Abstract
Citrullination, the deimination of arginine residues into citrulline, has been implicated in the aetiology of several diseases. In multiple sclerosis (MS), citrullination is thought to be a major driver of pathology, through hypercitrullination and destabilization of myelin. As such, inhibition of citrullination has been suggested as a therapeutic strategy for MS. Here, in contrast, we show citrullination by peptidylarginine deiminase 2 (PADI2) is required for normal oligodendrocyte differentiation, myelination and motor function. We identify several targets for PADI2, including myelin-related proteins and chromatin-associated proteins, implicating PADI2 in epigenetic regulation. Accordingly, we observe that PADI2 inhibition and its knockdown affect chromatin accessibility and prevent the upregulation of oligodendrocyte differentiation genes. Moreover, mice lacking PADI2, display motor dysfunction and decreased number of myelinated axons in the corpus callosum. We conclude that citrullination is required for oligodendrocyte lineage progression and myelination and suggest its targeted activation in the oligodendrocyte lineage might be beneficial in the context of remyelination.
Introduction
The conversion of a peptidylarginine into a peptidylcitrulline can introduce profound changes in the structure and function of the modified protein. This posttranslational modification, also known as protein citrullination or deimination, is calcium dependent and is mediated by the family of enzymes called peptidylarginine deiminases (PADIs)1. Five PADI isozymes (PADI1, 2, 3, 4 and 6) have been identified in mammals, and their expression pattern and function is tissue-specific2. Citrullination has been recently shown to play key roles in multiple cellular processes such as inflammatory immune responses3, apoptosis4, and regulation of pluripotency5. In the central nervous system (CNS), PADI2 is the most prevalent expressed PADI and occurs preferentially in oligodendrocytes (OL) and other glial cells6. OLs arise at postnatal stages from the differentiation of OL precursor cells (OPCs) and their most prominent function is the formation of the myelin sheath, an electrical insulating layer for the axons, essential for proper neuronal communication and thus CNS function7.
PADI2 has been reported to heavily citrullinate myelin binding protein (MBP), a fundamental myelin component. The ratio MBPcit/MBPtotal is high in the first four years of life and similarly in multiple sclerosis (MS), a disease where demyelination occurs8. Upon citrullination, MBP arginine residues lack positive charges, thereby having a reduced interaction with the negatively charged lipids. Consequently, citrullinated MBP does not form compact sheaths and the myelin remains immature or becomes unstable9. In accordance, transgenic mice overexpressing PADI2 in OL cells display myelin loss10. In light of this, PADIs, and in particular PADI2, have been thought to have a detrimental effect in MS and thus an improvement of the disease symptoms can be achieved by inhibiting their actions11. Indeed, treatment of a MS mouse model Experimental Autoimmune Encephalomyelitis (EAE) with 2-chloroacetamidine (2-CA), a PADI2 and −4 inhibitor leads to disease attenuation12. The improvement on disease progression by 2-CA treatment was not specifically assigned to the lack of PADI activity in OL lineage cells alone but to inhibition of all PADI-expressing cells, including immune cells that play an essential role in the disease development.
Interestingly, however, no changes in disease progression were observed upon EAE induction in PADI2 KO mice13. This could point to a possible compensation of PADI2 functions by other PADIs, or to additional functions of PADI2 in EAE disease progression. While citrullination of myelin might play an important role in MS, other proteins such as histone H3 have been found to be citrullinated in MS14. Thus, the role of PADI2-mediated citrullination in MS might not be confined to myelin. Furthermore, while the effects of Padi2 overexpression in OL have been characterized, its absence in OL lineage cells has not been further investigated, nor its physiological function in OL lineage cells and its significance for the myelin integrity maintenance.
Results
Padi2 expression is increased upon OL differentiation
By analyzing our single-cell RNA-Seq dataset of the OL lineage in the adult and juvenile mouse brain15, we identified Padi2 as the predominant Padi expressed in OLs (Supplementary Fig. 1a). Interestingly, Padi2 expression is found in OPCs, increases in committed OL precursors (COPs) and newly formed OLs (NFOLs) and peaks at more mature stages (Supplementary Fig. 1a). Surprisingly, we did not observe expression of Padi4, which has been previously suggested to be present in myelin14,16. To further investigate the pattern of expression of Padi2 during OL lineage progression, we cultured OPCs isolated from postnatal day P1-P4 brains of the transgenic mouse line Pdgfra-histone 2b (H2B)-GFP17 in which GFP expression is under the control of the endogenous Pdgfra promoter locus. GFP+ OPCs were collected with fluorescence activated cell sorting (FACS) to plates and expanded in media containing the growth factors (GFs) bFGF and PDGFAA and differentiated into OLs by removing the GFs for 2 days (Fig. 1a). Gene expression of the differentiation markers Mbp and Sox10 was upregulated and the progenitor marker Pdgfra was reduced upon GFs removal (Fig. 1b). In agreement with the single-cell RNA-seq data, Padi2 was expressed in OPCs and it was greatly enhanced upon differentiation (Fig. 1b and Supplementary Fig. 1b). To investigate Padi2 expression in the OL lineage in vivo, we isolated OPCs and OLs from the brain of the transgenic mouse line Pdgfra-Cre-loxP-GFP18 in which all OL lineage cells express the GFP reporter (Fig. 1c). GFP+ OPCs were collected with FACS from P1-P4 pups (all GFP+ cells are OPCs since OLs are not formed yet) and GFP+ CD140-OLs were collected with FACS from juvenile (P21) and adult (P60) mice (at this stage GFP+ cells comprise all OL progeny including CD140+ OPCs). As a confirmation of the sorted populations we have assessed the expression of Pdgfra and Mbp as markers for OPCs and differentiated oligodendrocytes, respectively (Fig. 1d). Padi2 mRNA was substantially enriched in OLs from both juvenile and adult brains when compared to postnatal OPCs (Fig. 1d). At the protein level, and in agreement with our gene expression data, we observed a continuous increase in PADI2 protein from P1 to adult in the spinal cord of wild type mice, concomitant with the increase in the OL marker MBP (Fig. 1e). Thus, PADI2 is rapidly upregulated upon OPC differentiation, suggesting a role of this citrullinating enzyme at this stage of OL lineage progression.
Reduction of PADI2 activity hinders OL differentiation
In order to investigate whether the increased expression of PADI2 upon OL differentiation has a functional significance, we inhibited PADI activity in the mouse OPC cell line Oli-neu19 and rat primary OPCs, using Cl-amidine, a pan-inhibitor of PADI enzymes. Strikingly, Oli-neu cells failed to differentiate in the presence of this inhibitor, as observed by the lack of cell branching typical of differentiating OLs shown with CNPase immunostaining (Fig. 2a). In accordance, gene expression analysis on undifferentiated and differentiated Oli-neu cells treated with Cl-Amidine revealed a striking impairment on OPC differentiation. The increase of Mbp, Sox10 and Mog mRNA levels, crucial for proper OPC differentiation, was no longer observed after Cl-Amidine during differentiation (Fig. 2b). Interestingly, the expression of the transcription factor (TF) Sox9, required for OL specification20 and downregulated upon OPC differentiation15, was increased upon PADI inhibition (Fig. 2b). Similar results were obtained by treating Oli-neu with another PADI-inhibitor 2-CA (Supplementary Fig. 1c). Importantly, these effects were also observed in rat OPC primary cultures, where under differentiating conditions, the treatment with Cl-Amidine impaired differentiation as observed by the lower mRNA expression levels of the differentiation markers Mog and Mag (Fig. 2c).
To investigate whether the effect of PADI inhibitors was due to PADI2 inhibition, we specifically decreased Padi2 mRNA levels in mouse primary FACS OPCs by transfecting cells with siRNA against Padi2 (targeting exon 2). Similar to PADI inhibition, the reduction of Padi2 expression led to a decrease in the mRNA levels of Sox10 and Mog and an increase in Sox9 (Fig. 2d). Mog mRNA levels were also reduced in Padi2 knockdown conditions after 2-days of differentiation (Fig. 2d). Likewise, Padi2 knockdown in Oli-neu cells mimicked the effects of PADI inhibition (Supplementary Fig. 1d). Thus, our findings indicate that PADI2 is dramatically increased on the onset of OL differentiation, where it contributes to the transition from an OPC state to a NFOL state.
