Tumors induce de novo steroid biosynthesis in T cells to evade immunity

Summary

Tumors subvert immune cell function to evade immune responses¹, and the mechanisms of tumor immune evasion are incompletely understood. Here we show that tumors induce de novo steroidogenesis in T lymphocytes to evade anti-tumor immunity. Using a novel transgenic fluorescent reporter mouse line we identify and characterize de novo steroidogenic T cells. Genetic ablation of T cell steroidogenesis restricts primary tumor growth and metastatic dissemination in mouse models. Steroidogenic T cells dysregulate anti-tumor immunity, which can be restored by inhibiting the steroidogenesis pathway. This study demonstrates that T cell de novo steroidogenesis is a cause of anti-tumor immunosuppression and a druggable target.

Steroidogenesis is a metabolic process by which cholesterol is converted to steroids². The biosynthesis of steroids starting from cholesterol is often termed “de novo steroidogenesis”¹. Cytoplasmic cholesterol is transported into the mitochondria, where the rate-limiting enzyme CYP11A1 (also known as P450 side chain cleavage enzyme) converts cholesterol to pregnenolone. Pregnenolone is the first bioactive steroid of the pathway, and the precursor of all other steroids (Figure 1a) ^2,3. The steroidogenesis pathway has been extensively studied in adrenal gland, gonads and placenta. De novo steroidogenesis by other tissues, known as “extraglandular steroidogenesis”, in brain^2,4,5, skin⁶, thymus⁷, and adipose tissues⁸ has also been reported. Steroid production as a result of immune induction from mucosal tissues, such as in the lung and intestine, has been shown to play a tolerogenic role to maintain tissue homeostasis^9,10. However the physiological and pathological role of extraglandular steroidogenesis is largely unknown³.

Figure 1. Generation of a de novo steroidogenesis reporter mouse line and its application to steroidogenic T cell analysis

a. Schematic of de novo steroidogenesis pathway. In steroidogenic cells, such as testicular Leydig cells, cholesterol is imported into the mitochondria, where CYP11A1 converts it into pregnenolone, the first bioactive steroid of the pathway and precursor of all other steroids. CYP11A1 is the first and a key rate-limiting enzyme of the pathway.

b. Cyp11a1-mCherry reporter mice express H2B-tagged mCherry fluorescent protein, and Cyp11a1 as a single mRNA, driven by the endogenous Cyp11a1 promoter. The newly synthesized fusion protein self-cleaves due to presence of a T2A peptide and dissociates into two separate proteins: Cyp11a1 and H2B-mCherry.

c. Cyp11a1-mCherry reporter mice report Cyp11a1 expression accurately. Spleen, testis and adrenal glands were harvested from Cyp11a1-mCherry reporter mice. Tissues were mechanically dissociated and enzymatically digested into single cell suspension. Splenic naïve CD4⁺ T cells were purified by using anti-CD4 antibody conjugated microbeads by using magnetic activated cell sorting (MACS). Single cell suspensions were analyzed by flow cytometry. Gating: All cells > Singlets > Live cells > Cyp11a1-mCherry. Representative of three independent experiments; each experiment contains 3-4 mice.

d. Induction of Cyp11a1 expression in T cells by cytokines. Splenic naïve CD4⁺ T cells from Cyp11a1-mCherry reporter mice were purified by negative selection; activated in the anti-CD3e and anti-CD28 antibody coated plates in the presence of cytokines for 3 days, rested for 2 days, restimulated 6 hours, and Cyp11a1-mCherry expression was analyzed by flow cytometry. Error bars represent mean ± s.e.m, representative of 3 independent experiments.

e. Cyp11a1 expression in T cells. Splenic naïve CD4⁺ and CD8⁺ T cells from Cyp11a1-mCherry reporter mice were purified by negative selection; activated in anti-CD3e and anti-CD28 antibody coated plates under Th1, Th2, Th9, Th17, Tfh, Treg, Tc1 and Tc2 differentiation conditions (activation 3 days, resting 2 days), and Cyp11a1-mCherry expression was analyzed by flow cytometry. Error bars represent mean ± s.e.m, representative of 3 independent experiments.

Steroid hormones are known immunosuppressive biomolecules^11,12. We recently reported that CD4⁺ T cells induce de novo steroidogenesis to restore immune homeostasis by limiting the immune response against a worm parasite¹³. In cancer, the immunosuppressive tumor microenviroenmnt (TME) prevents immune cells from mounting an effective anti-tumor immune reposne¹. Thus we sought to determine whether T cell steroidogenesis contributes to the generation of a suppressive niche in the TME.

