 results, we also targeted IMP activity using lithium chloride (LiCl) treatment. Lithium is an effective inhibitor of IMP, although it also has activity against other enzymes and pathways including WNT signaling. We showed previously that LiCl inhibits angiogenesis in developing zebrafish in vivo and in EC invasion assays using HUVEC in vitro, with the specificity of these effects for IMP verified by myoinositol rescue 9. As with L-690,488, we find that treatment with LiCl inhibits tumor growth and tumor angiogenesis in both LLC and B16 allografts, and that these effects are largely reversed by co-administration of myo-inositol (Fig. S10).

All of the treatments described above involve systemic inhibition of PI recycling. In order to show that the effects on tumor growth are due to reduced PI recycling in the endothelium, we generated inducible EC-specific Cds2 knockout mice using the Cad5(PAC)-CreERT2 (31) EC specific Cre line crossed to Cds2tm1a(KOMP)Wtsi (i.e. Cds2lox/lox) mice (32). Tamoxifen was supplied to the indicated mouse groups for 5 consecutive days prior to the implantation of LLC tumors into the flanks and then suspended for the remainder of the study. LLC tumors from the Cad5(PAC)- CreERT2;Cds2lox/lox +TMX (homozygous lox cassette, CreiECΔ, +TMX-experimental deletion group) show decreased tumor volume and decreased final tumor weight compared to all other control groups (Fig. 2L-N). Western blot data of EC’s isolated from tumors shows significant suppression of CDS2 protein at the end of the 14 day experimental time course in LLC tumors from Cad5(PAC)-CreERT2;Cds2lox/lox +TMX mice (Fig. 2O).

The results described above show that anti-phosphoinositide (PI) recycling treatments effectively reduce tumor growth and tumor angiogenesis in LLC or B16 allografted mice without significant effects on the endogenous vasculature of the liver in the same animals. We hypothesized that the distinct effects of anti-PI recycling treatments on tumor versus normal vessels might reflect increased signaling and increased PIP2 substrate utilization in “activated” tumor-associated ECs compared to “quiescent” ECs in endogenous tissues and organs (Fig. 3A). We examined this by ELISA quantitation of PIP2 levels in endothelial cells obtained from tumors and lungs of tumor-allografted animals, and by measuring Erk and Akt activation by quantitation of EC fluorescence in immunostained histological sections from tumors and livers of the same mice (Fig. 3B). Tumor ECs show substantially higher phospho-Erk and phospho-Akt levels (Fig. 3C), as well as higher PIP2 levels (Fig. 3D) than liver or lung ECs (respectively). The increased angiogenic signaling in tumor-associated ECs supports the idea that systemic administration of appropriate doses of PI recycling inhibitors can have specific effects on “activated” tumor ECs but not on normal “quiescent” ECs.

Figure 3.
  • Download figure
  • Open in new tab
Figure 3. Systemic anti-PIP2 recycling therapies suppress VEGFR2 downstream signaling in LLC tumor models.

(A) Model for signaling in activated versus quiescent endothelium. (B) Diagram illustrating tissues isolated from mice and their use. (C) Quantification of phospho-Erk1/2 (black bars) and phospho-Akt (gray bars) protein levels in immunostained liver or tumor tissue from LLC allografted control animals. (D) ELISA measurement of PIP2 levels in lung or tumor endothelial cells from LLC allografted control animals. (E-N) CDS2 vMO-treated, LLC-allografted mice. Quantification of PIP2 levels by ELISA in tumor (E) or lung (J) endothelial cells isolated from the same LLC allografted animals. Quantification of phospho-Erk1/2 (F,K), phospho-Akt (G,L) and CDS2 (H,M) protein levels from immunostained sections of tumor (F-H) or liver (K-M) tissue collected from the same LLC allografted animals. (I,N) Representative images of tumor (I) or liver (N) sections from control or CDS2 vMO treated mice, double-immunostained with phospho-Erk1/2 antibody (green images) and PECAM antibody (red images). (O-T) L-690,488-treated, LLC-allografted mice. Quantification of phospho-Erk1/2 (O,R) and phospho-Akt (P,S) protein levels from immunostained sections of tumor (O,P) or liver (R,S) tissue collected from the same LLC allografted animals. (Q,T) Representative images of tumor (Q) or liver (T) sections from control (DMSO) or L-690,488 treated mice, double-immunostained with phospho-Erk1/2 antibody (green images) and PECAM antibody (red images). p ≤ 0.05, ± SEM. *Significance from control.