OLs are reduced in conditional Padi2 knockout mouse lines
To investigate if the observed effects of PADI2 have an impact on OL differentiation and myelin maintenance in vivo, we generated a Padi2 conditional knock-out (cKO) mouse line, Pdgfra-Cre; RCE:loxP; Padi2−/− where Padi2 is not present in any cells derived from Pdgfra+ cells, which include the whole OL lineage. We estimated the number of CC1+ cells per area at P21, in both corpus callosum and in the dorsal funicullus of the spinal cord. In accordance to our results in Oli-neu and primary FACS OPC cultures (Fig. 2), we observed a reduction in the number of CC1+ OLs in the spinal cord of Padi2 cKO mice, compared to littermate controls (Fig. 3a, b). Nevertheless, we did not observe such an effect in the corpus callosum (Fig. 3a). This finding led us to further investigated if these OLs exhibited the same levels of OL-related genes by performing qPCR on the brains of P21 controls and Padi2 cKO. We observed that Pdgfra, Mbp and Mog mRNA were unaltered in FACS cKO GFP+ cells (Supplementary Fig. 2c), indicating that the effect of Padi2 cKO is more prominent in posterior regions of the CNS.
We also generated an inducible Padi2 cKO (indKO) mouse line, Pdgfra-CreERT; RCE:loxP; Padi2−/−, where Padi2 could be ablated from OPCs by tamoxifen treatment at early postnatal stages (Fig. 3c). Since we observed that PADI2 mainly modulates the transition between OPCs and NFOLs in vitro (Fig. 2), we depleted Padi2 specifically at the onset of OPC differentiation by injecting mice with tamoxifen at P6 and collecting the brains and spinal cord at P11 (Fig. 3c). We show a reduction, although not statistically significant (p=0.0828 for corpus callosum and p=0,0567 for spinal cord), of OLs formed upon tamoxifen-induced OPC Padi2 depletion, as assessed by the percentage of CC1+ cells out of total GFP+ in the corpus callosum and in the spinal cord of Padi2 indKO animals, compared to littermate controls (Fig. 3d). Thus, our results in two independent mouse lines where Padi2 is ablated from the OPC stage suggest that PADI2 is important for the generation of OLs in vivo.
Padi2 knockout mice display impaired motor and cognitive functions, and a decrease in the number of myelinated axons
Given the decrease in OLs upon Padi2 cKO in the OL lineage and the targeting of myelin proteins by PADI2, we investigated whether Padi2 cKO mice presented a behavioral phenotype, in comparison with controls. Interestingly, Padi2 cKO mice exhibited impairment in motor coordination and balance as assessed by decreased latency to fall in the rotarod test (Fig. 4a). Moreover, we observed similar impairments in the full Padi2 KO (Padi2 fKO), where exon 1 of Padi2 is deleted in all cells13. In addition, we found an increase in the number of slips on the beam test in the Padi2 cKO mice, strengthening the motor impairment phenotype (Fig. 4b). Strikingly, when testing the Padi2 cKO mice for cognitive functions, these mice performed worse in the novel object recognition test, displaying a decrease in the discrimination index that provides an indication of recognition memory (Fig. 4c).
To further investigate the mechanisms underlying the impact of PADI2 on motor and cognitive functions we have analyzed the myelin structure of the Padi2 fKO mice and respective controls by Electron Microcopy (EM). We found a significant decrease in the number of myelinated axons in the corpus callosum of adult mice together with a decrease in the g-ratio of small diameter axons and an increase in the g-ratio of axons with 0.6-0.9 μm diameter (Fig. 4d-f). Moreover, the percentage of myelinated axons was decreased in Padi2 fKO mice compared to controls (Fig. 4g). As such, our results indicate that PADI2 plays an important role for efficient OL differentiation and myelination, as evidenced by the motoric and cognitive defects occurring upon its ablation.
PADI2 is present in both nucleus and cytoplasm in OL lineage cells
To disclose the possible mechanisms of action underlying the observed in vitro and in vivo effects, we have further investigated the cellular location of Padi2 in OL lineage cells. Despite that PADI4 is the only one displaying a nuclear localization signal (NLS), PADI2 has recently been detected in the nucleus of mammary epithelial cells21 and was described to be able to citrullinate nuclear histone H3R26 in MC7 breast cancer cells22. Remarkably, immuno-cytochemistry analysis showed the presence of PADI2 protein both in the nucleus and in the cytoplasm of OPCs (MBP-negative) and OLs (MBP-positive) (Fig. 5a). In order to confirm the localization of PADI2 in the nucleus, we transfected Oli-neu cells with the fusion vector Padi2-ZsGreen. We observed the presence of the green fusion protein both in the nucleus and cytoplasm of these cells (Fig. 5b), indicating that PADI2 can indeed be nuclear in OL lineage cells and might thereby regulate transcription through epigenetic mechanisms.
PADI2 citrullinates nuclear proteins
To determine what could be the molecular targets of PADI2 in both nuclei and cytoplasm, we generated a stable Padi2 overexpressing Oli-neu cell line, where citrullination activity was greatly enhanced when tested in an Antibody-based assay for PADI activity (ABAP)23 (Supplementary Figure 2a), and performed quantitative proteomics, by applying stable isotope labeling of amino acids in cell culture (SILAC) followed by mass spectrometry24. SILAC relies on the incorporation of a light (12C) or a heavy (13C) isotopic version of lysine into proteins of control and overexpressing Padi2 cell lines, respectively. The proteomes of fully light (L) and heavily (H) labelled cells were mixed 1:1 and the relative dissimilarities in the proteome citrullination target sites of these cell populations was determined and quantified by mass spectrometry (Fig. 5c). Interestingly, we observed a striking difference in the number of citrullination targets and ratios between proliferating and differentiating Oli-neu cells (Fig. 5d). In the proteome of proliferating Oli-neu, we found up to 151 citrullination sites, of which 81 were upregulated (H/L SILAC ratio higher than 1.5) with Padi2 overexpression. In contrast, up to 500 citrullination sites were identified in differentiating Oli-neu cells, of which 347 were upregulated upon Padi2 overexpression (Fig. 5d and Supplementary Table 1). These observations indicate that OLs have an intracellular environment that is more permissive to PADI2 activity than OPCs.
We also uncovered citrullination sites arising only with Padi2 overexpression (no H/L SILAC ratio with peptides detected only in heavy proteomes; Fig. 5e and Supplementary Table 1). Consistent with our previous observations on the localization of PADI2 in the OL lineage (Fig. 4a, b), PADI2 targets were not only cytoplasmic such as ribosomal proteins and myelin proteins (for example HSPA8, CNP and RAB1, ENO1 and EEF1A25), but also nuclear (Fig. 5e and Supplementary Table 1). Chromatin components and modulators such as histone H1 (HIST1H1B), histone H2b (HIST1H2BA), histone H3 (HIST1H3), the histone demethylase KDM3B and the chromodomain helicase DNA binding protein 6 (CHD6), among others, were identified to be citrullinated by PADI2 at specific arginines (Fig. 5e). We also observed citrullination of several RNA binding proteins, consistent with the abundance or arginines in their RNA binding motifs (Fig. 5e). Gene ontology (GO) analysis indicated that proteins citrullinated by PADI2 are involved in translation, ribosomal biogenesis and nucleosome assembly both in proliferating and differentiating conditions, and RNA splicing, RNA processing and posttranscriptional regulation of gene expression in differentiating conditions (Fig. 5f and Supplementary Table 4). Thus, PADI2 activity is not circumscribed to myelin and cytoplasmic proteins but is also relevant to nuclear processes.
PADI2 protein-protein interaction network is enriched in cytoplasmic and myelin proteins
Our data suggests that PADI2 might be involved in different biological cell processes occurring both in the nucleus and in the cytoplasm. To further explore the PADI2 role in OL lineage cells, we identified the PADI2 protein interactors by pulling-down biotin-tagged PADI2. Control (expressing biotin ligase, BirA, and empty vector) and biotin-tagged Padi2 (bioPadi2) Oli-neu cell lines (expressing BirA and the biotin-tagged Padi2) were fed with 12C or 13C isotopes, respectively, immunoprecipitated with streptavidin beads and combined for further mass spectrometry analysis (Fig. 6a). As expected, PADI2 was the protein enriched the most (Fig. 6b). We uncovered up to 74 shared PADI2 protein interactors in proliferating and 2-days differentiated Oli-neu cells (Fig. 6b, c, e and Supplementary Table 2), among which nuclear proteins such as elongator protein complex 1 (ELP1). Nevertheless, the number of interactors was much lower than citrullination targets, suggesting that most of the PADI2 interactions leading to citrullination are transient and cannot be captured. Yet, GO analysis on the biological processes showed common categories with the GO analysis of the PADI2 citrullination targets, such as translation and posttranscriptional regulation of gene expression (Fig. 6d), suggesting once again a role for PADI2 in these processes. Interestingly, one of the categories in the GO analysis, the intracellular protein transport, comprises RAN and KPNB1, two key regulators for active nuclear transport, which suggests that these proteins can be involved in the PADI2 nuclear-cytoplasmic shuttling (Supplementary Table 2). When performing GO analysis for the cellular component, we also have identified a myelin sheath component of PADI2 interactors (Fig. 6e, myelin sheath partners highlighted in red, Supplementary Table 4). Furthermore, comparison with a previously published myelin proteome25 uncovers additional myelin proteins that interact with PADI2 such as WDR1, FASN, among others (Fig. 6e and Supplementary Table 2). Thus, while interactions of PADI2 with nuclear proteins might be more transient, we observed several myelin proteins interacting with this enzyme.
