Abstract
Eps15-homology domain containing protein 2 (EHD2) is a dynamin-related ATPase located at the neck of caveolae, but its physiological function has remained unclear. We found that global genetic ablation of EHD2 in mice led to increased fat deposits in several organs. This organismic phenotype was paralleled at the cellular level by an increased lipid uptake via a CD36-dependent pathway, an elevated number of detached caveolae and higher caveolar mobility. Following a high fat diet, various enzymes involved in de novo fatty acid synthesis were down-regulated in EHD2 KO mice. Furthermore, EHD2 expression itself was down-regulated in the visceral fat of two obese mouse models and in diet-induced obesity. Thus, EHD2 controls a cell-autonomous, caveolae-dependent lipid uptake pathway, implicating a role of EHD2 in fat accumulation and obesity.
Introduction
Caveolae are small membrane invaginations of the plasma membrane that are abundantly found in adipocytes, endothelial and muscle cells (Cheng and Nichols, 2016). They have been implicated in the regulation of membrane tension (Sinha et al., 2011; Torrino et al., 2018), in mediating lipid metabolism (Liu et al., 2008), or in acting as distinct sites for specific and highly regulated signaling cascades such as the endothelial nitric oxide synthase (eNOS)-nitric oxide (NO) pathway (Ju et al., 1997). The characteristically shaped caveolar bulb has a typical diameter of 50 - 100 nm and is connected to the cell surface via a narrow neck region. The integral membrane protein Caveolin (with three isoforms in human, Cav1-3) and the peripheral membrane protein Cavin (with four isoforms in human, Cavin1-4) build a mesh-like coat around the caveolar bulb (Ludwig et al., 2013; Kovtun et al., 2015; Mohan et al., 2015; Ludwig, Nichols and Sandin, 2016; Stoeber et al., 2016). In addition, BAR domain containing proteins of the PACSIN/syndapin family (PACSIN1-3 in human) participate in the biogenesis of caveolae (Hansen, Howard and Nichols, 2011; Senju et al., 2011; Seemann et al., 2017).
Loss of Cav1/Cav3 or Cavin1 results in a complete lack of caveolae from the plasma membrane (Drab et al., 2001; Hill et al., 2008; Liu et al., 2008). Also, Cavin2 knockout (KO) mice show a decreased number of caveolae at the plasma membrane in adipocytes and lung endothelium, but not in cardiomyocytes or heart endothelium, suggesting a cell-type specific function (Hansen et al., 2013). In contrast, loss of the muscle-enriched PACSIN3/syndapin III leads to the loss of caveolae in cardiomyocytes (Seemann et al., 2017). The deletion of Cavin3 alone does not alter caveolae formation or caveolar protein assembly (Hansen et al., 2013; Liu et al., 2014).
Cav1 KO mice suffer from cardiomyopathy, pulmonary hypertension, endothelium-dependent relaxation problems and defective lipid metabolism (Cheng and Nichols, 2016). In agreement with the latter, Cav1 KO mice are resistant to high fat diet-induced obesity (Razani et al., 2002) and display smaller white adipocytes and fat pads (Martin et al., 2012). Furthermore, increased levels of triglycerides and fatty acids are found in blood plasma samples obtained from Cav1 KO mice suggesting a reduced cellular uptake of fatty acids (Razani et al., 2002). A similar metabolic phenotype was found in mice lacking Cavin1 (Hill et al., 2008; Liu et al., 2008; Ding et al., 2014). Conversely, overexpression of Cav1 in adipocytes results in enhanced fat accumulation, enlarged adipocytes and lipid droplets (LDs) (Briand et al., 2014). An increased number of caveolae is also found at the plasma membrane of Cav1 overexpressing adipocytes. These results suggest that caveolae are involved in fat accumulation in adipocytes and may promote fatty acid uptake (Pohl et al., 2004). However, the molecular mechanisms of caveolae-dependent fat uptake have remained obscure.
Eps15 homology domain containing protein 2 (EHD2) localizes to the caveolar neck region (Morén et al., 2012; Stoeber et al., 2012; Ludwig et al., 2013). The protein belongs to the dynamin-related EHD ATPase family, which comprises four members in human (EHD1-4), and shows strong expression in human adipose and muscle tissue (human protein atlas) (Uhlén et al., 2015). EHD is built of an N-terminal GTPase (G)-domain, which mediates dimerization and oligomerization, a helical domain containing the membrane binding site, and a C-terminal regulatory Eps15 homology (EH)-domain. The proteins exist in a closed auto-inhibited conformation in solution (Daumke et al., 2007). When recruited to membranes, a series of conformational changes aligns the phospholipid binding sites with the membrane and facilitates oligomerization of EHD2 into ring-like structures (Shah et al., 2014; Hoernke et al., 2017; Melo et al., 2017).
Down-regulation of EHD2 in cell culture results in decreased surface association and increased mobility of caveolae, whereas EHD2 overexpression stabilizes caveolae at the plasma membrane (Morén et al., 2012; Stoeber et al., 2012; Mohan et al., 2015; Shvets et al., 2015). This led to the hypothesis that formation of an EHD2-ring at the neck of caveolae restricts caveolar mobility within the membrane. In agreement with this hypothesis, EHD2 assembles in an ATP-dependent fashion into ring-like oligomers in vitro and induces the formation of tubular liposomes with an inner diameter of 20 nm, corresponding to the diameter of the caveolar neck (Daumke et al., 2007). Whether EHD2 also controls caveolar membrane dynamics in vivo and what the physiological consequences of EHD2 loss at the organismic level are, is unknown.
In this study, we found that EHD2 KO mice revealed enlarged fat accumulations in several organs, and increased lipid droplets (LDs) in caveolae-harboring cell types like adipocytes, muscle or liver cells. In tissue and cells lacking EHD2, caveolae were frequently detached from the plasma membrane and displayed elevated mobility. We demonstrate that fatty acid uptake via the fatty acid translocase CD36 is increased in adipocytes from EHD2 KO mice. Furthermore, in two obesity mouse models or after high fat diet, reduced EHD2 expression and an increased numbers of detached caveolae were found in visceral fat. Our data establish EHD2 as a negative regulator of caveolae-dependent lipid uptake and implicate a crucial role of caveolar stability and dynamics for lipid homeostasis and obesity.
Results
Generation of EHD2 knockout mouse model
To elucidate the expression pattern of EHD2, immunostainings on cryostat sections of C57BL6/N E15 mouse embryos were performed. They revealed strong EHD2 expression in the developing heart (Fig. 1A, see arrow), blood vessels (Fig. 1A, e.g. umbilical cord marked by star) and brown adipose tissue (BAT, Fig. 1A, see arrow head), e.g. in tissues where caveolae are particularly abundant (Cheng and Nichols, 2016). These results were corroborated by in situ hybridizations against EHD2 mRNA, which indicated strong EHD2 expression in BAT of an E18 C57BL6/N embryo (Fig. S1A). Intense EHD2 staining was also observed in cryostat sections of adult C57BL6/N heart, white adipocyte tissue (WAT) and BAT (Fig. 1B-D).
A Cryostat section of a C57BL6/N E15 mouse embryo stained against EHD2 (red), actin (green) and the nucleus (Blue, DAPI). White arrowhead indicates BAT, arrow indicates heart, star illustrates umbilical cord. B-D Cryostat sections obtained from adult C57BL6/N heart (E), white (F) and brown (G) adipose tissue were stained against EHD2 with an EHD2-specific antibody.
E Generation of the EHD2 KO mouse model. A targeting vector containing a pGK-Neomycin (neo) cassette and loxP sites flanking exon 3 was placed in the EHD2 wt allele. EHD2 del/del mice were obtained by breeding with Cre-deleter mouse strain (DTA - diphtheria toxin A).