To determine whether systemic inhibition of PI recycling indeed preferentially reduced signaling in tumor-associated ECs as compared to quiescent endogenous ECs, we analyzed ECs from tumors (Fig. 3E-I,O-Q) or livers/lungs (Fig. 3J-N,R-T) of the same CDS2 vMO (Fig. 3E-N) or L-690,488 (Fig. 3O-T) treated, LLC-allografted mice. ECs from LLC tumors have markedly reduced PIP2, p-Akt, p-Erk1/2, and CDS2 protein levels following CDS2 vMO treatment (Fig. 3E-I; Fig. S11G-L). In contrast, EC from lungs and livers of the same CDS2 vMO treated mice show no reduction in PIP2, p-Akt, or p-Erk1/2 levels (Fig. 3J-L,N; Fig. S11B-E), despite having comparable reduction in CDS2 protein levels (Fig. 3M; Fig. S11A,F). Similar differential effects on tumor versus liver EC p-Erk1/2 and p-Akt activation were noted in mice treated with the IMP inhibitor L-690,488 (Fig. 3O-T). Taken together, these data show that systemic inhibition of PI recycling depletes PIP2 levels and causes angiogenic defects in the tumor-associated vasculature, but has little effect on the pre-existing stable lung or liver vasculature of the same animals.

Our findings highlight the important role that phosphoinositide recycling plays in tumor angiogenesis, and suggest that targeted inhibition of PI recycling may provide a useful new anti-angiogenic modality for the treatment of cancer. As noted above, the effectiveness of anti-angiogenic therapies targeting VEGF ligand, receptor, or downstream signal transduction has been hampered by the ability of tumors to overproduce VEGF and other cytokines, overcoming endothelial inhibition (Fig. 4A). The paradoxical VEGF sensitivity of ECs subjected to anti-PI recycling treatments suggests that high levels of tumor-secreted VEGF may facilitate the effectiveness of anti-PI recycling therapies rather than overcome them (Fig. 4B), although further studies will be needed to further validate this exciting possibility.

Figure 4.
  • Download figure
  • Open in new tab
Figure 4. Proposed model for inhibition of tumor growth with anti-VEGF versus anti-PIP2 recycling therapies.

Currently available anti-angiogenic therapies targeting VEGF (top) lead to an initial decrease in tumor growth and angiogenesis. However, production of high levels of pro-angiogenic ligands by tumors results in a relapse in vascular impairment and return of tumor growth. Our results indicate that targeting PI recycling leads to reduced tumor vasculature and tumor growth (bottom), and further suggest that the effects on tumor angiogenesis and tumor growth may be strengthened, not overcome, as tumor production of VEGF increases.

AUTHORSHIP

Contribution: A.N.S, C.M.M., Z.W., O.M.F, M.F.M, M.C.B, V.N.P., S.A.P., D.C., A.E.D., J.J.Y, and T.M.K. performed experiments; A.N.S, C.M.M., Z.W., O.M.F, M.F.M, S.A.P, V.N.P., S.A.P., D.C., A.E.D., J.J.Y, T.M.K., G.E.D., J.S.G., and B.M.W. analyzed results and made the figures; A.N.S, C.M.M., V.N.P., G.E.D., J.S.G., and B.M.W. designed the research and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests. Correspondence: Brant M. Weinstein, Program in Genomics of Differentiation, National Institute of Child Health and Human Development, National Institutes of Health, 6 Center Dr. Bethesda, MD 20892; e-mail: flyingfish2{at}nih.gov.

MATERIALS AND METHODS

Zebrafish Methods

Zebrafish (Danio rerio) embryos were raised and maintained as described (2, 3). The Tg(fli1a:EGFP)y1 transgenic zebrafish line was previously described(4). The cds2y25 and cds2y54 mutants were identified in an F3 genetic screen in the Tg(fli1a:EGFP)y1 background as described previously (1). Embryos imaged at developmental stages later than 36 hpf were treated with 1-phenyl-2-thiourea to inhibit pigment formation (3). Zebrafish husbandry and research protocols were reviewed and approved by the NICHD Animal Care and Use Committee.