Histone citrullination by PADI2 is associated with regulation of OL differentiation genes
Since we found PADI2 in the nucleus of OL lineage cells and identified several chromatin-associated proteins as targets of PADI2, we investigated whether citrullinated nuclear proteins, such as histones, are present in OL lineage cells, using an orthogonal technique. Indeed, western blot analysis of histone citrullination shows the presence of histone H3R26Cit and histone H3R2+8+17Cit in proliferating Oli-neu cells (Fig. 7a). Treatment with 200 μM of the pan PADI inhibitors Cl-Amidine or 60 μM of 2-CA led to a reduction on these modifications (Fig. 7a). We also observed an increase of histone H3R2+8+17Cit and Histone H3R26Cit in the Padi2 overexpressing cell lines indicating that PADI2 is mediating histone H3 citrullination and thus acts as an epigenetic regulator in OL lineage cells (Fig. 7b). While the expression of Mog and Sox9 was not altered upon Padi2 overexpression, we observed upregulation of Mbp and Cnp in differentiating cells (Fig. 7c), corroborating their downregulation upon PADI2 inhibition/Padi2 knockdown (Fig. 2). Thus, histone citrullination might be one of the mechanisms by which PADI2 regulates the transition of OPCs to NFOLs.
Padi2 knockdown results in reduced accessibility at OL differentiation genes
To further examine the possible role of PADI2 in transcriptional regulation and the chromatin structure, we investigated if the knockdown of Padi2 would affect the chromatin accessibility. We performed assay for transposase-accessible chromatin using sequencing (ATAC-seq)26 to identify changes in accessibility of regulatory regions in differentiating Oli-neu upon knockdown of Padi2 with siRNAs (Fig. 7d). Interestingly, we observed a general reduction in accessibility upon knock down of Padi2 (Fig. 7d, Supplementary Fig. 2d and Supplementary Table 3). We further investigated accessibility of OL enhancers and promoters, presenting H3K27ac in Oli-neu cells (see methods) or H3K27ac/H3K4me3 in OPCs27. Indeed, we observed decreased chromatin accessibility in regulatory regions of genes as Pik3cd, Plin4 or Ezh1. Importantly, we also observed such reduction in accessibility in important regulators of OL myelination, including Sirt2, Mag and Mbp (Fig. 7d), and in Plp1, Sox10 and Mog, although to minor extent (Supplementary Fig. 2d). Accordingly, gene ontology analysis indicated an enrichment in regulatory regions of genes involved in lipid metabolism (Supplementary Fig. 2e and Supplementary Table 4). Nevertheless, PADI2 appears to target specific regulatory regions, since we did not find regulation of chromatin accessibility at regulatory regions of other genes modulating OL differentiation, such as Sox9, Tcf7l2, (Fig. 7d), Id1 or Olig2 (Supplementary Fig. 2d). Interestingly, we also find a cohort of genes where accessibility of their regulatory regions was instead increased by Padi2 knockdown, including Cxcl2 (Fig. 7d), Hspb8 or Gabra6. Gene ontology analysis indicated involvement in processes chemotaxis, Polycomb activity and apoptosis, among others (Supplementary Fig. 2d and Supplementary Table 4). As such, recruitment of PADI2 to specific regulatory regions in OLs regulates their accessibility, which will also ultimately modulate transcriptional output, as observed for Mog and Sox10.
Discussion
The formation of myelin is a fundamental biological process that encompasses subsequent steps of OPC specification, differentiation and myelin sheath formation/wrapping of axons. Our study highlights PADI2 as an important player in these last two steps by 1) facilitating OPC differentiation and influencing the OL epigenetic landscape through histone citrullination and 2) interacting with and mediating the citrullination of several myelin protein components. While Padi2 expression in OLs and its occurrence in the myelin were described before16, we report for the first time its presence in OPCs and the dramatic upregulation of Padi2 in the transition from OPCs to NFOLs and its function facilitating OL lineage progression. To uncover PADI2 mechanisms of action, we further determined the citrullination targets and the binding partners of PADI2. Our data revealed new PADI2 citrullinated proteins and interactors, both located in the nuclear and cytoplasmic compartments. We also demonstrate, using 3 different Padi2 knockout mouse lines, that PADI2 is important for the OL development and motoric and cognitive behaviour. Our findings indicate that PADI2 mediated citrullination is required for efficient OL development with acting not only as a myelin modulator, through MBP citrullination, but also displaying other functions in the cytoplasm and nucleus, for instance as an epigenetic modulator. Additional mechanisms underlying PADI2 actions in OPC differentiation remain to be investigated.
By using an unbiased proteomics methodology based on SILAC followed by mass spectrometry we have revealed hundreds of novel citrullination protein targets and the respective arginine locations, some of those in core histones such as HIST1H1, HIST1H2 and HIST1H3. PADI2 mediated H3R26Cit has been shown to lead to local chromatin de-condensation and targeted transcriptional activation in breast cancer cells28. In a similar manner, when we knockdown Padi2 we observe a general decrease in chromatin accessibility as revealed by ATAC-seq. Furthermore, upon PADIs inhibition or Padi2 knockdown we observed a decrease in the pro-differentiation and myelin genes such as Mbp, Mog and Sox10 suggesting that PADI2 might be locally enhancing transcription through histone H3 citrullination.
Interestingly, we detected HIST1H1C citrullination on R54 in our cells. This modification was previously described to induce global chromatin decondensation in iPS cells5 and to be specifically mediated by PADI4, which suggests that there is an overlap of the substrates of PADI2 and PADI4. Moreover, H3R2+8+17Cit was also induced upon hPadi4 over-expression5. hPADI2 and hPADI4 were shown to exhibit different substrate preferences and hPADI4 had more pronounced substrate specificity, in both Cos-1 and HEK cells or by adding recombinant hPADIs to cell lysates29. Additional hPADI2 targets were disclosed by overexpressing hPADI2 in HEK cells using a different technology30. Although these are targets for hPADI2 in different human cell types, we observed many common targets with our mouse OL lineage cells such as ribosomal proteins and splicing factors. Thus, PADI2 might have a widespread and undetermined role in basic cellular processes such as mRNA splicing and translation.
Differentiated Oli-neu cells displayed considerably more citrullination targets, higher citrullination activity in basal conditions with the ABAP kit, and a more pronounced increase in H3R2+8+17Cit and H3R26Cit upon Padi2 overexpression suggesting that PADI2 activity can be enhanced upon differentiation. In agreement, most of PADI2 effects are more noticeable upon OPC differentiation. Of notice, PADI activity can also be context dependent, as these enzymes need a high concentration of calcium to become active, and calcium signaling has been shown to be fundamental for OPC migration, differentiation and myelination31. Although several citrullination targets found in proliferating and 2-days differentiated Oli-neu were common and/or showed additional citrullinated arginine in differentiation, they did not overlap completely, indicating that there is a preference for the targeted arginine between these conditions that could be due for instance, to differences in the binding partners. Likewise, not all proteins found interacting with PADI2 were citrullinated and vice versa. Nevertheless, GO analysis for the biological processes on the PADI2 interactors also reveals categories similar to the citrullination targets, such as translation and posttranscriptional regulation of gene expression reinforcing once again a putative role for PADI2 in these processes.