Cyp11a1 expression is known to be a faithful biomarker of de novo steroidogenesis due to its role as a central enzyme in this pathway². Therefore, we generated a novel reporter mouse line to identify Cyp11a1-expressing steroidogenic cells definitively (Figure 1b, c, Extended Data Figure 1a, b, c and d). As expected, mCherry expression was detected in single cell suspensions of testis and adrenal glands but not in the spleen (Figure 1c) or other tissues including lung, kidney, blood, liver, bone marrow, lymph nodes and thymocytes (Extended Data Figure 1b).

However, upon activation in vitro, Cyp11a1-mCherry signal was detected specifically in activated type-2 CD4⁺ T helper cells (Th2 cells) (Extended Data Figure 1c), as reported previously¹³. Cyp11a1 expression was only detectable in mCherry-expressing T helper cells but not in the mCherry-negative T helper cells (Extended Data Figure 1d). Exploiting our Cyp11a1-mCherry reporter line, we assayed a panel of cytokines commonly found in inflammatory settings, including tumors, in terms of their ability to induce steroidogenesis in CD4⁺ T cells. IL6, TSLP, IL13, and IL4 induced a strong induction of Cyp11a1-mCherry in CD4⁺ T cells that had also been activated by anti-CD3 and anti-CD28. In contrast, IL12 had minimal effect on steroidogenesis (Figure 1d, Extended Data Figure 2a and b). This result indicates that not only the Th2 but also other T cell types are capable of de novo steroidogenesis. To test this, we differentiated naïve CD4⁺ or CD8⁺ T cells into Th1, Th2, Th9, Th17, Tfh, Treg, Tc1 and Tc2 subsets in vitro. All subsets examined, with the exception of Th1 and Tc1 exhibited Cyp11a1-mCherry expression when stimulated (Figure 1e, Extended Data Figure 2c). Of all T cell subtypes generated in vitro, Th2 cells exhibited the highest levels of Cyp11a1 expression.

Tumor infiltrating T cells are key fate determinants within a tumor, but are often suppressed¹⁴. The steroidogenesis-inducing cytokines examined above are also often present in the TME^15,16, thus we next sought to examine the steroidogenic capacity of T cells infiltrating tumors, and their impact on tumor development. First, to explore Cyp11a1 expression in vivo, we utilized the well-established B16-F10 melanoma model^17–19 and generated subcutaneously implanted tumors in Cyp11a1-mCherry reporter mice.

Cyp11a1 expression was detected in immune cells of primary tumor tissue, but not in tumor-draining brachial lymph nodes (LN) or blood (Figure 2a), indicating that stimulation occurs in situ. Within the tumor, Cyp11a1⁺ tumor infiltrating T cells were predominantly CD4⁺ (helper T cells) rather than CD8⁺ T cells (Figure 2b). We next measured the functional output of Cyp11a1 expression. Significant concentrations of the steroid pregnenolone were detected exclusively in immune cells isolated from tumors, with negligible levels detected in cells from the spleen (Figure 2c). Using the B16-F10 model of experimental metastatic dissemination²⁰, we determined that lungs with metastatic nodules, but not control lungs without metastatic nodules, had elevated levels of pregnenolone (Figure 2d).

Figure 2. Tumors induce steroidogenesis in T cells in vivo

a. Presence of steroidogenic (Cyp11a1⁺) T cells in the B16-F10 melanoma tumor. B16-F10 cells were injected subcutaneously into the shoulder region of Cyp11a1-mCherry reporter mice. After 12 days brachial lymph node (LN), blood and tumor tissues were dissociated into single cell suspensions, and analyzed by flow cytometry. Gating strategy: Singlets > Live cells > CD45, Cyp11a1-mCherry. (N=5)

b. Cyp11a1 expression in CD4⁺ T cells. CD45⁺Cyp11a1-mCherry+ cells were further gated to show T helper cell (CD4⁺CD3e⁺) expression of Cyp11a1.

c. TIL supernatant contains pregnenolone. B16-F10 tumor-infiltrating leukocytes (TIL) were purified from tumor-bearing mice on post-inoculation day 12, cultured for 48 hours, and the supernatant was analyzed by ELISA to measure pregnenolone. Splenic leukocytes from the tumor bearing mice were used as control. N=12, pooled analysis of three independent experiments, symbol represents individual mouse, error bars represent mean ± s.e.m., unpaired two-tailed t-test.