Genotyping assays for cds2y25 and cds2y54 mutants

cds2y25: Zebrafish carrying the cds2y25 mutation were genotyped using KBiosciences Competitive Allele-Specific PCR genotyping system (KASP) assays. Assays were performed on zebrafish adult or embryonic genomic DNA extracts. Primer mixes with two 5’ fluor-labeled oligos that bind to allele-specific primers are provided with a common 3’ oligo, as per the manufactures design. y25FAM, 5’-CAGCGGGAGGAGCC TCTTC-3’ and y25HEX-5’-GCAGCGGGAGGAGCCTCTTT-3’; y25common, 5’-AAATGA AGCGATGGTATTTGCTGAGGATT-3’. Details on assay and primer design can be obtained from KBioscience. The following PCR program was designed to determine wild-type versus mutant PCR fragments: 1) 94°C, 15min; 2) 94°C, 20s; 3) 61°C 1min; 4) GOTO step 2 9x and decrease temperature in step 3 by 0.6°C each cycle; 5) 94°C, 10s; 6) 55°C, 1min; 7) GOTO step 5 35x; 8) 25°C, 5min; Plate Read and End. As primers are labeled with fluorophores, homozygous products express only one fluorescent signal while heterozygous products will result in a mixed fluorescent signal.

cds2y54: PCR was performed on zebrafish adult or embryonic genomic DNA extracts using REDTaq ReadyMix PCR Reaction Mix and the following primers: y54genotypeF-5’-AACAGCTTGATGTAGCACAGCAGAGTA-3’; y54genotypeR-5’-ATGAGGGTGTGGATGATGATGATA-3’. PCR products were then digested with MseI cutting the PCR products carrying mutant cds2 into 193bp and 124bp fragments versus wild-type cds2 products that do not cut generating a 317bp PCR product. All fish were housed as pairs in genotyping tanks (R&D Aquatics).

Zebrafish Expression Constructs and Morpholinos

pCS2(+)-zvegf165 was a gift from Dr. Ruowen Ge (National University of Singapore). CMV promoter-driven zebrafish vegf165 DNA for injection was generated as previously described. DNA was injected at a final concentration of 75 ng/uL.

Morpholino antisense oligonucleotides (Genetools) used in this study include:

cds2 ATG MO: 5’-TCGCTGTCGTAATTCTGTCATGGTG-3’ that targets −4 to 21 of the 5’ untranslated region and coding region of cds2 (1.8ng was used as a maximal dose);

vegfaa: 5’-CTCGTCTTATTTCCGTGACTGTTTT-3’ (6ng was used as a maximal dose). The cds2 and vegfaa morpholinos used have both been previously validated (1, 5). Morpholino injections were performed on zebrafish embryos in the 1-4 cell stage as previously described (4). Maximal doses were determined by titration of morpholinos to levels that yielded maximal vascular-specific phenotypes with little to no nonspecific toxic effects.

siRNA Transfection and Validation

Invitrogen single SilencerSelect or Stealth siRNAs for CDS2 versus a siRNA negative control (control) were purchased and resuspended in H2O at a concentration of 10 uM. siPORT Amine (Ambion) was used as a transfection agent (siRNA target sequences in Supplemental Table 1). A double transfection protocol was used as previously described (6, 7) with siPORT Amine and a final concentration of 50 nM siRNA per transfection condition. Validation of CDS2 siRNA suppression was previously reported (1) but reconfirmed here by western blot. The siRNA sequences utilized are as follows:

Figure16
  • Download figure
  • Open in new tab

Endothelial Cell Culture and Assays

HUVECs (Lonza) were cultured in bovine hypothalamus extract, 0.01% Heparin and 20% FBS in M199 base media (Gibco) on 1mg/mL gelatin-coated tissue culture flasks. HUVECs were used from passages 3-6.

3-dimensional (3D) in vitro angiogenesis assays were done essentially as described (6, 7), 2.5mg/mL collagen type I (BD Bioscience, Acid Extracted) gels were prepared including SCF, SDF1α and IL-3 in the gel at 200 ng/mL and VEGF-A165 at the indicated doses described in the manuscript. HUVECs were seeded on the gel surface at a density of 40,000 cells/well. Culture media included FGF and IGF-II. Assays were fixed in 3% glutaraldehyde at the indicated time points and processed for future analysis. Cells were stained with 1% toluidine blue in 30% methanol to increase visualization before imaging. Data analysis was done by imaging the endothelial cell invasive front at 3 depths below the monolayer of cells (approximately 50uM apart in depth). Images were obtained and the number of endothelial cells present at each depth counted; the counts at the 3 depths were added together to give a total number of invading cells per well. A minimum of 5 replicate wells was averaged to give a mean ± SD within a single experiment. At least 2 experimental replicates were performed. Data is represented as a percentage of the 10ng/ml VEGF Control siRNA condition (Figure 1J-% Average number of invading cells) or as a percentage of invasion inhibition at each indicated VEGF dose (Figure 1H-calculated by taking % Invading number of CDS2 KD cells/% Invading number of Paired Control cells = % Invasion Inhibition).