Mice overexpressing Padi2 under the Mbp promoter display abnormal myelination with structural changes of the myelin10. This effect was attributed to the increased citrullination of MBP and also of histones that would ultimately cause OL apoptosis10. However, a striking finding in our study is the abundance of myelin component proteins within the interactors of PADI2, that might also mediate the effect of PADI2 on myelin when overexpressed10. Citrullination of myelin proteins is naturally occurring, and thus normal citrullination levels must certainly have a physiological function. 2’,3’-Cyclic-nucleotide 3’-phosphodiesterase (CNP), which has an important role in the generation of cytoplasmic channels in OLs32, displayed PADI2-mediated citrullination of several arginines (Table S1). It is possible that hypocitrullination of CNP upon knocking out PADI2 could lead to disruption of cytoplasmic channels and ultimately to the observed defects on myelination in our Padi2 fKO mice (Fig. 7). Further investigation would be necessary to determine which citrullination targets of PADI2 in the myelin could be responsible for these defects.
We found that PADI2 absence in OL lineage cells caused decreased OL cell density in spinal cord and a decrease in the number of myelinated axons in the corpus callosum of adult mice, that were reflected in motor and cognitive dysfunctions. Since Pdgfra and Padi2 can also be co-expressed in other non-CNS cells such as Schwann cells, the impairment on motor functions could also be due to the absence of PADI2 in peripheral cells. However, overexpression of Padi2 did not have any effect on the peripheral myelin10 and the EM and OL densities analysis in the brain and spinal cord (Fig. 7) indicate a phenotype in OLs. In addition, the cognitive behavior test also supports a CNS specific PADI2 effect. Analysis of single-cell RNA-Seq data (Supplementary Fig. 1) suggested that PADI2 is the only member of the PADI family robustly expressed in the OL lineage. Although PADI4 was identified by IHC in the myelin16 we could not detect Padi4 mRNA in any OL lineage cell tested nor it was identified in the myelin proteome25. However, we did detect very low mRNA levels of Padi3 and Padi1 in Oli-neu cells and found it expressed in very few cells in OPCs/OLs collected from P90 brains (data not shown). As such, we cannot totally rule out that these PADIs have a function in OL lineage progression and that compensatory mechanisms might be operational upon PADI2 knockdown, knockout or inhibition, particularly since PADIs can have overlapping substrates.
PADI2 has been long investigated in the context of MS since MBP hypercitrullination is a hallmark of the disease33. Our study demonstrates that PADI2-mediated citrullination is also required for OL lineage progression and myelination and uncovers several new citrullination targets in the OL lineage. Thus, targeted activation of PADI2 in the OL lineage might be beneficial in the context of remyelination in diseases as multiple sclerosis.
AUTHOR CONTRIBUTIONS
AMF and GCB designed all experiments. AMF, MM, and JL performed the in vitro experiments, AMF and AH performed the tissue collection and microscopic analysis, PR and AS performed the behavior experiments and PE and PC oversaw, AS, MF and RK processed and analyzed Electron Microcopy data and PC oversaw, MV-G was involved in all the cloning, SCL and MLN performed and analyzed Mass Spectrometry data. EA analyzed the ATAC-Seq experiments, while AR analyzed the Chip-Seq experiments, under supervision of DC. GCB and AMF wrote the paper, with contribution from all authors, and were involved in all the data analysis.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Experimental procedures
Animals
All mice were maintained under a pathogen-free environment at the animal facility. All experimental procedures were performed following the guidelines and recommendations of local animal protection legislation and were approved by the local committee for ethical experiments on laboratory animals (Stockholms Norra Djurförsöksetiska nämnd in Sweden). The following transgenic mice strains were used: Pdgfra-H2BGFP knock-in mice17 where H2BeGFP fusion gene is expressed under the promoter of Pdgfra; Pdgfra-Cre BAC transgenic mice (The Jackson Laboratories, CA, USA), where Cre recombinase is under the control of the Pdgfra promoter; RCE:loxP-GFP reporter mice (Gord Fishell, NYU Neuroscience Institute); Pdgfra-CreERT BAC transgenic mice (The Jackson Laboratories, CA, USA), Padi2tm1a(KOMP)Wtsi (UCDAVIS KOMP Repository Knockout Mouse Project) and Actb:FLPe (The Jackson Laboratories, CA, USA). All individual mice strains were in a C57BL/6 genetic background, at the exception of RCE:loxPGFP that was in a CD1 background. Padi2fl/fl was generated by breeding Padi2tm1a(KOMP)Wtsi with Flp deleter mice. Padi2fl/fl mice were crossed with RCE:loxP-GFP, Pdgfra-Cre or Pdgfra-CreERT. Tamoxifen (Sigma T5648) was dissolved in corn oil and administrated i.p. in P6 Pdgfra-CreERT;RCE:loxP;Padi2fl/fl pups at a dose of 2mg/40g. Brain and spinal cord were subsequently collected at P11.
Use of full Padi2 KO mice was strictly compliant with the guidelines set forth by the US Public Health Service in their policy on Human Care and Use of Laboratory Animals, and in the Guide for the Care and Use of Laboratory Animals. Mice were maintained under a pathogen-free environment at the animal facility of Mount Sinai Medical Center. All procedures received prior approval from the Institutional Animal Care and Use Committee (IACUC). The C57BL/6-Padi2-KO mice were obtained from the Scripps Research Institute (Kerri Mowen’s laboratory) which was originally from Lexicon Genetics (Woodlands, TX).
Behavioral analysis
For the beam balance test the fine motor coordination and balance was assessed by beam walking assay. Performance on the beam was quantified by measuring the time taken by the mouse to traverse the beam and the number of paw slips that occurred in the process. The beam apparatus consisted of a PVC plastic beam (1.2 cm wide × 100 cm long) located 50 cm above the table top on two poles. A black box was placed at the end of the beam as the finish point. Nesting material and faeces from home cages was placed in the black box to attract the mouse to the finish point. A nylon or cotton pad was placed below the beam, to cushion any falls. Mice were trained three times a day for two consecutive days until they were able to cross the beam without hesitation. No data were collected during these sessions. During the test session, the time needed to cross the beam and the number of paw slips were recorded. The beam and box were cleaned of mouse droppings and wiped with 70% ethanol before the next animal was placed on the apparatus. The novel object recognition task was conducted as described previously34, and was used to assess the non-spatial hippocampal memory. A mouse was presented with two similar objects during the first session, and then one of the two objects was replaced by a new object during a second session. The amount of time taken to explore the new object provided the index of recognition memory. The task consisted of habituation, training, and testing phases conducted on separate days. During habituation, mice were allowed to freely explore an empty white box (60 cm wide × 60 cm long × 47 cm high) for 5 min/day for two days. Twenty-four hours later, mice were re-habituated (familiarization session) in the same box for 10 min, with two identical objects placed inside, 5 cm away from the walls. Mice were allowed to freely investigate until they accumulated a total of 20 sec exploring the objects. Exploration and recognition of the object were determined when the nose of the animal was in contact with an object or directing nose to the object within a defined distance (<2 cm). Mice were then immediately returned to their home cage. After the familiarization session, the objects and the open field was cleaned with 70% ethanol to minimize olfactory cues. After 1 hour of familiarization session, object recognition was tested, using the same procedure as in training except that one of the familiar objects was substituted with a novel object (cleaned and free of olfactory cues). The position of the novel object (left or right) has to be randomized between each mouse and each group tested. Time spent with each object was recorded using a stopwatch by a trained observer. Mice inherently prefer to explore novel objects; thus, a preference for the novel object indicates intact memory for the familiar object. A discrimination index was calculated according to the following formula: time of novel object exploration/time of novel plus familiar object exploration×100. Rotarod behavioral analysis was performed for evaluation of coordination and motor learning. Mice were trained on a Rotarod (Ugo Basile, Comerio VA, Italy) at a constant speed (4 rpm), 120 s per day for 3 consecutive days. Subsequently, test day consisted of three trials on an accelerating rotarod for up to 300 s (starting at 4 rpm accelerating to a final speed of 40 rpm), with mice returned to their home cages for at least 30 min between trials. The time at which each animal fell from the rod was recorded as a measure of motor coordination and repeated measurements of speed at the time of animal falling were averaged.