d. Metastatic dissemination of cancer cells induces steroid biosynthesis. Metastasized lungs were harvested 10 days post-B16-F10 intravenous injection in C57BL/6 mice, dissociated into single cell suspension, cultured for 48 hours and the supernatant was analyzed by ELISA. Naïve uninfected lungs (normal lung) were used as control. N=6, symbol represents individual mouse, pooled analysis of two independent experiments, error bars represent mean ± s.e.m., unpaired two-tailed t-test.

e-g. Human tumors induce de novo steroidogenesis. Publicly available data sets from TCGA, GEO and ArrayExpress were analyzed to identify steroidogenic and cytokine gene expression, and their correlation.

e. Human de novo steroidogenic tumor types as predicted by CYP11A1 expression. A diagrammatic presentation of details in Extended Data Figures 3a and b.

f. Steroidogenic gene expression is correlated with IL4 expression in human melanoma. Hierarchical clustering of steroidogenic genes and IL4 mRNA expression across 44 melanoma patient samples (Raw data source: GEO: GSE19234).

g. Frequency distribution histogram showing CYP11A1 mRNA expression (normalized read counts, log10 scale) across 22 melanoma patients’ tumor infiltrating CD4⁺ T cells (Raw data accession code EGAD00001000325).

Having observed steroidogenic T cells in murine melanoma, we turned to publicly available transcriptomic data sets to verify our findings and ascertain relevance in the human setting. We identified CYP11A1 mRNA expression, and thus steroidogenic potential, in a range of cancer types including liver, breast, prostate, lung, kidney, sarcoma, glioma, uterine, cervical, lymphoma and melanoma (Figure 2e and Extended Data Figure 3a,b)¹⁶. Human melanoma tissues represented a prominent steroidogenic tumor type, expressing CYP11A1, HSD3B1, HSD3B2, CYP17A1, CYP21A1, CYP11B1 (Figure 2f). Together, this was indicative of melanoma-driven production of glucocorticoids (Figure 2f, Extended Data Figure 3c).

Interestingly, in melanoma, steroidogenic gene expression was correlated with IL4 expression (Figure 2f, Extended Data Figure 3d), a key inducer of T cell steroidogenesis. Moreover, analysis of human tumor infiltrating CD4⁺ T cell transcriptomes, confirmed CYP11A1 expression (Figure 2g) implying that CD4⁺ T cells are a source of steroids in tumors, mirroring the murine setting. Collectively these data indicate that TILs produce steroids within the tumor both in human and mouse. Since steroid hormones are efficient modulators of metabolism and potent regulators of immune cell function, it is plausible that T cell-mediated steroid biosynthesis may have a profound effect on tumor growth and metastasis.

To determine the functional consequences of T cell-driven steroidogenesis in tumors, we created a Cyp11a1 floxed (Cyp11a1^fl/fl) mouse following EUCOMM/WSI conditional gene targeting strategy²¹. Briefly, a “Knockout-first” (tm1a) mouse line was created using a promoter-driven targeting cassette (Figure 3a). The tm1a mouse was then crossed with Flp-deleter mice (FlpO) ²² to remove the LacZ and Neo cassette and generate a tm1c allele (i.e. Cyp11a1^fl/fl). When crossed with a Cre-driver, the Cre-recombinase removes exon 3 of Cyp11a1 gene and creates a frameshift mutation (Figure 3a). We crossed the Cyp11a1^fl/fl line with a Cd4-driven Cre-recombinase to delete Cyp11a1 and prevent de novo steroidogenesis in all T cells. Deletion efficiency of Cre-recombinase in the Cyp11a1 cKO (Cd4-Cre;Cyp11a1^fl/fl) mice was nearly 100% in Th2 cells (Extended Data Figure 4a). Cyp11a1 cKO mice showed normal thymic development of T cells, and a normal distribution in the peripheral tissues (Extended Data Figure 4b, c).