PI(4,5)P2 Quantification

siRNA treated HUVECs were plated on collagen type I-coated plastic wells, allowed to attach overnight and then treated with the indicated doses of rhVEGF-A for predetermined times prior to PIP2 quantification.

PIP2 quantification was done using a competitive ELISA Kit purchased from Echelon Biosciences (Echelon Biosciences, #K-4500) or utilizing a direct ELISA protocol for measuring PIP2 levels as previously modified and described (8). PIP2 lipid was extracted following Echelon Biosciences manufacturer recommendations. Absorbance was read using a plate reader at 450 nm. No detergent was used for washes to maintain the PIP2 lipid integrity. Samples were assessed in triplicate, normalized to cell number as assessed by counting 4 individual high powered fields (trypsin treatment of the cells can alter lipid levels and is not advised if it can be avoided), and results given as mean relative PIP2 levels as compared to control untreated cells ± SD for a single experiment or ± SEM when averaging multiple experiments. At least 2-3 experimental replicates were performed.

For measurements of PIP2 levels in lung ECs and tumor associated ECs, competitive ELISAs protocols were done as described above. Results were normalized to input protein levels based on Western blot tubulin expression.

Injection of PI(4,5)P2 Liposomes

Purified PI(4,5)P2 liposomes (Echelon Biosciences) were incubated in equal molar concentration (40uM) with lipid carrier constructs (Histone H1 Carrier #2, Echelon Biosciences) for 10 minutes at room temperature prior to intra-vascular injection into either the zebrafish or mice. For zebrafish studies, a single 15nl ‘bolus’ injection of BODIPY labeled PIP2 was delivered over the course of 2-3 minutes into the sinus venosus at 48 hpf. Only fish showing substantial and predominantly vascular dispersion of the BODIPY labeled PIP2 were utilized for ISV quantification analysis. Data analysis was done at 72 hpf. For mouse studies, daily retro-orbital injections of PIP liposomes were done versus lipid carrier alone conditions.

Immunoanalysis

Zebrafish trunk tissue was collected using no. 55 superfine forceps to remove the head and dissect off the yolk ball. Tissue was directly lysed in 2x Laemmli Sample Buffer containing 5% β-ME and a PhosSTOP tablet (Roche), 10 ul per embryo. HUVEC culture lysates were harvested directly into the same lysis buffer described above. Antibodies: p-Erk1/2, T. Erk, p-Akt, T. Akt (Cell Signaling Technologies), Tubulin (Sigma), CDS2 (ProteinTech, 13175-1-AP) and used at 1:1000 in 5% BSA. Secondary HRP-conjugated antibodies were purchased from Santa Cruz or Invitrogen and used at 1:2000 in 5% milk. Quantification of relative band intensity was performed by ImageJ image analysis software, with results shown from at least two independent HUVEC assays, two independent zebrafish clutches, or two-three independent western blots from pooled EC samples collected from a minimum of 2-4 tumors/lungs.