F Genotyping of EHD2 delta E3 offspring (wildtype – band size 1,700 bp; EHD2 KO – band size 830 bp).
G EHD2 mRNA level in EHD2 del/+ and EHD2 del/del mice (mRNA from BAT, n = 5, bar column bar graph represents mean + SE, Mann Withney U test, *** P < 0.0001).
H Western Blot analysis of different tissues in EHD2+/+, +/- and -/- mice against EHD2, Cav1 and Cavin1.
I EHD2 immuno-staining in BAT cryostat sections from EHD2 +/+, del/+ and del/del mice, see also Fig. S1.
To examine the physiological function of EHD2, a mouse strain with LoxP recognition sites surrounding exon 3 and intron 3 of the Ehd2 gene was engineered (Fig. 1E). Exon 3 encodes part of the highly conserved GTPase domain (residues 137-167), and its deletion is predicted to result in non-functional protein. Following global removal of exon 3 by crossings with a germ-line specific Cre-deleter strain, offspring mice were back-crossed with the C57BL6/N mouse strain for five generations, yielding a global EHD2 KO mouse model.
Genotyping of offspring confirmed the successful deletion of EHD2 exon 3 in EHD2 del/del animals (Fig. 1F) and real-time PCR revealed the absence of EHD2 mRNA in the EHD2 del/del tissue (Fig. 1G). Western blot analysis of EHD2 +/+ and del/+ tissues indicated the expression of EHD2 in several organs, such as heart, muscle, fat, lung, intestine and bladder, compared to its complete loss in EHD2 del/del mice (Fig. 1H). Cav1 and Cavin1 protein levels remained unchanged upon loss of EHD2. Immunostaining of cryostat sections obtained from EHD2 del/del brown adipose tissue did not reveal any significant differences in Cav1 or Cavin1 expression and localization (Fig. S1B). Furthermore, BAT immunostainings in adult mice illustrated the same high expression of EHD2 for +/+ and del/+ mice, whereas the EHD2 KO mice (del/del) showed a complete loss of EHD2 staining (Fig. 1I). In adult heart sections, specific staining of EHD2 in +/+ and del/+ mice was observed, and again no staining was seen in EHD2 KO mice (Fig. S1C).
Loss of EHD2 results in increased lipid accumulation
EHD2 del/del mice were born in normal Mendelian ratios, were fertile and did not show an obvious phenotype upon initial inspection. However, when one year-old EHD2 del/del male mice were dissected, the heart was surrounded by white fat deposits, and an increased amount of epigonadal and periinguinal white fat was observed, in contrast to the EHD2 del/+ male sibling controls or C57BL6/N male mice (Fig. 2A, C, Fig. S2A). Notably, heart and body weight did not differ in EHD2 del/del compared to EHD2 del/+ mice (Fig. 2B-D).
A-B EHD2 del/+ and EHD2 del/del mice during preparation (A). The body weight was monitored over 12 months (B, n = 7, line graph represents mean +/- SE).
C-D Illustration of EHD2 del/+ and del/del hearts (C, scale bar 1 cm) and its weight (D, n = 10).
E-F Masson Trichrome staining of WAT paraffin sections of EHD2 del/+ and EHD2 del/del. Detailed analysis of the adipocytes cell size (F, n(del/+) = 172/3, n(del/del) = 199/3).
G Lipid composition analysis of 15 µg WAT obtained from EHD2 del/+ or EHD2 del/del mice.
H EHD2 del/del mice showed decreased BAT in the neck region. Instead, WAT was integrated into the BAT depots.
I-J Masson Trichrome staining of EHD2 del/del BAT paraffin sections and BAT cryostat sections stained against the LD coat protein Perilipin1. LD size was measured in BAT cryostat sections (J, n(del/+) = 118/3, n(del/del) = 104/3).
K-M Representative image of liver obtained from EHD2 del/+ or del/del mice (K). Oil Red O staining of liver and muscle tissue (L, M, n(liver) = 30/3, n(muscle) = 26/3).
Box plots indicate each replicate with mean +/- SE, column bar graphs show mean + SE, normal distributed groups were analyzed by t-test, not normally distributed values with Mann Withney U test, * P<0.05, *** P<0.0001. For comparison to C57BL6/N, see also Fig. S2.
When analyzed in more detail, white adipocytes of EHD2 del/del mice showed an increased cell size compared to adipocytes of EHD2 del/+ mice (Fig. 2E, F), likely due to increased lipid storage. Indeed, lipid composition measurements of WAT indicated an increased amount of storage lipids (mainly triacylglycerol) in EHD2 del/del mice compared to EHD2 del/+ (Fig. 2G). Similarly, elevated fat accumulations in LDs were found in EHD2 del/del BAT (Fig. 2H). Histological inspections of BAT paraffin and cryostat sections stained against the LD coat protein Perilipin1 indicated an increased LD size in EHD2 del/del BAT compared to EHD2 del/+ or C57BL6/N mice (Fig. 2I, J, Fig. S2B-D). Moreover, liver of EHD2 del/del mice displayed a yellowish appearance, suggesting increased fat accumulation (Fig. 2K). This was confirmed by Oil red O staining of liver sections (Fig. 2L, Fig. S2E). Elevated fat accumulations were also observed in EHD2 del/del muscle sections (Fig. 2L, M, Fig. S2E, F), indicating a general function of EHD2 in lipid metabolism in many cell types. As no significant differences in EHD2 expression levels and lipid accumulation (Fig. 1, S1 and S2) were found in EHD2 del/+ and C57BL6/N male mice, the following animal experiments were carried out with EHD2 del/+ as control group to EHD2 del/del male mice to reduce animal numbers.
Based on the increased lipid accumulation in EHD2-lacking adipocyte tissue, we further investigated if adipocyte differentiation is impaired in EHD2 del/del WAT. However, gene expression analysis of adipogenic marker genes like PPRaγ, Retn or Serpina3k displayed no significant change compared to EHD2 del/+ WAT (Fig. S2G). Furthermore, glucose tolerance was tested in EHD2 del/del mice but did not reveal major differences for blood glucose concentrations after glucose injection compared to EHD2 del/+ mice (Fig. S2H).
Increased lipid droplet size in adipocytes lacking EHD2
To explore the function of EHD2 at the cellular level, lipid metabolism was investigated in cultured adipocytes. Primary pre-adipocytes were isolated from WAT of EHD2 del/+ and EHD2 del/del mice and differentiated into mature adipocytes. Oil red O staining revealed increased lipid accumulation in adipocytes lacking EHD2 (Fig. 3A, B). BODIPY staining of these cultures was used to measure the LD size. Undifferentiated EHD2 del/+ and del/del pre-adipocytes had similarly sized LDs. In contrast, enlarged LDs were found in differentiated EHD2 del/del adipocytes, compared to a moderate size increase in EHD2 del/+ cells (Fig. 3C-E). 3D reconstruction of EHD2 del/del differentiated adipocytes revealed that some LDs even exceeded the volume of the nucleus (Fig. 3C).
A-B Oil Red O staining of cultured untreated pre-adipocytes and differentiated adipocytes (untreated: n(del(+) = 41/4, n(del/del) = 36/4); differentiated: n(del/+) = 84/6, n(del/del) = 106/8).
C-E Analysis of LD size in EHD2 del/del and EHD2 del/+ adipocytes by staining with BODIPY (untreated: n(del(+) = 74/3, n(del/del) = 60/3); differentiated: n(del/+) = 132/3, n(del/del) = 95/3). 3D reconstruction of EHD2 del/del differentiated adipocyte. Green – LDs, blue – nucleus.