Figure 3. Ablation of T cell de novo steroidogenesis restricts experimental tumor growth and metastasis

a. Generation of a Cyp11a1 conditional knockout mice. Schematic presentation of the Cyp11a1 conditional knockout mouse line and generation of T cell specific Cyp11a1 knockout mice (Cd4-Cre;Cyp11a1^fl/fl). The targeting allele is shown in the left-hand-side panel and the crossing strategy is on the right.

b. Genetic deletion of Cyp11a1 in T cells inhibits primary tumor growth of B16-F10 melanoma cells. Left-panel: B16-F10 subcutaneous tumor growth curve assessed in T cell specific Cyp11a1 cKO (cKO) and Cd4-Cre control mice (n=5, representative of four independent experiments, error bars represent mean ± s.e.m.). Tumors were measured every day from 6th day after subcutaneous injection of B16-F10 cells. Right panel: Graphical presentation of end-point tumor volume (n ≥ 20, pooled data of four independent experiments, error bars represent mean ± s.e.m., unpaired two-tailed t-test).

c. Genetic deletion of Cyp11a1 in T cells inhibits experimental lung metastasis. Left panel: Representative photograph of pulmonary metastatic foci produced 10 days after tail vein injection of B16-F10 cells. Right panel: Graphical presentation of the numbers of lung metastatic foci (right panel) (n ≥ 15, pooled data of three independent experiments, error bars represent mean ± s.e.m., unpaired two-tailed t-test).

d. Pregnenolone complements the Cyp11a1 deficiency in Cyp11a1 cKO mice. Cyp11a1 cKO and Cd4-Cre control mice were injected with B16-F10 cells. Pregnenolone or vehicle (DMSO) applied topically at the primary tumor site every 48 hrs. Tumor volume was measured at the end-point at day 12. N=5, error bars represent mean ± s.e.m., one way ANOVA, representative experiment.

e. B16-F10 cells were injected subcutaneously in C57BL/6 mice with or without Cyp11a1 inhibitor aminoglutethimide (AG). AG treatment was continued with a 48 hrs interval (N=5, error bars represent mean ± s.d., two way ANOVA, P=0.013, representative experiment).

We subcutaneously implanted Cyp11a1 cKO mice with B16-F10 cells to explore the pathophysiological role of T cell steroidogenesis. Ablation of steroidogenesis in T cells significantly restricted primary tumor growth rates and final volumes (Figure 3b). Similarly, in the experimental metastatic dissemination model, impaired lung colonization was observed in the absence of T cell-expressed Cyp11a1: there was a significant reduction in number of lung metastatic foci in the Cyp11a1 cKO mice compared to the control mice (Figure 3c).

In the B16-F10 subcutaneous melanoma model, topical application of pregnenolone at the primary tumor site was sufficient to compensate for the Cyp11a1 deficiency, restoring tumor growth to levels comparable with control mice (Figure 3d). Furthermore, pharmacological inhibition of Cyp11a1 by aminoglutethimide (AG) recapitulated the tumor restriction phenotype of Cyp11a1 genetic deletion (Figure 3e). Together, these data indicate that, T cell-derived steroids can support tumor growth.

It has been reported that steroid hormones induce immunosuppressive M2 phenotype in macrophages^11,23, cell death and anergy in T cells11 and tolerance in dendritic cells^11,24. Therefore we set out to test whether steroidogenic T cells support tumor growth through the induction of immunosuppressive phenotypes in infiltrating immune cells. To determine whether intratumoral macrophages were M1 or M2 type, we purified tumor infiltrating macrophages (Lin⁻CD45⁺CD11b⁺) and analyzed mRNA expression of the M2-macrophage signature genes Arg1 and Tgfb1. In tumor-infiltrating macrophages from Cyp11a1 cKO mice, Arg1 and Tgfb1 mRNA expression was significantly reduced compared to the control mice, indicating fewer of the tumour-supporting M2 macrophages in the knockout mice (Figure 4a).

Figure 4. Inhibition of T cell steroidogenesis boosts anti-tumor immunity.