Tumor Allografts

All animal studies were carried out according to NIH-approved protocols, in compliance with the Guide for the Care and use of Laboratory Animals. B16-F10 or LLC tumor cells were maintained in 10% FBS/DMEM growth media. Prior to tumor injection into B6/C57 mice, the mice were shaved to remove hair at the site of tumor growth and facilitate tumor identification and volume measurements. On the day of injection, the tumor cells were trypsinized and resuspended in PBS. 200 ul of PBS/cell suspension containing 106 cells was injected into each flank. For LiCl studies, normal saline (control), LiCl (400 mg/kg), myoinositol (400 mg/kg), or LiCl+myoinositol in 200 uL normal saline were injected daily IP. For vMO (Gene Tools) studies, control vMO (sequence: CCCTGTCCCCTACTTCGCTCATGCT), CDS2 vMO #1 (CCTCTGCCG TAGTTCGGTCATGCT), CDS2 vMO #2 (GGCTTGTCAACGATACTTACAATCA) were injected through the tail vein or retro-orbitally at a dose of 40 ul of 2000 nmol stock per mouse per day. vMO were stored at room temperature and heated at 65°C for 15 min prior to use. To verify suppression of the CDS2 gene in vMO treated mice, endothelial cells were isolated from the lungs at the termination of the studies (see below), and lysed for protein analysis to verify protein suppression. L-690,488 chemical inhibitor was purchased from Tocris (#0682), resuspended in DMSO at 100mM and supplied via retro-orbital injection at a daily dose of 80uM per animal daily. For endothelial specific genetic suppression of Cds2, tamoxifen was injected IP daily at a dose of 1mg/mouse in corn oil for 5 days prior to allograft of the tumors. The Cds2 mouse strain used for this research project was created from ES cell clone EPD0033_1_C08 obtained from KOMP Repository (www.komp.org) and generated by the Wellcome Trust Sanger Institute (9). Endothelial cells were isolated from both lungs and tumors at the end of the 14 day experiment to confirm Cds2 protein suppression. 8 groups were generated:

Wild type + TMX (no Cre, no floxed Cds2, tamoxifen added CONTROL)

Cad5(PAC)-CreERT2 +TMX (cre driver alone, tamoxifen added CONTROL)

Cad5(PAC)-CreERT2 (cre driver alone, no tamoxifen CONTROL)

Cds2lox/lox +TMX (homozygous floxed Cds2, no cre, tamoxifen added CONTROL)

Cds2lox/lox (homozygous floxed Cds2, no cre, no tamoxifen CONTROL)

Cad5(PAC)-CreERT2;Cds2lox/+ +TMX (heterozygous EC-specific knockout)

Cad5(PAC)-CreERT2;Cds2lox/lox +TMX (homozygous EC-specific knockout)

Cad5(PAC)-CreERT2;Cds2lox/lox (cre driver, homozygous floxed Cds2, no tamoxifen CONTROL)

For all experiments, calipers were used to measure the approximate tumor volume daily, with final weight measurements (mg) made at the termination of the experiment. Tumors were allowed to grow until control tumors reached a volume of approximately 500-1000 mm3, day 18 was reached, or significant impairment to the mouse motility from tumor burden was noted.

Measurement of Tumor Vascularization

B16-F10 or LLC tumors or livers from the treatment mice were collected for analysis and paraffin embedded for H&E and immunofluorescent staining or preserved in OCT medium for cryo-sections. At minimum, 4 livers or 8 tumors of each type were embedded and serially sectioned for vessel density analysis. Immunofluorescent labeling of CD31/PECAM (BD Biosciences #550274, 1:10) and active Caspase3 (Sigma, 1:1000) was done and slides counterstained with HOECHST (Molecular Probes #33342, 1:2000). Images were taken using a Leica Inverted TCS-SP5 II confocal microscope and 20x objective. Three images were taken randomly from within the liver or the tumor body and the average vessel area and average vessel diameter measured per high powered imaging field. Average vessel area was measured using ImageJ, measuring the average CD31/PECAM+ area per high power image field. Average vessel widths were calculated by measuring the distance across the cross-sectioned lumen diameter. 50 measurements were made across vessels per high power image. The data are reported as a mean ± SEM.

Quantification of Tumor Cell Proliferation

For tumor cell proliferation in the presence of LiCl: B16 or LLC tumor cells were plated in 24 well plates in 500 ul of 10% FBS/DMEM. Cells were allowed to attach and LiCl or vMO added. Estimated concentrations of LiCl were determined proportionally based off of doses provided in vivo to the mice (whole mouse dose/approximate tissue volume = x concentration). 10uM (estimated equivalent concentration to mouse dose) and 20uM (estimated double concentration to mouse dose) concentrations of LiCl were added to the growth media daily and proliferation assessed over a multi-day time course. Culture media was changed completely every 3 days for the duration of the time course. For tumor cell proliferation in the presence of vMO: Concentrations for the vMOs were determined based off of the estimated mouse blood volume (approximately 2ml) and proportioned to the volume of tissue culture media present in the assay. A daily dose of 4ul of the 2000nmol stock per well was added to 24 well plates containing 500 ul of 10% FBS/DMEM. Media was changed completely every three days. For both assays, cells were fixed using 2% PFA and stained with HOECHST dye. 5 distinct images per well were assessed and the number of nuclei per well counted. The data are reported as the averages between images ± SD.