F Cultivated EHD2 cKO flox/wt or flox/flox adipocytes were transfected with Cre recombinase-EGFP to induce EHD2 deletion and differentiated for 5 days, lipid droplets were stained with Nile Red for analysing (n(flox/wt) = 74/2, n(flox/flox) = 82/2).
G Pre-adipocytes were treated with either differentiation medium containing delipidated FBS or without glucose and BODIPY staining illustrating LDs.
H-I Fatty acid uptake assay in differentiated EHD2 del/+ and EHD2 del/del adipocytes. Dodecanoic acid-BODIPY uptake was measured after 5, 10, 20, 30 or 60 min, and R1 population indicates positively stained cells (illustrated in red in graphs H, I). R2 populations (blue) correspond to higher BODIPY staining intensity in cells and represent adipocytes with increased amount of dodecanoic acid taken up (shown in blue in graphs H, I).
J-M Overview of fatty acid uptake (percent cell numbers (J), normalization of EHD2 del/del R2 population relative to EHD2 del/+ R2 (K), time scale (L); J-L, n(del/+) = 6/3 experiments, n(del/del) = 8/3 experiments). Example images of differentiated adipocytes treated with dodecanoic acid for 60 min (M, scale bar 40 µm).
Column bar graphs and line graphs illustrate mean +/- SE, t-test or Mann Withney U test were used to calculate significance, * P<0.05; *** P<0.0001. See also Fig. S3.
Next, we aimed to address the possibility that increased lipid uptake is a secondary effect of EHD2 deletion mediated via putative organ cross-talk. We therefore repeated the experiments with cultivated adipocytes derived from EHD2 cKO flox/flox mice, in which EHD2 expression was down-regulated by expression of Cre recombinase via viral transfection (AAV8). Again, EHD2 removal led to increased LD growth (Fig. 3F), indicating a cell-autonomous function of EHD2 in controlling lipid uptake.
LD growth is mainly mediated by extracellular fatty acid uptake and conversion into triglycerides, whereas increased glucose uptake and de novo lipogenesis only play a minor role in this process (Wilfling et al., 2013; Rutkowski, Stern and Scherer, 2015). Fatty acids and lipids are present in high concentrations in fetal bovine serum (FBS). Addition of delipidated FBS during adipocyte differentiation resulted in complete loss of LD in both genotypes (Fig. 3G), whereas glucose-depletion led to a general impairment of adipocyte differentiation. However, enlarged LD could still be observed in KO adipocytes under the latter conditions (Fig. 3G). These data led us to speculate that the increased LD size in EHD2 del/del adipocytes may be a consequence of increased fatty acid uptake.
To test this possibility directly, we monitored the uptake of extracellularly added fatty acids into differentiated adipocytes using BODIPY-labelled dodecanoic acid (FA12) paired with FACS analysis. After 5 min, only a minor fraction of EHD2 del/+ adipocytes displayed intense BODIPY staining (R2, for definition see Fig. 3H, J). This R2 population increased to more than 30% after 60 min of FA12 treatment. EHD2 del/del adipocytes displayed increased BODIPY staining at both early (Fig. 3I, K) and late time points (Fig. 3I, L), indicating accelerated lipid uptake. In line with these experiments, light microscopy imaging revealed a more intense BODIPY staining of EHD2 del/del cells compared to EHD2 del/+ adipocytes after 60 min of fatty acid incubation (Fig. 3M). In contrast, EHD2 del/+ and EHD2 del/del adipocytes did not differ with respect to their ability to take up extracellularly added glucose (Fig. S3A-C). Previously, an involvement of EHD2 in the autophagic engulfment of LD (lipophagy) was suggested (Li et al., 2016). However, inducing starvation by incubation of differentiated adipocytes with Hank’s balanced salt solution (HBSS) revealed no differences in the release of stored lipids in EHD2 del/+ and EHD2 del/del adipocytes, and both genotypes displayed similar reductions in lipid accumulation (Fig. S3D). These data indicate that loss of EHD2 does not affect the release of fatty acids or lipophagy, but specifically controls LD size by regulating fatty acid uptake.
Loss of EHD2 results in detachment of caveolae from the plasma membrane in vivo
To address if the absence of EHD2 results in altered caveolar morphology, WAT and BAT were analyzed by electron microscopy (EM). Caveolae in EHD2 del/+ BAT were mostly membrane-bound and displayed the characteristic flask-shaped morphology (Fig. 4A, white arrows, ratio detached/membrane bound caveolae = 0.27). Strikingly, an increased number of caveolae were detached from the plasma membrane in BAT isolated from EHD2 del/del mice compared to EHD2 del/+ controls (Fig. 4A, B, black arrows, ratio detached/membrane bound caveolae = 1.75). The total number of caveolae, as well as the caveolar diameter and size, were unchanged in brown adipocytes lacking EHD2. An increased number of detached caveolae were also observed in EHD2 del/del white adipocytes compared to EHD2 del/+ cells from littermate controls (Fig. 4C, D, black and white arrow heads, ratio detached/membrane bound caveolae (del/del) = 1.2 vs. ratio (del/+) = 0.24). In white adipocytes, a reduced total number of caveolae was determined, while both caveolar size and diameter were increased in EHD2 del/del compared to EHD2 del/+ animals (Fig. 4D). Cav1 immunogold labeling confirmed that the round vesicles close the plasma membrane, indeed, were detached caveolae (Fig. 4E). 3D visualization of EHD2 del/del brown adipocyte by electron tomography (ET) further demonstrated that the majority of detached caveolae in 2D EM images were not connected to the plasma membrane (Fig. 4F, G, Movie S1) but localized 20-30 nm underneath (Fig. 4G a, b), although some caveolae close to the plasma membrane showed thin connections (Fig. 4G b, d, white arrow head). Taken together, EM and ET reveal an increased detachment of caveolae from the plasma membrane in EHD2 del/del adipocytes, suggesting a crucial function for EHD2 in the stabilization of caveolae at the plasma membrane.
A-B Representative EM images of BAT from EHD2 del/+ and del/del mice and systematic analysis (caveolae number: n(del/+) = 140/3, n(del/del) = 100/3; caveolae size and diameter: n(del/+) = 201/3, n(del/del) = 171/3). Scale bar 500 nm.
C-D EM images of EHD2 del/+ and del/del WAT (caveolae number: n(del/+) = 108/3, n(del/del) = 124/3; caveolae size and diameter: n(del/+) = 151/3, n(del/del) = 185/3). Scale bar 500 nm.
E Representative image for EM gold immunolabeling against Cav1. Control labeling did not reveal specific staining. Scale bar 200 nm.
F-G Electron tomogram of a 150 nm EHD2 del/del BAT section (F). The 3D model contains the plasma membrane (G, green) and the detached caveolae (violet). Detachment of caveolae was observed by changing the viewing angle (white arrow indicates the direction). Closer inspection of cell membrane and caveolae clearly showed displacement of caveolae from the membrane. The 3D model also revealed attachment of caveolae to the membrane (arrow head).
Graphs illustrate each replicate with mean +/- SE, t-test or Mann Withney U test were used to calculate significance, ** P<0.001; *** P<0.0001. See also Movie S1.