Comparing Cyp11a1 cKO and Cd4-Cre control mice with B16-F10 cells injected subcutaneously (n= 5 or 6, error bars represent mean ± s.e.m., unpaired two-tailed t-test, representative experiment)., representative experiment).

a. Tumor infiltrating macrophages (Lin⁻CD11b⁺) were purified by cell sorting at day 12. Arg1 and Tgfb1 mRNA expression was quantified by RT-qPCR, with mRNA expression level normalized by Gapdh mRNA expression.

b. Tumour infiltrating CD3e⁺CD8⁺ T cells purified by cell sorting at day 12, reactivated ex vivo, and Ifng and Tnfa mRNA expression quantified by RT-qPCR, with mRNA expression level was normalised by Rplp0 expression.

c. Co-inhibitory cell surface receptor PD1 and TIGIT co-expression on tumor infiltrating CD4⁺ T cells analyzed by flow cytometry after 12 days post B16-F10 inoculation. Gating: All cells > singlets > live cells > CD4⁺ T cell > PD1, TIGIT.

d. Cytotoxic T lymphocyte (CD8⁺ T cell) degranulation assay. CD107a/LAMP1 expression on tumor infiltrating CD8+ T cells was analyzed by flow cytometry after 12 days post-inoculation of B16-F10 cells. Gating: All cells > singlets > live cells > CD8⁺ T cell > CD107a.

e. NK cell degranulation assay by measuring CD107a/LAMP1 expression on tumor infiltrating NK cells. Gating: All cells > singlets > live cells > NK cells > CD107a.

f. CD4⁺ T cell degranulation assay by measuring CD107a/LAMP1 expression on CD4⁺ T cells. Gating: All cells > singlets > live cells > CD4⁺ T cell > CD107a

g. Graphical summary of the panels a-f above. T cell mediated de novo steroidogenesis in the tumor microenvironment inhibits anti-tumour immunity, in part by inducing M2 phenotype in macrophages and suppressing T and NK cell function. Genetic deletion of Cyp11a1 boosts anti-tumor immunity.

Conversely, significantly higher levels of the cytokines Ifng and Tnfa expression were identified in tumor infiltrating CD8⁺ T cells (Figure 4b). Examination of co-inhibitory receptors Tim-3, PD-1, TIGIT and Lag3^25–27 on tumor-infiltrating T cells revealed a significant reduction in the frequency of PD1 and TIGIT expressing CD8⁺ TILs in the Cyp11a1 cKO mice compared with control littermates. This indicates greater T cell functionality and less exhaustion in the knockout mice (Figure 4c).

To test the tumor cell killing cytotoxic nature of T and NK cell populations, we examined the degranulation response of these cells by analyzing cell surface expression of CD107a/LAMP1 in tumor-infiltrating T and NK cells. We observed a significantly increased proportion of degranulating CD107a⁺CD8⁺ T cells in Cyp11a1 cKO mice compared to control mice (Figure 4d). There was trend for enhanced degranulation response in NK cells and CD4⁺ T cells (Figure 4e, f). Altogether these data suggest that inhibition of T cell steroidogenesis boosts active and functional anti-tumor immunity.

The importance of systemic steroid hormones is well documented in regulating cell metabolism and immune cell function in homeostasis, but the role of local cell type specific steroidogenesis is less clear, particularly in pathologies such as cancer. This is in part due to the lack of tools to study steroidogenesis in a tissue-specific manner in vivo. To overcome this, we generated a novel Cyp11a1-mCherry reporter and a conditional Cyp11a1 knockout mouse strain to identify de novo steroidogenic cells and study their role in vivo.

Using these discovery tools, we uncovered a novel anti-tumor immune suppression mechanism that may be exploited clinically to boost the anti-tumor immunity (Figure 4g). Similar experimental approaches can in future provide in depth mechanistic insights into other extraglandular (local) steroidogenic cell types such as adipose cells, neuron, osteoblasts, astrocytes, microglia, skin, trophoblast and thymic epithelial cells. Furthermore, our Cyp11a1-mCherry reporter mouse line can be used as a discovery tool to identify new steroidogenic cell types in tolerogenic physiological conditions such as pregnancy, mucosal tolerance, and inflammatory and immunopathological conditions such as virus, bacteria, fungi and parasite infections. Their functional role can be dissected by using Cyp11a1 cKO mice using tissue specific Cre-drivers.

Finally, the ability of several cytokines (including IL4, IL5, IL13, IL33, IL23, TSLP, and IL6) to induce steroidogenesis in T cells opens up the possibility that this mechanism is involved in numerous immunological contexts. Further studies in diverse physiological scenarios would be of great interest to more broadly understand the role of immune cell de novo steroidogenesis in regulating inflammation and immunity.

Materials and Methods

Mice

The care and use of all mice in this study were in accordance with the UK Animals in Science Regulation Unit’s Code of Practice for the Housing and Care of Animals Bred, Supplied or Used for Scientific Purposes, the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012. All procedures were performed under a UK Home Office Project licence (PPL 80/2574 or PPL P8837835), which was reviewed and approved by the local institute’s Animal Welfare and Ethical Review Body.