Isolation of mouse lung microvascular endothelial cells or tumor associated endothelial cells

Isolation of mouse lung or tumor microvascular endothelial cells was performed essentially according to a previously described protocol (10). Modifications are briefly described, lungs were removed from the mice, washed in 10% FBS/DMEM, minced into 1-2 mm squares and digested with Collagenase Type I (2 mg/ml, Gibco) at 37°C for 2 h with occasional agitation. The cellular digest was filtered through a 70 um cell strainer, centrifuged at 1500 rpm and the cells immediately incubated with Dynabead sheep anti-rat IgG (Invitrogen) coated with a rat anti-mouse ICAM-2 mAb (3C4) at room temperature for 10 minutes. The bead-bound cells were recovered with a magnet, washed four times, and the cells immediately collected for protein lysates and PIP2 ELISA protocols. All isolation steps were done in the presence of phosphatase inhibitors.

Statistics

Statistical analysis of data was done using SPSS or Microsoft Excel. Statistical significance was set at a minimum of P ≤ 0.05, and is indicated in individual figure legends. Student t-tests were used when analyzing 2 groups within a single experiment.

Study Approval

Zebrafish and mouse husbandry and research protocols were reviewed and approved by the NICHD and NIDCR Animal Care and Use Committee at the National Institutes of Health. All animal studies were carried out according to NIH-approved protocols, in compliance with the Guide for the Care and use of Laboratory Animals.

ACKNOWLEDGEMENTS

The authors would like to thank members of the Weinstein laboratory for their critical comments on this manuscript. This work was supported by the intramural program of the National Institute of Child Health and Human Development, National Institutes of Health (NIH; B.M.W.), the intramural program of the National Institute of Dental and Craniofacial Research, National Institutes of Health (NIH; J.S.G), and K99/R00 Pathway to Independence Award (4R00HL125683 – 02; A.N.S.).