Increased caveolar mobility in EHD2 knockout cells
To verify the cell-autonomous EHD2-mediated control of LD size and to further dissect the interplay of caveolar mobility and LD growth at the molecular level, we analyzed mouse embryonic fibroblasts (MEFs) derived from EHD +/+ and EHD2 del/del mice. Oil Red O staining showed increased intensity in EHD2 del/del MEFs after adipogenic differentiation compared to EHD2 +/+ MEFs (Fig. S4A), suggesting increased lipid accumulation. BODIPY staining of EHD2 del/del MEFs revealed enlarged LD sizes after differentiation or treatment with oleic acid for 6 h (Fig. S4B, C). Furthermore, both storage and membrane lipids were largely increased in MEFs lacking EHD2 (Fig. S4D). Re-expression of an EGFP-tagged EHD2 version in MEFs lacking EHD2 completely rescued the observed LD phenotype. In fact, overexpression of EHD2 in +/+ and del/del MEFs reduced the size of LDs compared to EGFP expressing cells (Fig. 5A, B). These data indicate a general and cell autonomous role of EHD2 in the control of LD growth and size.
A-B EHD2 +/+ and del/del MEFS were transfected with either pEGFP or pEHD2-EGFP, incubated for 48 h and afterwards treated for 6 h with oleic acid and Nile Red staining was performed to determine LDs (pEGFP: n(+/+) = 309/3, n(del/del) = 310/3; pEHD2-EGFP: n(+/+) = 218/4, n(del/del) = 184/4).
C-D EHD2 del/del MEFs were treated with Cav1 siRNA and lipid droplets were stained with BODIPY (negative control: n(+/+) = 504/3, n(del/del) = 530/3; Cav1 siRNA: n(+/+) = 521/3, n(del/del) = 558/3); Clth HC - clathrin heavy chain.
E-F EHD2 MEFs were treated with Cholera toxin subunit B Alexa594 uptake in EHD2 +/+ and del/del MEFs after 30 min (F, n(+/+) = 40/5, n(del/del) = 40/6).
G-H TIRF live-imaging of EHD2 +/+ and del/del MEFs expressing pCav1-EGFP. Line scan analysis of the recorded Cav1 intensities revealed for fixed, non-moving caveolae lines and for fast moving caveolae single sparks (as illustrated in a and b, n(+/+) = 90/3; n(del/del) = 92/3; each replicate is represented with mean +/- SE).
Box plots indicate maximal to minimum value with median, column bar graphs show mean + SE, t-test or Mann Withney U test were used to calculate significance, *** P<0.0001. See also Fig. S4 and Movie S2-4.
To test if the observed increased LD size in EHD2 del/del MEFs was dependent on caveolae, MEFs lacking EHD2 were treated with Cav1 siRNA to eliminate caveolae. Indeed, LD sizes in EHD2 KO MEFs were significantly decreased after Cav1 knockdown compared to control siRNA treated cells (Fig. 5C, D), pointing to a crucial role of caveolae in EHD2-controlled LD size.
Next, we investigated caveolar mobility and endocytosis of Cholera toxin subunit B (CTxB) in EHD2 +/+ and del/del MEFs. CTxB can be internalized by multiple pathways including caveolar uptake as well as by clathrin-(and caveolin)-independent carriers (CLICs, Parton and Simons et al., 2007). Strikingly, MEFs lacking EHD2 showed increased CTxB uptake compared to EHD2 +/+ MEFs (Fig. 5E, F).
To analyze caveolae dynamics directly, we monitored caveolar movement by total internal reflection fluorescence (TIRF) microscopy. EHD2 +/+ and del/del MEFs were transfected with pCav1-EGFP to label single caveolae. As illustrated in Fig. 5G, regions of moderate Cav1 expression were investigated to ensure that distinct Cav1 spots were observed during the analysis. Live TIRF imaging of EHD2 wt MEFs showed a slow or no continuous movement for the majority of investigated caveolae (Movie S2). However, single caveolae moved along the plasma membrane or left the TIRF illumination zone towards the inside of the cell, indicative of their spontaneous detachment, as previously reported (Moren et al., 2012). Strikingly, movement and velocity of caveolae was greatly increased in EHD2 del/del MEFs (Movie S3), not allowing Cav1 single spots to be tracked. Line scan analysis revealed a greatly reduced number of fixed, non-moving Cav1 spots (referred to as lines in Fig. 5G) in EHD2 del/del MEFs compared to wt cells. Moreover, a larger number of highly mobile Cav1 sparks, reflecting fast moving caveolae, was found in EHD2 del/del cells (Fig. 5G, H). Re-expression of EHD2 in EHD2 del/del MEFs reduced the mobility of caveolae, often leading to their immobilization (Fig. S4E). Collectively, these data show that EHD2 crucially regulates cellular lipid uptake and caveolar mobility.
The fatty acid translocase CD36 is involved in EHD2-dependent fatty acid uptake
CD36 had previously been implicated in caveolae-dependent fatty acid uptake (Aboulaich et al., 2004; Ring et al., 2006; Eyre et al., 2007). We therefore examined whether the increased fatty acid uptake in EHD2 del/del adipocytes and EHD2 del/del MEFs is mediated by CD36. Initially, we analyzed CD36 localization in MEFs using immuno-live stainings (Fig. 6A). Strong CD36 signal was detected at the cell membrane, where a minor pool of CD36 co-localized with Cav1. Partial co-localization of CD36 and Cav1 was further confirmed by high-resolution z-stack imaging (Fig. 6A). Both EHD2 KO MEFs (Fig. 6A) and del/del adipocytes (Fig. S4F) showed a slight reduction in CD36 plasma membrane levels compared to EHD2 expressing cells (Fig. 6C, siRNA negative control), possibly reflecting the increased amount of detached caveolae due to EHD2 loss. Removal of caveolae by Cav1-specific siRNAs treatment resulted in significantly decreased CD36 plasma membrane staining in EHD2 +/+ and del/del MEFs (Fig. 6B, C) suggesting a function of caveolae for CD36 membrane localization (Fig. 6D).
A CD36 localization was investigated by antibody staining in EHD2 +/+ and del/del MEFs. Partial co-localization of CD36 and Cav1 was observed by confocal airyscan z-stack imaging.
B Example images for CD36 and Cav1 staining after Cav1 siRNA treatment in EHD2 +/+ and del/del MEFs (cells are indicated by white surrounding lines, compare to staining in A).
C Fluorescence intensity measurement of Cy3-Rabbit antibody after Rabbit-CD36 live staining in Cav1 siRNA treated MEFs (negative control: n(+/+) = 584/6, n(del/del) = 475/6; Cav1 siRNA#1: n(+/+) = 341/3, n(del/del) = 249/3; Cav1 siRNA#2: n(+/+) = 412/3, n(del/del) = 468/3; Cav1 siRNA#3: n(+/+) = 251/3, n(del/del) = 368/3; box plots indicate median with whiskers from maximal to minimum value, siRNA negative control was compared to Cav1 siRNA for statistical analysis).
D Correlation of Cav1 and CD36 staining intensities in EHD2 +/+ and del/del MEFs (n(+/+) = 150/4, n(del/del) = 120/4; Pearson correlation; graph shows each replicate and related linear regression including 95% confidence interval).
E-F LD size after CD36 siRNA knockdown in EHD2 +/+ and del/del MEFs (D, negative control: n(+/+) = 584/6, n(del/del) = 475/6; CD36 siRNA#1: n(+/+) = 341/3, n(del/del) = 249/3; CD36 siRNA#2: n(+/+) = 412/3, n(del/del) = 468/3; CD36 siRNA#3: n(+/+) = 251/3, n(del/del) = 368/3; graph illustrates each replicate with mean +/- SE, 2-way ANOVA test were used to calculate significance between siRNA negative CTRL and siRNA, t-test was used between +/+ and del/del data).
*P<0.05, **P<0.001, ***P<0.0001. See also Fig. S5.