Generation of a Cyp11a1-mCherry reporter mouse line

Targeting Description

Using CRISPR_Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) ²⁸ technology we introduced double strand DNA breaks 5’ and 3’ adjacent to the Cyp11a1 termination codon in exon 9 to facilitate the introduction of our targeting construct. The 5’ and 3’ arms of homology were designed to remove the Cyp11a1 termination codon and 100bp of the 3’ UTR immediately downstream and replace it with a minimal T2a self-cleavage peptide followed by the fluorescent marker mCherry.

Cyp11a1 Guide RNA generation and ESC targeting

sgRNA design and cloning

Using the web-based tool designed by Hodgkins et al²⁹, two sgRNAs were identified 5’ and 3’ adjacent to the Cyp11a1 termination codon. The guide sequences were ordered from Sigma Genosys as sense and antisense oligonucleotides, and annealed before individually cloning into the human U6 (hU6) expression plasmid (kind gift from Sebastian Gerety).

Targeted ES cell generation

3×10 ⁶ C57Bl/6 JM8 ESC (kind gift from Bill Skarnes) were nucleofected with 2ugs Cyp11a1 circular targeting construct, 1.5ugs of each hU6_sgRNAs and 3ugs a plasmid expressing human codon-optimised CAS9 driven by the CMV promotor (Addgene # 41815). 48 hours post transfection the media was changed for G418 selection media. Confirmation of the correct targeting events were confirmed by qPCR for loss of heterozygosity (LOH) and the presence of the selectable marker, and long range (LR) PCR and Sanger sequencing.

Breeding and removal of the Selectable marker

Following blastocyst injection and chimaera breeding three F1 Cyp11a1+/^mCherry-Neo (MGWG18.1f, MGWG16.1b, MGWG16.1d) mice were breed to pCAGGSs-Flpo (kind gift from Andrea Kranz)²² mice to remove the neomycin selectable marker to generate Cyp11a1^+/mCherry.

Generation of a Cyp11a1 cKO mice

Cyp11a1^fl/fl mice were generated by crossing Cyp11a1^{tm1a(KOMP)Wtsi} mice with a previously reported Flp-deleter (FlpO) line²². Cyp11a1^fl/fl mice were crossed with Cd4-cre mice to generate the Cyp11a1 cKO mice.

Syngeneic melanoma model

The C57BL/6 derived B16-F10 melanoma cell line was purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagle medium (DMEM, Life Technologies), supplemented with 1% Penstrep and 10% FBS. For the primary tumor growth assay, 2.5 x10⁵ B16-F10 cells were injected subcutaneously into the shoulders of either wild type (WT) C57BL/6 mice, Cd4-Cre, Cyp11a1^fl/fl or Cd4-Cre;Cyp11a1^fl/fl mice. After 5, 8 and 11 days animals were sacrificed and tissues collected for analysis. In addition, skin was also taken from non-tumor bearing mice. For the experimental metastasis assay, 5×10⁵ B16-F10 cells in a volume of 0.1 ml PBS were injected intra-venously into the tail vein. After ten days (±1 day) the mice were sacrificed via cervical dislocation, and their lungs removed and rinsed in phosphate buffered saline. The number of B16-F10 colonies on all five lobes of the lung were counted macroscopically.

Tumor Tissue Processing

Tumors were mechanically dissociated and digested in 1mg/ml collagenase D (Roche), 1mg/ml collagenase A (Roche) and 0.4mg/ml DNase (Roche) in PBS, at 37°C for 2 hrs. Lymph nodes were mechanically dissociated and digested with 1mg/ml collagenase A (Roche) and 0.4mg/ml DNase (Roche) in PBS, at 37⁰C for 30 mins, after which time, Collagenase D (Roche) was added (final concentration of 1mg/ml) to lymph node samples and digestion was continued for a further 30 mins. EDTA was added to all samples to neutralize collagenase activity (final concentration (5mM) and digested tissues were passed through 70μm filters (Falcon).

Cell sorting

Once processed, single cell suspension tumour samples were incubated with a fixable fluorescent viability stain (Life Technologies) for 20mins (diluted 1:1000 in PBS) prior to incubation with conjugated primary antibodies for 30 mins at 4⁰C. Antibodies were diluted in PBS 0.5% BSA. Stained samples were sorted, using the MoFlo XDP or BD Influx cytometer system.