Electron Microscopy
For EM analysis, deeply anesthetized C57BL/6-Padi2-KO mice (n=4 per condition) were perfused transcardially using a varistaltic pump (Manostat) with 0.1M PBS (pH 7.4) followed by cold Karnovsky’s fixative (2.0% PFA/2.5% Glutaraldehyde in 0.1M Sodium Phosphate buffer). Using a McIlwain tissue chopper, coronal brain sections between −2.2 and −2.5 bregma were obtained and corpus callosum tissue was micro-dissected and post-fixed overnight in 2.0% PFA/ 2.5% Glutaraldehyde in 0.1M Sodium Phosphate buffer. The samples were then processed using standard protocols employed by the Stony Brook University Microscopy Core (see below, and35,36). The following day (after overnight post-fixation), an additional fixation step was carried out using 2% osmium tetroxide in 0.1M PBS (pH 7.4), after which samples were dehydrated in a graded series of ethyl alcohol. Finally, samples were embedded using Durcupan resin in between two pieces of ACLAR sheets (Electron Microscopy Sciences). Ultrathin sections of 80nm were obtained using a Lecia EM UC7 ultramicrotome and placed on formvar coated slot copper grids (Electron Microscopy Sciences). Uranyl acetate and lead citrate counterstained samples were viewed under a FEI Tecnai12 BioTwinG2 electron microscope. Digital images (minimum 10 per animal, taken at 11,000x) were acquired using an AMT XR-60 CCD Digital Camera system and compiled using Abobe Photoshop software. G-ratio was determined by dividing the mean axon diameter without myelin by the same axon diameter with myelin. A minimum of 100 healthy axons were considered per animal. To determine the size distribution of myelinated fibers in corpus callosum, diameters of all measured axons were separated into four ranges (0.3-0.6, 0.6-0.9, 0.9-1.2, & >1.2 µm). No axons with diameters smaller than 0.3 µm were considered. Data are expressed as comparison of means between the control and knock-out for each range. Percentage of myelinated axons was determined by placing a centered grid over the image using ImageJ software, and counting whether the axon at each intersection was myelinated or not. A minimum of 100 axons was counted per image, and 10 images were quantified per animal. All measurements were acquired on electron microscopy sections images using an ImageJ software. Mann-Whitney U tests were performed to assess statistical differences between control and knock out mice for both differences in g-ratio per axon diameter range and percent myelinated axons.
Tissue dissociation
Cells were isolated from postnatal, juvenile and adult brains from Pdgfra-Cre;RCE:loxP mice, and from juvenile brains from Pdgfra-Cre;RCE:loxP;Padi2+/+ and PdgfraCre;RCE:loxP;Padi2fl/fl mice with Neural (for postnatal) and Adult (for juvenile and adult) Tissue Dissociation kits (P) (Miltenyi Biotec). Cell suspensions were then filtered with 30µm filter (Partec) and FACS sorted for selection of GFP+. FACS sorted cells were collected in eppendorf tubes, centrifuged at 400xg, resuspended in Qiazol and frozen for further RNA extraction/cDNA synthesis.
FACS
GFP+cells were FACS sorted using a BD FACSAria III Cell Sorter B5/R3/V3 system. Cells were collected either in PBS for further RNA extraction processing or in OPC media directly into coated plates. For OPC removal on OL lineage cells from juvenile and adult brains, CD140 (anti-mouse CD140 APC conjugated, BD Bioscience) labelling was performed in tissue-isolated cells and GFP+CD140+ cells were excluded. To define the gates for specific CD140+ cells we have performed an additional labelling with APC conjugated IgG (BD Bioscience) as a negative control.
Cell culture
Primary OPC culture: GFP+ OPCs were obtained with FACS from P1-P4 brains from the Pdgfra-H2BGFP mouse line. The mouse brains were removed and dissociated in single cell suspensions using the Neural Tissue Dissociation Kit (P) (Miltenyi Biotec, 130-092-628) according to the manufacturer’s protocol. Cells were seeded in polyL-lysine (O/N) (Sigma P4707) plus fibronectin (1h) (Sigma F1141) coated dishes and grown in proliferation media comprising DMEM/Gmax (life tec 10565018), N2 media (life tec 17502048), Pen/Strep (life tec 15140122), NeuroBrew (Miltenyi 130-093-566), bFGF 20ng/ml (Peprotech 100-18B) and PDGF-AA 10ng/ml (R&D 520-BB-050). For OPC differentiation, cells were left for 2 days in medium without bFGF and PDGF-AA. Oli-neu cell culture: Oli-neu cells were grown in poly-L-lysine coated dishes and expanded in proliferation media consisting of DMEM (life tec 41965062), N2 supplement, Pen/Strep Glu (life tec 10378016), T3 (sigma T6397) 340ng/ml, L-thyroxine (sigma 89430) 400 ng/ml, bFGF 10ng/ml and Pdgf-BB 1ng/ml. For Oli-neu differentiation, media without growth factors was added for two days in vitro and in the presence of 1µM of erb inhibitor (PD174265, St Cruz, sc-204170). Rat OPC cultures: primary rat OPCs were isolated as reported previously37. Briefly, mixed glia cultures were first derived from rat brain cortex at postnatal day 1. OPCs were selected by the A2B5 antibody followed by purification with the magnetic rat anti-mouse IgM beads (Miltenyi Biotec). Purified OPCs were cultured in the SATO medium supplemented with PDGFA and bFGF, and were induced to differentiate with T3 replacing the growth factors. PADI inhibition: Olineu cells were treated either with ClAmidine (Millipore 506282) or 2-chloroacetamidine (2CA) (Sigma C0267) at a concentration of 200 µM and 60 µM for one and two days, respectively, in proliferation and differentiation media.
SILAC
To generate LIGHT and HEAVY labeled cell lines, Oli-neu cells were grown and expanded in LIGHT (Lysine 12C) or HEAVY (Lysine 13C) media for at least five passages. The media was prepared with SILAC Advanced DMEM/F12-FLEX kit (Life Tec, MS10033) and contained 0.1% of dialyzed FBS, 10ng/ml bFGF, 10ng/ml PDGF-BB, 400ng/ml of L-thyroxine and 340ng/ml of T3. For the differentiation, growth factors and the FBS were removed. LIGHT labeled cells lines correspond to all controls, scramble over-expression control and BirA control, while HEAVY labeled cell lines comprise the overexpression of Padi2 or the biotin tagged Padi2. A control experiment in which control cells were also fed with heavy media and then mixed 1:1 with light control cells was performed in order to confirm that all proteins in heavy conditions were heavily labeled (Supplementary Fig. 2b).
Padi2 overexpression cell lines and knock down
Padi2 and Ctr overexpression cell lines were generated by insertion of the following vectors with piggyBac transposon system: pB-CAG-Ctr, pB-CAG-Padi2 and for the control and overexpression of Padi2, respectively; pB-CAGBirA together with pB-CAG-IRES-GFP as a control and pB-CAG-BirA together with pB-CAG-bioPadi2-IRES-GFP for the biotin tagged Padi2. The gateway system was used to clone all these vectors (Gateway® LR Clonase® II Enzyme mix, 11791020 and Gateway® BP Clonase® II Enzyme mix11789020) in Oli-neu cells. pB-CAG-Ctr, pBCAG-Padi2, pB-CAG-BirA + pB-CAG-IRES-GFP and pBCAG-BirA + pB-CAG-bioPadi2-IRES-GFP were transfected together with piggyBac transposase (pBase) expression vector by lipofection according to the manufacturer’s instructions (Lipofectamine® 2000, Invitrogen 11668019). To select for biotin tagged Padi2 and pB-CAG-IRES-GFP vectors cells were FACsorted for GFP, all the other cell lines express the hygromycin resistance gene in the DNA integrated vectors and were selected and expanded in media containing 200 µg/ml of hygromycin. For the expression of the fusion Padi2 plasmid in Oli-neu OPCs, Padi2 was cloned into the pZsGreen1-N1 plasmid (Clontech, 632448). Oli-neu and primary mouse OPCs were then transfected with these plasmids with Lipofectamine2000 according to the manufacturer’s instructions. For silencing Padi2 we used the siDESIGN center from Dharmacon. The following siRNAs were selected and purchased from Dharmacon GE Healthcare: mouse Padi2; sense: 5’ CGUACGUGAUGGAGAGGCAUU 3’; antisense: 5’ UGCCUCUCCAUCACGUACGUU 3’ and ONTARGETplus Non-targeting siRNA #1 (D-001810-01-20). Knockdown experiments for Padi2 were performed both in Oli-neu and mouse primary OPCs with Lipofectamine2000, following manufacturer’s instructions. For mouse primary OPCs, upon 4h of adding the lipids:DNA complexes to the cells, media was changed to either proliferation or differentiation and cells were collected two days after. For Oli-neu experiments, upon 4h of adding the lipids:DNA complexes to the cells, media was changed to proliferation for one day and cells were either collected at this point (proliferation condition) or changed to differentiation media one more day (differentiation condition).