To investigate the causal relationship between the increased LD growth in EHD2 KO MEFs and CD36-mediated lipid uptake, CD36 expression was downregulated in MEFs by treatment with either one of three specific CD36 siRNA, followed by oleic acid application and LD staining. CD36 antibody staining confirmed efficient knockdown of CD36 in EHD2 +/+ and del/del MEFs (Fig. 6E). Strikingly, removal of CD36 in EHD2 +/+ and del/del MEFs dramatically decreased the size of LDs compared to a control siRNA treated cells (Fig. 6E, F). We conclude that the observed enlargement of LDs in cells lacking EHD2 depends on CD36.
Decreased EHD2 expression in genetic obesity models or diet induced obesity
To examine the effect of genetic EHD2 deletion during diet-induced obesity, EHD2 del/+ and del/del mice were fed with a high fat diet (60% kcal fat) for 10 days or 4 months, and the body weight was monitored every 5 days.
Within the first 10 days of high fat feeding, a strong rise in body weight was observed for both genotypes, which was slightly faster in EHD2 del/del mice compared to EHD2 del/+ (Fig. 7A, 0.84 vs. 0.73 g/day). However, in the following days, the differences in the overall body weight disappeared (Fig. 7B). As already observed in EHD2 del/del mice on a standard diet, white and brown adipocytes from EHD2 del/del mice revealed enlarged LD sizes compared to EHD2 del/+ after 10 days on the high fat diet (Fig. 7D). Similar effects were obtained in liver sections (Fig. 7D). After 4 months of high fat feeding, enlarged lipid accumulation was observed in adipocytes and liver in both genotypes (Fig. S5A, B). Fat mass in EHD2 del/+ and EHD2 del/del mice did not differ after short or long-term high fat feeding (Fig. 7C).
A-B EHD2 del/+ and EHD2 del/del mice were fed with a high fat diet (60% kcal fat) for 10 days (A) or 4 months (B) and body weight was measured every 5 days (A, n(day 0-10) = 12; B, n(day 15-110) = 6).
C Body composition analysis after 10 days or 4 months of high fat diet (n(10 days high fat diet) = 7; n(4 months of high fat diet) = 6).
D After 10 days high fat feeding, adipocyte cell sizes were analyzed in EHD2 del/+ and EHD2 del/del WAT paraffin sections (n(del/+) = 317/2; n(del/del) = 337/2). BAT cryostat sections were stained against Perilipin1 (red – Perilipin1, blue – DAPI; n(del/+) = 263/2; n(del/del) = 236/2). Oil Red O staining of liver sections obtained from EHD2 del/+ and EHD2 del/del mice fed for 10 days with high fat diet (n(del/+) = 28/2; n(del/del) = 29/2).
E-F Expression levels of genes involved in de novo lipogenesis in EHD2 del/del and del/+ WAT following standard diet (SD, E) or high fat diet (HFD, F; n(SD) = 8-12/4; HFD, n(del/+) = 8/3, n(del/del) = 6/3).
G EHD2 expression in white adipocytes of EHD2 del/+ mice fed with high fat diet (HFD) compared to EHD2 del/+ mice under standard diet (n = 5).
H EHD2 expression level was analyzed in fat tissue of ob/ob or NZO mouse models compared to C57BL6/N mice (n = 5, graph illustrates mean +/- SE).
I-J Investigation of caveolae by EM imaging (n(ob/ob mice) = 85/2; n(C57BL6/N) = 117/2; graph illustrates mean +/- SE).
K The model illustrates the EHD2-caveolae dependent fatty acid uptake. CD36 localizes within caveolae, consequently, CD36 can bind and transfer free fatty acids (FFA) through the plasma membrane (PDB: 5LGD, (Hsieh et al., 2016)). After loss of EHD2, the enhanced mobility and detachment of caveolae results in an increased fatty acid uptake either via direct fusion or docking to the ER or via the endosomal pathway (FFA - free fatty acid, ER – endoplasmic reticulum, LD – lipid droplet).
Box plots indicate median with whiskers from maximal to minimum value, column bar and line graphs show mean +/- SE, normal distributed groups were analyzed by t-test, not normal distributed values with Mann Withney U test, * P<0.05, *** P<0.0001. See also Fig. S5-6.
The weight adaptation of both genotypes suggested the occurrence of compensatory mechanisms. First, we looked for changes of adiponectin, leptin and insulin blood levels but did not detect any significant difference in mice lacking EHD2 compared to EHD2 del/+ mice after 4 months of high fat feeding or under standard diet (Fig. S6A, B). Free fatty acid concentration in blood plasma was slightly reduced in EHD2 del/del samples after standard diet indicating increased fatty acid uptake (Fig. S6B).
Already under standard diet, we observed a down-regulation of genes involved in de novo lipogenesis in EHD2 del/del vs. EHD2 del/+ mice (Fig. 7E). Similar results were obtained for primary adipocyte cell cultures (Fig. S3E). High fat diet led to a drastic reduction of gene expression in de novo lipogenesis like SREBP1 and FAS in WAT obtained from EHD2 del/del mice, suggesting that downregulation of lipogenesis is an active mechanism that partially compensates for the enhanced lipid uptake (Fig. 7F). Remarkably, EHD2 expression was essentially absent in WAT obtained from EHD2 del/+ mice following a 4 months high fat diet (Fig. 7G). This may explain the similar phenotypes of EHD2 del/+ and EHD2 del/del mice following a long-term high fat diet (Fig. 7B, Fig. S5).
Based on these observations, EHD2 expression was investigated in two obesity-related mouse models, ob/ob and NZO (Kleinert et al., 2018). Indeed, WAT obtained from ob/ob and NZO mice showed reduced EHD2 expression compared to C57BL6/N mice fed by standard diet (Fig. 7H). When investigating adipocytes from ob/ob mice, a higher proportion of detached caveolae were found in the obesity mouse model (ratio detached/membrane bound caveolae = 1.4 vs. 0.35 in C57BL6/N mice fed with standard diet, Fig. 7I-J). Taken together, these data indicate that EHD2 expression is highly regulated by lipid uptake and load and suggest that EHD2-mediated caveolar dynamics is altered in obesity.
Discussion
Here, we identify EHD2 as a negative regulator of caveolae-dependent lipid uptake. In caveolae containing cells, like adipocytes, muscle cells or fibroblasts, loss of EHD2 resulted in increased lipid accumulation, which was observed in the whole organism as well as in cell culture-based experiments. Loss of EHD2 was associated with the detachment of caveolae from the plasma membrane, higher caveolar mobility and increased uptake of lipids and other caveolar substrates, such as CTxB. We demonstrate that the fatty acid translocase CD36 participates in this EHD2-dependent lipid uptake pathway. Furthermore, obese mouse models and mice exposed to a long-term high fat diet exhibit decreased EHD2 expression in WAT. Thus, our study reveals a cell-autonomous lipid uptake route that involves CD36 and caveolae, is controlled by EHD2 and modified by metabolic conditions.