REFERENCES

  1. 1.↵
    J. Folkman, Anti-angiogenesis: new concept for therapy of solid tumors. Annals of surgery 175, 409–416 (1972).
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.
    G. Bergers, L. E. Benjamin, Tumorigenesis and the angiogenic switch. Nature reviews. Cancer 3, 401–410 (2003).
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.
    P. Carmeliet, Angiogenesis in life, disease and medicine. Nature 438, 932–936 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  4. 4.
    P. Carmeliet, R. K. Jain, Angiogenesis in cancer and other diseases. Nature 407, 249–257 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.
    K. R. Kidd, B. M. Weinstein, Fishing for novel angiogenic therapies. British journal of pharmacology 140, 585–594 (2003).
    OpenUrlCrossRefPubMed
  6. 6.↵
    R. S. Kerbel, Tumor angiogenesis. The New England journal of medicine 358, 2039–2049 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  7. 7.↵
    A. Abdollahi, J. Folkman, Evading tumor evasion: current concepts and perspectives of anti-angiogenic cancer therapy. Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy 13, 16–28 (2010).
    OpenUrl
  8. 8.↵
    G. Bergers, D. Hanahan, Modes of resistance to anti-angiogenic therapy. Nature reviews. Cancer 8, 592–603 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  9. 9.↵
    W. Pan et al., CDP-diacylglycerol synthetase-controlled phosphoinositide availability limits VEGFA signaling and vascular morphogenesis. Blood 120, 489–498 (2012).
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    E. Im, A. Kazlauskas, Regulating angiogenesis at the level of PtdIns-4,5-P2. The EMBO journal 25, 2075–2082 (2006).
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    E. Im, A. Kazlauskas, PtdIns-4,5-P2 as a potential therapeutic target for pathologic angiogenesis. Expert opinion on therapeutic targets 11, 443–451 (2007).
    OpenUrlPubMed
  12. 12.↵
    N. D. Lawson, J. W. Mugford, B. A. Diamond, B. M. Weinstein, phospholipase C gamma-1 is required downstream of vascular endothelial growth factor during arterial development. Genes & development 17, 1346–1351 (2003).
    OpenUrlAbstract/FREE Full Text
  13. 13.
    S. Halford, K. S. Dulai, S. C. Daw, J. Fitzgibbon, D. M. Hunt, Isolation and chromosomal localization of two human CDP-diacylglycerol synthase (CDS) genes. Genomics 54, 140–144 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.
    S. L. Inglis-Broadgate et al., Isolation and characterization of murine Cds (CDP-diacylglycerol synthase) 1 and 2. Gene 356, 19–31 (2005).
    OpenUrlCrossRefPubMed
  15. 15.↵
    N. D. Lawson, B. M. Weinstein, In vivo imaging of embryonic vascular development using transgenic zebrafish. Developmental biology 248, 307–318 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  16. 16.↵
    B. Ren et al., ERK1/2-Akt1 crosstalk regulates arteriogenesis in mice and zebrafish. The Journal of clinical investigation 120, 1217–1228 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.
    M. Shibuya, L. Claesson-Welsh, Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis. Experimental cell research 312, 549–560 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  18. 18.↵
    A. N. Stratman, M. J. Davis, G. E. Davis, VEGF and FGF prime vascular tube morphogenesis and sprouting directed by hematopoietic stem cell cytokines. Blood 117, 3709–3719 (2011).
    OpenUrlAbstract/FREE Full Text
  19. 19.
    M. Volta et al., Identification and characterization of CDS2, a mammalian homolog of the Drosophila CDP-diacylglycerol synthase gene. Genomics 55, 68–77 (1999).
    OpenUrlCrossRefPubMedWeb of Science
  20. 20.↵
    C. M. Warren, M. L. Iruela-Arispe, Signaling circuitry in vascular morphogenesis. Current opinion in hematology 17, 213–218 (2010).
    OpenUrlPubMed
  21. 21.↵
    B. M. Weinstein, N. D. Lawson, Arteries, veins, Notch, and VEGF. Cold Spring Harbor symposia on quantitative biology 67, 155–162 (2002).
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    M. Kamei, S. Isogai, W. Pan, B. M. Weinstein, Imaging blood vessels in the zebrafish. Methods in cell biology 100, 27–54 (2010).
    OpenUrlCrossRefPubMed
  23. 23.↵
    J. S. Palumbo et al., Fibrinogen is an important determinant of the metastatic potential of circulating tumor cells. Blood 96, 3302–3309 (2000).
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    J. R. Atack, H. B. Broughton, S. J. Pollack, Inositol monophosphatase--a putative target for Li+ in the treatment of bipolar disorder. Trends in neurosciences 18, 343–349 (1995).
    OpenUrlCrossRefPubMedWeb of Science
  25. 25.↵
    D. Liang et al., Cloning and characterization of vascular endothelial growth factor (VEGF) from zebrafish, Danio rerio. Biochimica et biophysica acta 1397, 14–20 (1998).
    OpenUrlCrossRefPubMed
  26. 26.↵
    C. C. Hong, Q. P. Peterson, J. Y. Hong, R. T. Peterson, Artery/vein specification is governed by opposing phosphatidylinositol-3 kinase and MAP kinase/ERK signaling. Current biology : CB 16, 1366–1372 (2006).
    OpenUrl
  27. 27.↵
    D. Liang et al., The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mechanisms of development 108, 29–43 (2001).
    OpenUrlCrossRefPubMedWeb of Science
  28. 28.↵
    M. S. O’Reilly, S. Pirie-Shepherd, W. S. Lane, J. Folkman, Antiangiogenic activity of the cleaved conformation of the serpin antithrombin. Science 285, 1926–1928 (1999).
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    P. A. Morcos, Y. Li, S. Jiang, Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques 45, 613-614, 616, 618 passim (2008).
    OpenUrlCrossRefPubMedWeb of Science
  30. 30.↵
    J. R. Atack et al., Effects of L-690,488, a prodrug of the bisphosphonate inositol monophosphatase inhibitor L-690,330, on phosphatidylinositol cycle markers. J Pharmacol Exp Ther 270, 70–76 (1994).
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    Y. Wang et al., Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis. Nature 465, 483–486 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  32. 32.↵
    W. C. Skarnes et al., A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474, 337–342 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  33. 33.↵
    C. C. Hong, T. Kume, R. T. Peterson, Role of crosstalk between phosphatidylinositol 3-kinase and extracellular signal-regulated kinase/mitogen-activated protein kinase pathways in artery-vein specification. Circulation research 103, 573–579 (2008).
    OpenUrlAbstract/FREE Full Text