ABAP
Cells were collected in lysis buffer [20mM Tris-HCl, pH 7.4; 100mM NaCl; 10mM β-mercaptoethanol; 10% glycerol; protease inhibitor complete (Roche)] and sonicated for 5 minutes at high power with 30 sec on/off cycles at 4°C. Then the samples were centrifuged at 13000 × g at 4°C for 30 minutes and the supernatant was immediately used for further application. PADI activity was determined with the Antibody Based Assay for PAD activity (ABAP) kit (Modiquest Research, MQ17.101-96) and performed according to manufacturer’s protocol. HRP-conjugated secondary antibody was visualized with a TMB substrate solution [1 mg/ml TMB (Sigma Aldrich); 0.1M sodium acetate, pH 5.2; 0.01% hydrogen peroxide] and the reaction was stopped with sulphuric acid [2M H2SO4]. The absorbance at 450 nm was determined with a FLUOstar Omega plate reader (BMG Labtech). Human PADI4 enzyme was used as control enzyme activity and was diluted in deimination buffer [40 mM TrisHCl, pH 7.5; 5 mM CaCl2; 1mM DTT] with concentrations between 0.002 mU (minimum deimination) and 2.0 mU (maximum deimination) to create a standard curve to correlate activity to the optical density measured at 450 nm.
RNA extraction, cDNA synthesis and quantitative real-time PCR (qRT-PCR)
RNA was extracted with the miRNeasy mini kit (Qiagen, 217004) for the Oli-neu cells or with the miRNeasy micro kit (Qiagen, 217084) for the primary OPCs and direct tissue isolated cells according to manufacturer’s protocols. Contaminating DNA was degraded by treatment of the samples with RNase-free DNase (Qiagen, 79254) in column. 0.35-1µg of RNA from each sample was reversed transcribed for 1h with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) including RNase inhibitor (Applied Biosystems, N8080119). An RT- control was included for each sample. Both the cDNA and the RT- were diluted 1:5 in RNase/DNAse free water. qPCR reactions were run on a StepOnePlus™ System (Applied Biosystems) in duplicate and with reverse transcriptase negative reactions to control for genomic DNA. Fast SYBR® Green Master Mix (Applied Biosystems, 4385616) was used according to the manufacturer’s instructions, each PCR reaction had a final volume of 10µl and 1–2.5µl of diluted cDNA and RT-. The running conditions were 20 seconds at 95°C, followed by 40 cycles of 3 seconds of 95°C and 30 seconds of 60°C, then 15 seconds at 95°C, 1 minute at 60°C and 15 seconds at 95°C. A melting curve was obtained for each PCR product after each run, to control for primer dimers and gene-specific peaks. Random PCR products were also run in a 2–3% agarose gel to verify the size of the amplicon. Tbp and Gapdh were run as housekeeping genes. Relative standard curves were generated for each gene to determine relative expression (CT values are converted to arbitrary quantities of initial template per sample). Expression levels were then obtained by dividing the quantity by the value of the geometric mean of the housekeeping genes. PCR primer sequences used are listed in table 1.
Immunofluorescence
For immunocytochemistry cells were fixed in 4% formaldehyde for 10 minutes, washed in PBS and incubated overnight at 4°C with the primary antibodies anti-CNP (abcam ab6319, 1:200) anti-MBP (Abcam, ab7349, 1:200) in PBS/0.5%Trition/10% normal donkey serum (Sigma, D9663). Cells were washed with PBS and then incubated for 2 hours with Alexa Fluorconjugated antibodies (Invitrogen, Alexa Fluor anti-mouse 488 1:1000 and Alexa Fluor anti-mouse 555 1:1000). For immunohistochemistry mice were perfused at P11 (for tamoxifen-induced Pdgfra-CreERT;RCE:loxP/Padi2+/+ and Pdgfra-CreERT;RCE:loxP;Padi2-/-) or at P21 (for Pdgfra-Cre;RCE:loxP;Padi2+/+ and Pdgfra-Cre;RCE:loxP;Padi2-/-) with PBS followed by 4% PFA. Brains and spinal cords were dissected and post-fixed with 4% PFA for 1h, at 4°C. The tissues were then cryo-protected with a 30% sucrose solution for 24 hours. The tissues were embedded into OCT (Tissue-Tek) and sectioned coronally (20 um thickness). Sections were incubated overnight at 4°C in the following primary antibodies: GFP (Abcam, ab13970, chicken 1:2000) and CC1 (anti-APC; Millipore, OP80, Mouse 1:100) diluted in PBS/0.5% Triton/10% normal donkey serum. After washing the section with PBS, secondary Alexa Fluor-conjugated antibodies diluted in PBS/0.5% Triton/10% normal donkey serum were incubated for 2h at room temperature (Invitrogen, Alexa Fluor anti-chicken 488 1:1000 and Alexa Fluor anti-mouse/goat 555 1:1000). Slides were mounted with mounting medium containing DAPI (Vector, H-1200) and kept at 4°C until further microscopic analysis.
Microscopy and quantitative analysis
To estimate the number of OL (CC1+ cells), newly formed/ Cre recombined OL (GFP+CC1+) and Cre recombined OPCs (GFP+PDGFRa+), 3 sections per animal (at same positions of the anterior-posterior axis) were analyzed. For each section, images were taken for the entire corpus callosum and dorsal funiculus of the spinal cord using a Zeiss LSM700 Confocal. The total number of CC1+ cells and GFP+CC1+ or GFP+PDGFRa+ double positive cells was counted using Image J software. The percentage of OL and OPCs out of total recombined cells at P11 corpus callosum and spinal cord was calculated by estimating the percentage ratio of GFP+CC1+ out of total GFP+cells for OLs and GFP+PDGFRa+ out of total GFP+cells for OPCs. For the estimation of OL density in juvenile mice CC1+cells were divided by the correspondent areas of corpus callosum and dorsal funiculus.
Western Blot
Cells were collected in 2x Laemmli buffer [120mM Tris-HCl, pH 6.8; 4% SDS; 20% glycerol] and sonicated for 5 minutes at high power with 30 sec on/off cycles at 4°C to shear genomic DNA. Protein concentrations were determined on nanodrop and concentrations were equalized with 2x Laemmli buffer. Bromophenol blue (0.1%) and β-mercaptoethanol (10%) were added to the samples and the samples were boiled at 95°C for 5 minutes to denature the protein. Equal volumes were loaded in a SDS-PAGE for protein separation and transferred (100V for 90’) to a PVDF membrane (GE-healthcare) activated in methanol. The membranes were blocked in blocking solution [TBS; 0.1% Tween 20; 5% milk] for 1 hour at room temperature and incubated overnight with primary antibody (diluted in blocking solution) at 4°C, washed 3 times 10 minutes in TBS-T [TBS;0.1% Tween 20] and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (diluted in blocking solution) for 2 hours at room temperature. Proteins were exposed with either enhanced chemiluminescence solution (GE healthcare) or Supersignal west femto (Thermo Scientific) at a ChemiDoc™ XRS imaging system (Bio-Rad). Primary antibodies were used against PADI2 (rabbit polyclonal; 12110-1-AP; ProteinTech; 1:300), GAPDH (rabbit monoclonal; 5174S; Cell Signaling; 1:1000), H3 (mouse monoclonal; ab10799; Abcam; 1:1000) H3Cit2+8+17 (rabbit polyclonal; ab5103; Abcam; 1:1000), H3Cit26 (rabbit polyclonal; ab19847; Abcam; 1:1000). Secondary antibodies were used at a dilution of 1:5000, anti-rabbit (A6667; Sigma), anti-mouse (A4416; Sigma).
PADI2 immunoprecipitation
Proliferating and 2-days differentiated BirA controls and biotin tagged Padi2 cells were fixed fo 8min at RT in 1% formaldehyde solution by adding 1/10 volume to cell media of freshly prepared 11% formalde-hyde solution (formaldehyde 11%, 0.1M NaCl, 1mM EDTA pH8, 0.5mM EGTA pH8 and 50mM Hepes pH8). Glycine was added (final 0.125M) to quench formaldehyde, rinsed twice in cold PBS and scrapped for subsequent centrifugation at 4000g for 10min at 4°C. At this point cell pellets can be stored at −80°C. Cell pellets were then resuspended in 1mL of lysis buffer (10mM Hepes-KOH pH7.5, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycolate,0.5% Na-lauroylsarcosinate, protease inhibitors) and sonicated. Cell suspension was centrifuged at 14000g for 10min at 4°C to remove the debris. For the immunoprecipitation, protein concentrations were determined in every sample and equal amounts of protein were used for further streptavidin pull-down. 50µL of streptavidin beads (DB Myone Streptavidin T1, Invitrogen) per 5mg of protein were added to the protein suspensions and incubated overnight at 4°C. Magnetic stand was used to precipitate the beads. At this step beads from BirA controls and biotin-tagged Padi2 were combined for the following washes: 4 times in wash buffer 1 (50mM Hepes pH7.6, 1mM EDTA, 0.1% Na-Deoxycolate), 2 times in wash buffer 2 (50mM Hepes pH7.6) and 2 times in wash buffer 3 (20 mM ammonium bicarbonate NH4HCO3). The beads can be stored at −80°C in this step.