For some time, caveolae have been implicated in lipid uptake. Thus, mice lacking caveolae showed reduced fat mass and did not develop any form of obesity. In addition, Pohl et al. (2005) observed decreased oleate uptake after expression of a dominant-negative Cav1 mutant. The EHD2 KO mouse model, described here, revealed the opposite phenotype, e.g. a caveolae gain-of-function in vivo model. In EHD2 KO mice, caveolae were more often detached from the plasma membrane and showed a higher mobility and faster lipid uptake, resulting in enlarged LDs. Unlike in Cav1 over-expressing mice (Briand et al., 2014), which also show increased fatty acid uptake, the number of caveolae remained unchanged in EHD2 KO mice. This supports a model in which not only caveolae numbers, but also caveolar dynamics play a crucial role in this process (see model in Fig. 7K). Furthermore, such idea is in line with our structural findings that EHD2 can form ring-like oligomers that may stabilize the neck of caveolae (Daumke et al, 2007; Shah et al., 2014; Melo et al., 2017; Hoernke et al., 2017), thereby restricting caveolar mobility (Morén et al., 2012; Stoeber et al., 2012). Based on studies in EHD2 KO NIH 3T3 cell line, Yeow et al. (2017) suggested that EHD1 and/or EHD4 could rescue loss of EHD2 during its role in membrane protection. However, we did not find rescue of caveolae detachment and lipid uptake in EHD2 KO cells by other EHD family members.
We show that CD36 partially co-localizes with caveolae and is involved in EHD2-mediated lipid uptake. Previous Cav1 KO studies already showed mis-localization of CD36 and impaired fatty acid uptake in MEFs lacking caveolae (Ring et al., 2006). CD36 belongs to a superfamily of integral membrane protein, the CD36 scavenger receptors, which also include the lysosomal integral membrane protein II (LIMP 2). The structure of the latter revealed a large hydrophobic tunnel in the conserved globular domain which was suggested to deliver lipids in the outer membrane (Hsieh et al., 2016). The specific lipid environment of caveolae, including a high proportion of cholesterol, may support CD36-mediated lipid uptake in caveolae. Our data support the idea that caveolae shuttling between the plasma membrane and intracellular compartments is involved in lipid uptake (as illustrated in Fig. 7K). Conventional caveolae internalization follows the endosomal pathway from early to late endosomes and finally to lysosomes (Pelkmans et al., 2004; Hayer et al., 2010). However, initial cellular fatty acid accumulation within LDs can be much faster (minutes) (Kuerschner, Moessinger and Thiele, 2008) compared to the caveolar turnover in lysosomes (one hour), suggesting an involvement of alternative pathways. Notably, LDs form at the membrane of the endoplasmic reticulum (ER) (Pol, Gross and Parton, 2014; Wilfling et al., 2014; Barneda and Christian, 2017), and it was proposed before that caveolae could translocate to the ER and form contact sites (Le et al., 2002; Le, 2003). Furthermore, a role of Cav1 in LD formation has been suggested (Ostermeyer et al., 2001; Schlegel, Arvan and Lisanti, 2001; Robenek et al., 2004). With the EHD2 KO mice, we have developed a suitable model to explore the molecular components of the caveolae-dependent lipid uptake pathway.
The loss of EHD2 on the cellular level led to increased fat deposits on the organismic level, which was particularly evident in older animals. The observed phenotype based on the global loss of EHD2 could be influenced by organ-organ interactions (Stern, Rutkowski and Scherer, 2016). However, we did not find any evidence for differences in adipocyte derived secretory factors, such as adiponectin (Fig. S6). Furthermore, increased lipid uptake was dependent on caveolae, as shown by Cav1 knockdown experiments, and lipid droplet growth could specifically be induced by viral transfection of Cre recombinase in EHD2 cKO flox/flox, but not in flox/wt adipocytes. Thus, increased lipid uptake is caused by a cell-autonomous, caveolae-dependent mechanism. As the WAT distribution and lipid accumulation is known to differ in male and female mice, further studies are required to analyze potential sex-specific differences in EHD2-dependent lipid uptake.
Despite the observed LD accumulation in mice lacking EHD2 (under standard and high fat diet), the body weight and overall fat mass of EHD2 del/del and EHD2 del/+ mice were not altered, suggesting metabolic compensation. In line with this idea, EHD2 del/del WAT and cultivated EHD2 del/del adipocytes showed a significant reduction in expression levels of genes involved in de novo lipogenesis like SREBP1 or FAS indicating a strong downregulation of glucose-dependent fatty acid production in fat cells. Similar compensatory mechanisms were noted in patients suffering from obesity (Eissing et al., 2013; Guiu-Jurado et al., 2015; Solinas, Borén and Dulloo, 2015). Even with elevated fat content in the adipose tissues, liver and skeletal muscle EHD2 del/del mice did not develop an insulin resistance as indicated by the normal glucose tolerance.
Remarkably, the expression levels of EHD2 in WAT of two obese mouse models (ob/ob and NZO mice) and of EHD2 del/+ mice treated with a long-term high fat diet were significantly lower than in C57BL6/N or EHD2 del/+ mice under standard diet, resulting in detachment of caveolae. Thus, expression of EHD2 appears to negatively correlate with adipocyte size, therefore reflecting the situation in the EHD2 KO mouse (see also (Sonne et al., 2017)). Consistent with this observation, it was previously reported that increased Cav1 expression and caveolae number were detected in patients suffering from obesity or T2D, and also in obesity rat models (Catalán et al., 2008; Grayson et al., 2013). We speculate that an imbalance in number, life-time and mobility of caveolae appears to accompany and maybe actively contribute to the development and progression of obesity. Accordingly, pharmacological approaches to enhance EHD2 expression or its stabilization at the plasma membrane could reduce lipid uptake and consequently help to treat obesity in patients.
In conclusion, our study reveals a conserved cellular lipid uptake pathway that involves caveolae and CD36 and is controlled by EHD2.
Author Contributions
C.M. planned, performed and analyzed all experiments if not otherwise indicated. C.M. and O.D. wrote the manuscript, with input from all authors. S.K. performed and analyzed all EM imaging, C.M. analyzed EM images, S.K. and C.M. performed and analyzed ET. I.L. generated the EHD2 KO mouse model and performed in situ hybridization. W.J. analyzed blood plasma markers and EHD2 expression in obesity mouse models. M.L. helped during TIRF imaging and discussed experiments, A.M. isolated primary MEF and performed the EHD2 Western Blot. E.L. performed lipid droplet staining experiments after Cav1 knockdown. A.S., V.H., R.L., C.B. and D.N.M. discussed potential experiments and the manuscript. O.D. wrote the mouse animal application with help of D.N.M. and C.M.
Declaration of Interests
The authors declare no competing interests.
Material and Methods
EHD2 delta E3 mouse strain generation
The EHD2 targeting construct was generated by insertion of two lox P sequences flanking exon 3 of EHD2 genomic DNA by homologous recombination in E.coli as previously described (Liu et al., 2003). A pGK Neomycin and a diphtheria toxin A (DTA) cassette was included to enrich for correctly targeted ES cells. Electroporation of the linearized targeting vector in R1 ES cells was performed. For southern blot analysis, genomic DNA from G418-resistant ES clones was digested with BamHI and EcoRV and probed with PCR fragments to confirm correct integration (BamHI-Probe: Primer-FWD: 5-CACGCGGTCCAGCTGGCTTCA-3’, Primer-REV: 5’-GTG GCT GAA GAG TCT ATG CAC TTC GAG-3’; EcoRV-Probe: Primer-FWD: 5’-CAG GCC CCA CGC TTC AGG ATT TTA ACT G-3’, Primer-REV: 5’-GCC TTG TTG AGT ACC ACG CGG ATC-3’). Correctly targeted ES clones were injected into C57Bl6 blastocyst. The offspring was genotyped by PCR. Mice carrying a loxP-flanked Exon 3 of EHD2 gene were mated to Cre deleter mice to generate EHD2 mutant (del/del) mice. After backcrossing the EHD2 del/del mice with C57BL6/N (Charles River, between 20-30 weeks, male) for 6 generations only male EHD2 del/del or EHD2 del/+ (as control) mice were used and littermates were randomly assigned to experimental groups. All animals were handled accordingly to governmental animal welfare guidelines and were housed under standard conditions. If not otherwise indicated mice were sacrificed at an age of 20-30 weeks (for cell culture preparation) or 40-50 weeks (organ dissection).