T helper Cell Culture

Splenic naïve T helper cells from Cyp11a1-mCherry reporter mice were purified with the CD4⁺CD62L⁺T Cell Isolation Kit II (Miltenyi Biotec) and polarized in vitro toward differentiated Th1, Th2, Th9, Th17, iTreg and Tfh subtype as described previously (Pramanik J et al, 2018)³⁰. In brief, naïve cells were seeded into anti-CD3e (2 μg/ml, clone 145-2C11, eBioscience) and anti-CD28 (5 μg/ml, clone 37.51, eBioscience) coated plates. The medium contained the following cytokines and/or antibodies:

Th1 subtype

Recombinant murine IL2 (10 ng/ml, R&D Systems), recombinant murine IL12 (10 ng/ml, R&D Systems) and neutralizing anti-IL4 (10μg/ml, clone 11B11, eBioscience). Th2 subtype: Recombinant murine IL2 (10 ng/ml, R&D Systems), recombinant murine IL-4 (10 ng/ml, R&D Systems) and neutralizing anti-IFNg (10μg/ml, clone XMG1.2, eBioscience). Th9 subtype: 20ng/ml recombinant mouse IL4, 2ng/ml recombinant human TGFb, 10μg/ml neutralizing anti-IFNg. Th17 subtype: 30ng/ml recombinant mouse IL6, 5ng/ml recombinant human TGFb, 50ng/ml recombinant mouse IL23. Tfh subtype: 50ng/ml recombinant mouse IL21, 10μg/ml neutralizing anti-IL4 and anti-IFNg. iTreg subtype: 5ng/ml recombinant mouse IL2, 5ng/ml recombinant human TGFb. The cells were removed from the activation plate on day 4 (after 72 hrs). Th2 cells were cultured for another two days in the absence of CD3e and CD28 stimulation. Then, cells were restimulated by seeding on coated plate for 6 hrs. For flow cytometric detection cells were treated with monensin (2μM, eBioscience) for the last 3 hrs.

In vitro Tc1 and Tc2 differentiation

Splenic naïve CD8⁺ T cells were purified by using Naive CD8a⁺ T Cell Isolation Kit, mouse (Miltenyi Biotec) following manufacturers protocol, and polarized in vitro toward differentiated Tc1 and Tc2. In brief, naive cells were seeded into anti-CD3e (2 μg/ml, clone 145-2C11, eBioscience) and anti-CD28 (5 μg/ml, clone 37.51, eBioscience) coated plates. The medium contained the following cytokines and/or antibodies:

Tc1 subtype

Recombinant murine IL2 (10 ng/ml, R&D Systems), recombinant murine IL12 (10 ng/ml, R&D Systems) and neutralizing anti-IL4 (10μg/ml, clone 11B11, eBioscience). Tc2 subtype: Recombinant murine IL2 (10 ng/ml, R&D Systems), recombinant murine IL-4 (10 ng/ml, R&D Systems) and neutralizing anti-IFNg (10μg/ml, clone XMG1.2, eBioscience).

Quantitative PCR (qPCR)

Tumor infiltrating macrophages (Lin⁻CD11b⁺) and CD8⁺ T cells were purified by cell sorting. We used the Cells-to-C_T kit (Invitrogen/Thermofisher Scientific) and followed SYBR Green format according to manufacturers instructions. 2μl of cDNA was used in 12μl qPCR reactions with appropriate primers and SYBR Green PCR Master Mix (Applied Biosystems). Data were analyzed by ddCT method. Experiments were performed 3 times and data represent mean values ± standard deviation. The primer list is provided below:

• Arg1: F- ATGGAAGAGACCTTCAGCTAC

  R- GCTGTCTTCCCAAGAGTTGGG

• Tgfβ1: F- TGACGTCACTGGAGTTGTACGG

  R- GGTTCATGTCATGGATGGTGC

• Ifnγ: F- ACAATGAACGCTACACACTGC

  R- CTTCCACATCTATGCCACTTGAG;