Mass Spectrometry for citrullination targets
SDS-PAGE gel
Extracted proteins were resuspended in Laemmli Sample Buffer, and resolved on a 4-20% SDS-PAGE. The gel was stained with Coomassie blue, cut into 20 slices and processed for mass spectrometric analysis using standard in gel procedure38. Briefly, cysteines were reduced with dithiothreitol (DTT), alkylated using chloroacetamide (CAA) (PMID: 18511913), and finally the proteins were digested overnight with endoproteinase Lys-C and loaded onto C18 StageTips prior to mass spectrometric analysis.
Mass spectrometric analysis
All MS experiments were performed on a nanoscale EASY-nLC 1000 UHPLC system (Thermo Fisher Scientific) connected to an Orbitrap QExactive Plus equipped with a nanoelectrospray source (Thermo Fisher Scientific). Each peptide fraction was eluted off the StageTip, auto-sampled and separated on a 15 cm analytical column (75 µm inner diameter) in-house packed with 1.9-µm C18 beads (Reprosil Pur-AQ, Dr. Maisch) using a 75 min gradient ranging from 5% to 40% acetonitrile in 0.5% formic acid at a flow rate of 250 nl/min. The effluent from the HPLC was directly electrosprayed into the mass spectrometer. The Q Exactive plus mass spectrometer was operated in data-dependent acquisition mode and all samples were analyzed using previously described ‘sensitive’ acquisition method39. Back-bone fragmentation of eluting peptide species were obtained using higher-energy collisional dissociation (HCD) which ensured high-mass accuracy on both precursor and fragment ions40.
Identification of peptides and proteins by MaxQuant
The data analysis was performed with the MaxQuant software suite (version 1.3.0.5) as described41 supported by Andromeda (www.maxquant.org) as the database search engine for peptide identifications42. We followed the step-by-step protocol of the MaxQuant software suite43 to generate MS/MS peak lists that were filtered to contain at most six peaks per 100 Da interval and searched by Andromeda against a concatenated target/decoy44 (forward and reversed) version of the IPI human database. Protein sequences of common contaminants such as human keratins and proteases used were added to the database. The initial mass tolerance in MS mode was set to 7 ppm and MS/MS mass tolerance was set to 20 ppm. Cysteine carbamidomethylation was searched as a fixed modification, whereas protein N-acetylation, oxidized methionine, deamidation of Asparagine and Glutamine, and citrullination of Arginines were searched as variable modifications. A maximum of two mis-cleavages was allowed while we required strict LysC specificity. To minimize false identifications, all top-scoring peptide assignments made by Mascot were filtered based on previous knowledge of individual peptide mass error. Peptide assignments were statistically evaluated in a Bayesian model on the basis of sequence length and Andromeda score. We only accepted peptides and proteins with a false discovery rate of less than 1%, estimated on the basis of the number of accepted reverse hits.
Mass Spectrometry for PADI2 interactome
LC-MS/MS sample preparation
The beads were thawed and resuspended in 100µl 25 mM ammonium bicarbonate. The samples were reduced for 1 hour at room temperature by addition of 1 mM DTT, followed by alkylation for 10 minutes in the dark with 5 mM iodoacetamide. The reaction was quenched by the addition of 5 mM DTT. 0.2 µg of Trypsin (sequencing grade modified, Pierce) was added to the samples and digestion was carried out over night at 37°C. After digestion, samples were spun briefly and the supernatant carefully transferred to a glass vial and dried in a SpeedVac and resuspended in 3% acetonitrile, 0.1% formic acid. On third of the original sample was injected for LC-MS/MS analysis.
LC-ESI-MS/MS Q-Exactive
Online LC-MS was performed using a Dionex UltiMate™ 3000 RSLCnano System coupled to a Q-Exactive mass spectrometer (Thermo Scientific). Samples were trapped on a C18 guard desalting column (Ac-claim PepMap 100, 75um × 2 cm, nanoViper, C18, 5 µm, 100 Å), and separated on a 50 cm long C18 column (Easy spray PepMap RSLC, C18, 2 µm, 100Å, 75 µmx15cm). The nano-capillary solvent A was 95% water, 5%DMSO, 0.1% formic acid; and solvent B was 5% water,5% DMSO, 95% acetonitrile, 0.1% formic acid. At a constant flow of 0.25 µl min1, the curved gradient went from 2%B up to 40%B in 95 min, followed by a steep increase to 100%B in 5 min. FTMS master scans with 70,000 resolution (and mass range 300-1700 m/z) were followed by data-dependent MS/MS (35 000 resolution) on the top 5 ions using higher energy collision dissociation (HCD) at 30-40% normalized collision energy. Precursors were isolated with a 2m/z window. Automatic gain control (AGC) targets were 1e6 for MS1 and 1e5 for MS2. Maximum injection times were 100ms for MS1 and 150-200ms for MS2. The entire duty cycle lasted 2.5s. Dynamic exclusion was used with 60s duration. Precursors with unassigned charge state or charge state 1 were excluded. An underfill ratio of 1% was used.
Peptide and protein identification
The MS raw files were searched using Sequest-Target Decoy PSM Validator under the software platform Proteome Discoverer 1.4 (Thermo Scientific) against a mouse database (Uniprot, downloaded on 140320) and filtered to a 1% FDR cut off. We used a precursor ion mass tolerance of 10 ppm, and a product ion mass tolerance of 0.02 Da for HCD-FTMS. The algorithm considered tryptic peptides with maximum 2 missed cleavage; carbamidomethylation (C) as a fixed modification; oxidation (M), and heavy SILAC labelled lysines (Label 13C(6) / +6.020 Da (K)) as dynamic modifications.
Gene Ontology analysis
Gene ontology (GO) enrichment analysis was performed using STRING protein-protein interaction networks45, and results adjusted for multiple testing using the Benjamini–Hochberg procedure (FDR).
ChIP-seq
Oli-neu cells were rinsed with cold PBS and cross-linked with 1% formaldehyde (Sigma) for 10 min at room temperature (RT) on a rotating platform. Fixation was quenched with 0.125M glycine for 5 min at RT. Cells were rinsed with cold PBS containing 1x Protease Inhibitors (PI, Sigma, 11873580001) and collected spinning at 1500rpm for 5 min at 4°C. Pellets were resuspended in swelling buffer (PIPES 5mM, KCl 85 mM, Igepal-CA630 1%, PI 1x), incubated 15min on ice followed by a centrifugation of 1300g for 5min. This step was repeated twice and nuclear pellets were resuspended in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.0) and PI 1x) and incubated for 10 min on ice followed by chromatin sonication using a BioruptorTM UCD200 (Diagenode), high frequency, 30 sec ON/30 sec OFF, for 10 min. Protein A/G coated beads (Invitrogen) were washed and resuspended in ChIP dilution buffer (0.01% SDS, 1% Triton, 1.2mM EDTA, 16.7mM TrisHCl pH8, 167mM NaCl and PI 1x). 20µg of chromatin per ChIP was diluted in ChIP dilution buffer and precleared by incubating with 20µl of pre-washed protein A/G coated beads for 1.5h at 4°C on a rotator. Beads were removed and 2µg of the antibody H3K27ac (Millipore, 17-683) was added to the chromatin and incubated overnight at 4°C on a rotator. Incubate 20µl of beads in 1mg/ml of BSA in PBS overnight at 4°C on a rotator. Wash beads in ChIP buffer and add to the chromatin/ab for 1h at 4°C on a rotator. Chromatin/ab/beads were washed 3 times low salt wash buffer (0.1% SDS, 2mM EDTA, 20mM TrisHCl pH8, 1% TritonX-100, 150mM NaCl), once with high salt wash buffer (0.1% SDS, 2mM EDTA, 20mM TrisHCl pH8, 1% TritonX-100, 500mM NaCl), once with LiCl wash buffer (0.25M LiCl, 1% IGEPAL-CA630, 1% deoxycolate, 1mM EDTA, 10mM TrisHCl pH8) and once with TE buffer (10 mM Tris-HCl (pH 7.5), 1mM EDTA). Chromatin was eluted by incubating the beads with elution buffer (1% SDS, 0.1M NaHCO3) for 15 min at RT. Eluted chromatin was reverse cross-linked by adding 10ng/ml of Proteinase K (Thermo Scientific) and 0.1M NaCL. After 2h incubation at 42°C, samples were incubated at 65°C O/N. Following morning, 10ng/ml of glycogen (Invitrogen) and 1 volume of Phenol:Chloroform:Isoamyl (25:24:1, Invitrogen, 15593031) were added and solutions were mixed thoroughly before isolating the DNA with Maxitract High Density Tubes (Qiagen).2.5 Volumes of 100% ethanol and 1/10 volume of 3M NaOAc (Sigma) were added to the sample and incubated for 15 min at −80°C. DNA was washed with 70% ethanol and resuspended in nuclease free water.