Obesity Mouse Models
Male NZO/HIBomDife (German Institute of Human Nutrition, Nuthetal, Germany), C57BL/6J (Charles River Laboratories, Sulzfeld, Germany) and B6.V-Lepob/ob/JBomTac (B6-ob/ob) mice (Charles River Laboratories, Calco, Italy) were housed under standard conditions (conventional germ status, 22 °C with 12 hour /dark cycling). NZO and C57BL/6J mice were fed were fed standard chow diet (Ssniff, Soest). Starting at 5 weeks of age B6-ob/ob received carbohydrate free diet (Kluth et al., 2015). Mice were sacrificed at an age of 20-22 weeks.
High Fat Diet
To investigate in vivo fat uptake the EHD2 delta E3 mice were fed with a high fat diet (OpenSource Diets, D12492, 60% kcal) according to our animal application. In total, 16 EHD2 del/+ and 16 EHD2 del/del mice were investigated whereby only male, backcrossed animals were used (>F5 generation, backcrossing with C57BL6/N). The high fat diet was immediately applied after weaning for maximal 16 weeks. The body weight was monitored every 5 days. 7 mice/genotype were fed for 10 days with high fat diet and afterwards the body composition (BRUKER MiniSpec LF90II) was measured.
Mouse embryonic fibroblast isolation and immortalization
All animals were handled accordingly to governmental animal welfare guidelines. MEFs were obtained from E14.5 EHD2 +/+ or del/del embryos. Therefore female, pregnant EHD2 del/+ were sacrificed by cervical dislocation, the embryos were dissected and removed from the yolk sac in sterile, cold PBS. For genotyping, a small piece of each mouse embryo tail was harvested followed by complete dissection of the whole embryo. Afterwards, the embryo pieces were treated with 0.25% trypsin/EDTA (Sigma) over night at 4 °C. After aspiration of the trypsin solution, 10 ml culture medium (DMEM/10%FBS/5% penicillin/streptomycin) was added and tissue pieces were break up by pipetting. The cell suspension was transferred in 75 cm2 culture flask for cultivation at 37 °C and 5% CO2. Immortalization of isolated primary MEFs was assured by frequently splitting. From passage 15 an increased growth rate was observed suggesting immortalized MEFs. For all experiments MEFs between passage 12 and 32 was used. For LD growth, MEFs were either treated with 10 µg/ml insulin, 2.5 mM dexamethasone, 50 mM IBMX and 25 mM rosiglitazone diluted in culture medium (differentiation medium) or 0.016 M oleic acid and 10 µg/ml insulin diluted in DMEM.
Primary adipocyte cell culture
Male EHD2 del/+ and EHD2 del/del mice or EHD2 cKO flox/wt or flox/flox were sacrificed by cervical dislocation and gonadal WAT was removed. Adipocytes and stromal vascular fraction (SVF) were isolated after washing the tissue in sterile PBS and digestion by collagenase type II (Sigma C6885). Mature adipocytes floating in the upper phase were transferred in a new flask and diluted with culture medium (DMEM/10%FBS/5% penicillin/streptomycin), SVF was obtained after 5 min centrifugation at 1,000 rpm. After complete tissue break up the adipocyte cell suspension was passed through a 270 µm cell strainer and the cells were plated in 75 cm2 culture flask at 37 °C and 5% CO2 whereby pre-adipocytes adhere to the flask and mature adipocytes float in the medium. SVF suspension was cleaned by passing through 70 µm cell strainer. The following day the culture medium was exchanged to remove dead or non-adherent cells. After 5 days, both pre-adipocytes and SVF were split by 0.25% trypsin/EDTA solution and merged for further cultivation. Differentiation to mature adipocytes was induced by 10 µg/ml insulin, 2.5 mM dexamethasone, 50 mM IBMX and 25 mM rosiglitazone diluted in culture medium. If not otherwise mentioned the primary pre-adipocytes were incubated for 5 days with differentiation medium and medium was changed after 2 days. Delipidation of FBS was carried out as described by (Cham and Knowles, 1976). EHD2 cKO adipocytes were transfected with Cre recombinase-EGFP by using adeno-associated virus particles 8 (AAV8) produced from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (addgene, #105545). The adipocyte cell culture was transfected and differentiated for 5 days.
Oil Red O staining
LDs in tissue sections or cultivated adipocytes and MEFs were stained with Oil Red O as published by (Mehlem et al., 2013). Briefly, freshly dissected liver of muscle pieces were frozen in liquid nitrogen, embedded in TissueTek and 10 µm cryostat sections (Leica) were prepared. After fixation with 4% para-formaldehyde (PFA, Merck) freshly prepared Oil Red O staining solution was applied for 10 min.
The sections were washed with PBS and embedded in ImmoMount (Invitrogen). Cultivated cells were fixed, treated with 60% isopropanol (Merck) for 2 min and then incubated with Oil Red O staining solution for 5 min. After washing with water until complete removal of Oil Red O the stained cells or sections were analyzed by Zeiss Axiovert microscope (20x Zeiss objective). Staining intensity was measured with ImageJ.
Histology
EHD2 del/+ and EHD2 del/del mice were anesthetized with 2% ketamine/10%rompun, perfused first by 30 ml PBS and next by 50 ml 4% PFA and tissues were dissected. After 24 h of fixation in 4% PFA, tissues were dehydrated in 3 steps (each 24h) from 70-100% EtOH and afterwards incubated in xylol (Merck) for 48 h. Next, the tissues were embedding in liquid paraffin at ca. 65°C and cooled down on ice. 4 µm paraffin sections were obtained, de-paraffinized and hydrated and Masson Trichrome staining (Kit, Sigma) was applied. Briefly, sections were stained with Bouin solution for 15 min at 60°C, followed by Haematoxylin Gill No. 2 staining for 5 min and incubation in Biebrich-Scarlet-Acid Fuchsin for 5 min. Next, the tissue sections were treated with Phosphotungstic/Phosphomolybdic Acid Solution and Aniline Blue solution both for 5 min, and acetic acid treatment (1%) for 2 min. After extensive washing the sections were dehydrated, incubated in xylol and embedded with Roti Histo Kit (Carl Roth). Images were obtained at Zeiss Axiovert100 microscope.
Immunohistostaining of cryostat sections
Perfused and fixated EHD2 del/+ and EHD2 del/del mice (as described before) were dissected and the investigated tissue pieces were further fixed for 1-4 h in 4% PFA, transferred to 15% sucrose (in PBS, Merck) for 4 h and finally incubated overnight in 30% sucrose. After embedding in TissueTek, the tissue is frozen at −80 °C. 5-15 µm sections were obtained in a cryostat at - 20 - −30 °C and stored at −20 °C. For immunostainings, the cryostat sections were incubated with blocking buffer (1% donkey serum/1% TritonX100/PBS) for 1 h at room temperature, and treated overnight at 4°C with the first antibody diluted in blocking buffer. After washing with PBS/1%Tween, the secondary antibody was applied for 2 h at room temperature. After completion of the staining, the sections were washed carefully and embedded in ImmoMount. The stained sections were analyzed with Zeiss LSM700 microscope provided with Zeiss objectives 5, 10, 20, 40 and 63x. The obtained images were further investigated by ZEN software and ImageJ/Fij.