ONLINE REFERENCES

  1. 1.↵
    W. Pan et al., CDP-diacylglycerol synthetase-controlled phosphoinositide availability limits VEGFA signaling and vascular morphogenesis. Blood 120, 489–498 (2012).
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    C. B. Kimmel, W. W. Ballard, S. R. Kimmel, B. Ullmann, T. F. Schilling, Stages of embryonic development of the zebrafish. Dev Dyn 203, 253–310 (1995).
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    M. Westerfield, The Zebrafish Book. Eugene, University of Oregon Press, (1995).
  4. 4.↵
    N. D. Lawson, B. M. Weinstein, In vivo imaging of embryonic vascular development using transgenic zebrafish. Developmental biology 248, 307–318 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    S. P. Herbert et al., Arterial-venous segregation by selective cell sprouting: an alternative mode of blood vessel formation. Science 326, 294–298 (2009).
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    W. Koh, A. N. Stratman, A. Sacharidou, G. E. Davis, In vitro three dimensional collagen matrix models of endothelial lumen formation during vasculogenesis and angiogenesis. Methods in enzymology 443, 83–101 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  7. 7.↵
    A. N. Stratman, M. J. Davis, G. E. Davis, VEGF and FGF prime vascular tube morphogenesis and sprouting directed by hematopoietic stem cell cytokines. Blood 117, 3709–3719 (2011).
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    W. Pan et al., Wnt3a-mediated formation of phosphatidylinositol 4,5-bisphosphate regulates LRP6 phosphorylation. Science 321, 1350–1353 (2008).
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    W. C. Skarnes et al., A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474, 337–342 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  10. 10.↵
    E. Y. Choi et al., Del-1, an endogenous leukocyte-endothelial adhesion inhibitor, limits inflammatory cell recruitment. Science 322, 1101–1104 (2008).
    OpenUrlAbstract/FREE Full Text
Back to top
PreviousNext
Posted April 18, 2019.
Download PDF
Email

Thank you for your interest in spreading the word about bioRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Enter multiple addresses on separate lines or separate them with commas.
Anti-angiogenic effects of VEGF stimulation on endothelium deficient in phosphoinositide recycling
(Your Name) has forwarded a page to you from bioRxiv
(Your Name) thought you would like to see this page from the bioRxiv website.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Anti-angiogenic effects of VEGF stimulation on endothelium deficient in phosphoinositide recycling
Amber N. Stratman, Olivia M. Farrelly, Constantinos M. Mikelis, Mayumi F. Miller, Zhiyong Wang, Van N. Pham, Andrew E. Davis, Margaret C. Burns, Sofia A. Pezoa, Daniel Castranova, Joseph J. Yano, Tina M. Kilts, George E. Davis, J. Silvio Gutkind, Brant M. Weinstein
bioRxiv 402362; doi: https://doi.org/10.1101/402362
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
Anti-angiogenic effects of VEGF stimulation on endothelium deficient in phosphoinositide recycling
Amber N. Stratman, Olivia M. Farrelly, Constantinos M. Mikelis, Mayumi F. Miller, Zhiyong Wang, Van N. Pham, Andrew E. Davis, Margaret C. Burns, Sofia A. Pezoa, Daniel Castranova, Joseph J. Yano, Tina M. Kilts, George E. Davis, J. Silvio Gutkind, Brant M. Weinstein
bioRxiv 402362; doi: https://doi.org/10.1101/402362

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Subject Area

  • Cell Biology
Subject Areas
All Articles
  • Animal Behavior and Cognition (2646)
  • Biochemistry (5266)
  • Bioengineering (3678)
  • Bioinformatics (15796)
  • Biophysics (7253)
  • Cancer Biology (5627)
  • Cell Biology (8095)
  • Clinical Trials (138)
  • Developmental Biology (4765)
  • Ecology (7516)
  • Epidemiology (2059)
  • Evolutionary Biology (10576)
  • Genetics (7730)
  • Genomics (10131)
  • Immunology (5193)
  • Microbiology (13905)
  • Molecular Biology (5385)
  • Neuroscience (30779)
  • Paleontology (215)
  • Pathology (879)
  • Pharmacology and Toxicology (1524)
  • Physiology (2254)
  • Plant Biology (5022)
  • Scientific Communication and Education (1041)
  • Synthetic Biology (1385)
  • Systems Biology (4146)
  • Zoology (812)