ATAC-seq
ATAC-seq was performed as previously described26 with minor adaptations. Oli-neu cells (differentiated, siRNA treated as described above) were collected with Accutase solution (Sigma-Aldrich, A6964). 50 000 cells per condition were lysed in lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.1% IGEPAL CA-630) and centrifuged at 500xg at 4°C for 20 minutes. The cells were then resuspended in tagmentation mix (2.5 µl TD buffer, 2.5 µl Tn5 enzyme, Illumina) and the DNA was transposed for 30 minutes at 37°C, where after the DNA was purified using the Qiagen MinElute kit. After PCR amplification with 7-8 cycles (cycles determined with qPCR) the libraries were sequenced on a HiSeq2500 Illumina sequencer. Three replicates per condition were performed in different days and different passages. Each replicate had > 10 million reads with an average of 45 million reads per sample.
Bioinformatic analysis of ChIP-seq and ATAC-seq
siPadi2 ATAC-seq processing
ATAC-seq siCtrl and siPadi2 replicates were processed separately following the standard ENCODE pipeline for ATAC-seq samples, https://www.encodeproject.org/pipelines/ENCPL792NWO/. Adapters were detected and trimmed with cutadapt 1.9.146 and aligned to mouse genome (GRCm38/mm10) using Bowtie247, with default parameters. After filtering mitochondrial DNA, reads properly paired were retained and multimapped reads, with MAPQ < 30, were removed using SAMtools48. PCR duplicates were removed using MarkDuplicates (Picard - latest version 1.126), http://broadinstitute.github.io/picard/.
ATAC-seq peaks were called using MACS2 https://github.com/taoliu/MACS/49, with parameters -g mm -q 0.05 –nomodel –shift -100 –extsize 200 -B –broad. To get the consensus promoter/enhancer regions from each of the replicates we first selected the significant peaks −log10(p-value) > 1.30103. Using bedtools.2.17 mergeBed, we recovered the consensus ATAC peak region that included more than one replicate for siCtrl samples and siPadi2 samples. From where we recovered 76021 and 55772 union peaks regions for siCtrl and siPadi2, respectively. For visualization and further analyses, the different replicates were merged using Samtools and tracks were normalized using deeptools bamcoverage, normalized with RPKM.
H3K27ac ChIP-seq data
Raw reads were mapped to the mouse genome (GRCm38/mm10) with Bowtie 2.1.047. Uniquely mapped reads (17 and 19.5 million for proliferation and differentiation chromatin samples) were then processed with SAMTools for format conversion and removal of PCR duplicates48. Broad peaks corresponding to H3K27ac enrichment were called using MACS 2.0.10, with q-value cutoff at 5*10-249. H3K27ac peaks were filtered against blacklisted genomic regions prone to artifacts (ENCODE Project Consortium, 2012) with BEDTools50 and annotated to the nearest Transcription Start Site with PeakAnalyzer51.
Defined promoter/enhancer regions
We recovered the regions around the transcription start site (TSS) from gene annotations, ENSEMBL83. The putative promoter regions were extracted as -3KB upstream the TSS and 100bp down-tream the TSS, to recover possible promoter and enhancer regions. To get more reliable signal we intersected the siCtrl union peaks with peaks from H3K27ac ChIP-Seq in Olineu cells in differentiation and proliferation conditions (see above), ending with 17281 siCtrl/promoter peaks overlapping with H3K27ac peaks. Only the union peaks (7087 peaks) from siCtrl/H3K27ac overlapping the defined promoter regions were retained, using Bedtools intersect50. In order to recover possible enhancer and promoter regions that could be have been excluded from H3K27ac filtering or due to been more downstream of defined promoter regions, we included in the analysis a known mark of promoters/enhancers, H3K4me3 in OPC-like cells (GSE80089)27. We recovered the peaks bed file of H3K4me3 control peaks, GSM2112628, (liftover mm9 to mm10) and with bed-tools intersect, we recovered 10428 peaks corresponding to siCtrl/promoter/enhancer peaks with H3K4me3 peaks regions. The final dataset of peaks included the union of both promoter/enhancer peaks marked by H3K27ac and/or H3K4me3, with a total of 10897 peaks. The final region was extended 200bp up and downstream for further calculations. For the differential accessibility analysis between conditions the merged replicates from both conditions were used with Pyicos52 on the final peaks dataset, with parameters pyicoenrich –tmm-norm and default parameters. Including the z-score associated p-value and Benjamini & Hochberg (1995) corrected p-value (adj p-value or FDR)53 and the log2 fold change for candidates selection, with adjust p-value < 0.05 significance threshold. Data was visualized with IGV, http://www.broadinstitute.org/igv.
Gene ontology analysis
For the GO analyses, the top 300 up genes from siCtrl selected peaks and top 300 genes form siPadi2 selected peaks, based on log2(RPKM siCtrl / RPKM siPadi2) were selected (adjusted p-val <0.05). GO and pathway analysis was performed with the ClueGO (version 2.5.1)54 plug-in Cytoscape (version 3.5.1)55 with settings, GO Biological process (20.11.2017) and REACTOME pathways (20.11.2017), showing only pathways with p-val <= 0.05. Default settings were used and a minimum of 4 genes per cluster were used.
Statistical analysis
Statistical analysis was performed in GraphPad Prism7. Parametric and non-paired t-test was used to determine statistically significant differences between 2 groups in qRT-PCR experiments at the exception of the rat primary cultures where a Wilcoxon matched paired test was performed. One way ANOVA was used to determine differences between three groups in the behavioral analysis of Padi2 fKO. Mann-Whitney tests were performed to compare Ct and Padi2 cKO behavior.
Accession numbers
The accession number for all raw data has been deposited in GEO GSE115929.
ACKNOWLEDGEMENTS
We would like to thank Tony Jimenez-Beristain, Alessandra Nanni, Ahmad Moshref and Johnny Söderlund, and the Clinical Proteomics Mass Spectrometry at Karolinska University Hospital and Science for Life Laboratory for providing assistance in mass spectrometry and data analysis, and Science for Life Laboratory, the National Genomics Infrastructure (NGI), and Uppmax for providing assistance in massive parallel sequencing and computational infrastructure. We thank Belinda Panagel and the CMB FACS facility for all the support in FACS sorting of all cells, and Jean-Jacques Medard and Roman Chrast for help with electron microscopy. We thank Helena Francis, Iris Muller, Marjan Abbasi, Theresa Mader, Diana Hernandez and Wouter Beenker, all students that had participated and pushed forward this project. We thank P. Soriano (Mount Sinai, New York) for the Pdgfra-H2B-GFP mouse. The bioinformatics computations were performed on resources provided by the Swedish National Infrastructure for Computing (SNIC) at UPPMAX, Uppsala University. A.M.F. was supported by the European Committee for Treatment and Research of Multiple Sclerosis (ECTRIMS). Work in P.C.’s research group was funded by NIH-NINDS to PC R01-NS052738. Work in G.C.-B.’s research group was supported by Swedish Research Council, European Union (FP7/Marie Curie Integration Grant EPIOPC, Horizon 2020 Research and Innovation Programme/ European Research Council Consolidator Grant EPIScOPE, grant agreement number 681893), Swedish Brain Foundation, Ming Wai Lau Centre for Reparative Medicine, Swedish Cancer Society (Cancerfonden), Petrus och Augusta Hedlunds Foundation and Karolinska Institutet. Raw data has been deposited in GEO GSE115929. This manuscript was formatted using the BioRxiv template in the Overleaf software (Author: Ricardo Henriques, License: Creative Commons CC BY 4.0).