  Tnfα: F- CATCTTCTCAAAATTCGAGTGACAA

  R- TGGGAGTAGACAAGGTACAACCC

• Gapdh: F- ACCACAGTCCATGCCATCAC

  R- GCCTGCTTCACCACCTTC

• Rplp0: F: CACTGGTCTAGGACCCGAGAA

  R: GGTGCCTCTGGAGATTTTCG

Flow cytometry

We followed eBioscience surface staining, intracellular cytotoplasmic protein staining (for cytokines) and intracellular nuclear protein staining (for transcription factors and Cyp11a1) protocols. Briefly, single cell suspension was stained with Live/Dead Fixable Dead cell stain kit (Molecular Probes/ Thermo Fisher) and blocked by purified rat anti-mouse CD16/CD32 purchased from BD Bioscience and eBioscience. Surface staining was performed in flow cytometry staining buffer (eBioscience) or in PBS containing 3% FCS at 4⁰C. For intracellular cytokine staining cells were fixed by eBioscience IC Fixation buffer and permeabililzed by eBioscience permeabilization buffer. For intra-organelle staining (nuclear and mitochondrial proteins) cells were fixed and permeabilized using Foxp3/Transcription Factor Fixation/Permeabilization Concentrate and Diluent (eBioscience) following the manufacturer’s protocol. Cells were stained in 1x permeabilization buffer with fluorescent dye-conjugated antibodies. After staining cells were washed with flow cytometry staining buffer (eBioscience) or 3% PBS-FCS, and were analyzed by flow cytometer Fortessa (BD Biosciences) using FACSDiva. The data were analyzed by FlowJo software. Antibodies used in flow cytometry were: CD4 (RM4-5 or GK1.5), CD8a (53-6.7), CD3e (145-2c11), CD45 (30F11), CD44 (IM7), CD25 (PC61), B220 (Ra3-6b2), Cyp11a1 (C-16, unconjugated, Santa Cruz; Fluorescent dye conjugated anti-goat secondary was used for staining), Ly6G (1A8), Ly6G/Ly6C (Gr-1) (RB6-8C5), Ly6C (HK1.4), CD11b (M1/70), CD11c (N418), CD19 (1D3), NK1.1(Pk136), Ter119 (TER119), PD-1 (J43), TIGIT (1G9), CD107a/LAMP1(1D4B). All antibodies were purchased from eBioscience, BD Bioscience or Biolegend.

Western Blot Antibodies

Anti-CYP11A1 (Santa Cruz Biotechnology, C-16) and anti-TBP (Abcam) were used.

Quantitative ELISA

CD45⁺ leukocytes were purified from B16-F10 tumor masses and lungs, of mice that had been tail vein administered B16-F0 cells, and seeded at equal density in IMDM medium supplemented with 10% charcoal stripped fetal bovine serum (Life Technologies, Invitrogen) for 24 hrs. Pregnenolone concentrations of the culture supernatants were quantified using pregnenolone ELISA kit (Abnova) and corticosteroids ELISA (Thermofisher) kit following manufacturers’ instruction. Absorbance was measured at 450 nm, and data were analyzed in GraphPad Prism 5.

Funding

CRUK Cancer Immunology fund (Ref. 20193), ERC consolidator grant (ThDEFINE, Project ID: 646794) and Wellcome Sanger Institute core funding (WT206194) supported this study.

Author contribution

BM: Led and managed the project, generated hypothesis, designed and performed experiments, analyzed data. JP: Performed experiments, analyzed data and helped in genetically modified mouse generation. LvdW: Performed B16-F10 pulmonary metastasis experiments, analyzed data. AR: Performed B16-F10 subcutaneous tumors experiments, analyzed data. GK, NAF and KK: Analyzed publicly available gene expression datasets to confirm human tumor expression of steroidogenic genes. ER and GD: Helped in generation of Cyp11a-mCherry and Cyp111a1^fl/fl mouse model. IW: Built the Cyp11a1-mCherry targeting construct. SD: Helped in illustrating conceptual diagram. KO: Helped in designing experiments, writing manuscript, critical comments and supervision. DJA: Conducted pulmonary metastasis experiments. JS: Conducted B16-F10 subcutaneous experiments under her PPL and supervised the study. SAT: Supervised the study. All authors commented on and approved of the draft manuscript before submission.

Acknowledgements

We would like to thank Ana C. Anderson and Rahul Roychoudhuri for their valuable comments on the manuscript and useful discussions; Jana Eliasova for her help with diagram illustration; Bee Ling Ng, Chris Hall, Sam Thompson and Jennie Graham for help with flow cytometry and cell sorting; Research Support Facility, WSI, for their technical help and animal husbandry.