Immunocytostaining and LD staining of cultivated cells
Adipocytes or MEFs were seeded on fibronectin (Sigma) coated glass dishes (12 mm diameter, Thermo Fisher) in cell concentration ranging from 20.000-40.000 cells/well depending on treatment and experiment. Before the staining, cells were washed with PBS, treated with 4% PFA for 10 min and blocking buffer (1%donkey serum/1% TritonX100/PBS) was applied for 20 min. The first antibody was diluted in blocking buffer and the cells were incubated with 200 µl antibody solution for 1 h. After washing with PBS the secondary antibody and DAPI (1:1000, Sigma) was applied for 1 h. For LD staining, BODIPY (Invitrogen) or Nile Red (Sigma) was diluted to 1:500 in cold PBS and after washing and fixation of the cells, the BODIPY or Nile Red staining solution and DAPI (1:1000) was applied for 30 min. The stained cells were washed and the glass dishes were placed on conventional microscope slides and embedded in ImmoMount. The antibody staining was investigated by Zeiss LSM700 or Zeiss LSM880 microscope and images were analyzed in detail with ImageJ/Fij.
Transfection and siRNA knockdown
Cultivated MEFs were transfected with the following plasmids pEHD2-EGFP, pCav1-EGFP or pEGFP by lipofectamine 3000 accordingly to the manufacture’s protocol. Transfected cells were incubated for 48 h and afterwards the treated cells were analyzed by confocal microscopy or TIRF. siRNA knockdown of CD36 or Cav1 was performed in freshly split MEFs by electroporation with the GenePulser XCell (Biorad). Briefly, MEFs were split as described before and the obtained cell pellet was resuspended in OptiMEM (Gibco). After cell counting, the MEF cell suspension was diluted to 1.5×106 cells/ml and 300 µl were transferred into electroporation cuvettes (2 mm, Biorad). CD36 or Cav1 stealth siRNA and siRNA negative control (medium GC content) was added to a final concentration of 200 nM. After carful mixing, the cuvettes were placed into the electroporation device and the pulse (160 µOHM, 500 µF, ? resistance) was applied. The electroporated cells were cultivated in DMEMaxi%FBS for 48 h before the experiments were started. Successful siRNA knockdown was monitored by CD36 antibody staining.
Cholera toxin subunit B uptake assay
MEFs were plated on fibronectin coated glass dishes and cultivated for 48 h. The cholera toxin uptake assay was performed as described by (Sotgia et al., 2002). Briefly, after washing twice with cold PBS cholera toxin subunit B labelled with Alexa594 was applied to the cells. The treated MEFs were incubated for 30 min in the dark on ice. Afterwards the cells were washed twice with PBS and incubated for 30 min with cultivation medium at 37 °C. After fixation with 4% PFA, DAPI staining solution was added for 10 min. Before embedding in ImmoMount, the cells were washed PBS. Cholera toxin uptake was analyzed with a Zeiss LSM700 microscope with a 63x Zeiss objective. The Alexa594 staining intensity was measured by ImageJ. For each experiment 10 different cells were examined.
TIRF live imaging of caveolae movement
MEFs transfected with pCav1-EGFP were incubated for 48 h on fibronectin coated cover slips (25 mm diameter). Samples were mounted in Attofluor Cell Chamber (Thermo) in a physiological buffer (130 mM NaCl, 4 mM KCl, 1.25 mM NaH2PO4-H2O, 25 mM NaHCO3, 10 mM glucose, 2 mM CaCl2, 1 mM MgCl2, pH 7.3, 305-315 mOsm/kg).
TIRF imaging was performed on an inverted Microscope (Nikon Eclipse Ti) equipped with a 488 laser (Toptica), an dicroic mirror (AHF, zt405/488/561/640 rpc), a 60x TIRF objective (Nikon, Apo TIRF NA 1.49), an appropriate emission filter (AHF, 400-410/488/561/631-640) and a sCMOS camera (mNeo, Andor). All components were operated by open-source ImageJ-based micromanager software. All experiments were performed at 37 °C. To investigate the movement of single caveolae transfected cells were selected in which regions of individual Cav1 spots were observed (ROIs illustrated in Fig. 4J, enhanced images). Recordings were obtained with the following imaging settings: image size 1776×1760 pixel, 1×1 binning, 500 frames, 200 ms exposure time/frame. For data analysis only the first 150 frames were investigated. After cropping to the specific ROI, kymograph analysis of several positions within the ROIs were carried out using the Reslice function of ImageJ/Fij. Carefully investigation of the kymographs revealed a single, straight line for fixed, not moving caveolae and sparks or short lines for fast moving caveolae.
Transmission Electron microscopy (TEM)
Mice were fixed by perfusion with 4% (w/v) formaldehyde in 0.1 M phosphate buffer and tissues were dissected to 1-2 mm3 cubes. For morphological analysis, tissue blocs were postfixed in phosphate buffered 2.5% (v/v) glutaraldehyde. Samples were treated with 1% (v/v) osmium tetroxide, dehydrated in a graded series of ethanol and embedded in the PolyBed® 812 resin (Polysciences Europe GmbH). Ultrathin sections (60-80 nm) were cut (Leica microsystems) and stained with uranyl acetate and lead citrate before image acquisition. For immuno-labeling, samples were fixed by perfusion as described above, but postfixed in phosphate buffered 4% (w/v) formaldehyde with 0.5% (v/v) glutaraldehyde for 1 hour. Samples were further processed as described in Slot and Geuze (Nature protocols, 2007). Briefly, samples were infiltrated with 2.3 M sucrose, frozen in liquid nitrogen and sectioned at cryo temperatures. Sections were blocked and washed in PBS supplemented with 1% BSA and 0.1% glycine. Labeling was performed with an anti-caveolin-1 antibody 1:500 (abcam #2910) and 12 nm colloidal gold (Dianova). Sections were contrasted with 3% tungstosilicic acid hydrate (w/v) in 2.8% polyvinyl alcohol (w/v) (Kärgel et al., 1996). Samples were examined at 80 kV with a Zeiss EM 910 electron microscope (Zeiss). Acquisition was done with a Quemesa CDD camera and the iTEM software (Emsis GmbH).
Electron tomography (ET)
To obtain electron tomograms 250 nm slices of EHD2 del/del BAT were prepared of samples embedded in resin and treated as described for TEM. The samples were tilted from 60 to −60° in 2° steps and examined at 120 kV with a FEI Talos electron microscope. FEI tomography software was used for acquisition of tomograms, detailed analysis and reconstruction was done with Inspect3D, Amira (both obtained from FEI) and IMOD (University of Colorado, USA).
In situ hybridization
Digoxigenin-labeled riboprobes were generated using a DIG-RNA labeling kit (Roche). In situ hybridizations were performed on 14 µm cryosections prepared from E18.5 wt embryos as previously described (Wilkinson, 1993). To generate an Ehd2 specific in situ probe, a 400 bp fragment was amplified from wildtype cDNA using PCR and primer listed below. The PCR product was cloned into pGEM-Teasy (Promega). T7 and sp6 polymerases were used to generate Ehd2-sense and antisense probes, respectively.
EDH2_ISH_FWD: 5’-CAGGTCCTGGAGAGCATCAGC-3’
EDH2_ISH_REV: 5’- GAGGTCCTGTTCCTCCAGCTCG-3’
Western Blot
EHD2 protein level in different tissues was examined by Western Blot. Therefore EHD2 +/+, EHD2 del/+ and EHD2 del/del mice were sacrificed by cervical dislocation and organs were dissected and snap frozen in liquid nitrogen. After homogenization of the tissue in 1x RIPA buffer (Abcam) with a glass homogenizer, the tissue lysate was incubated for 1 h on ice followed by 15 min centrifugation at 15,000 rpm. Supernatant was transferred in a fresh tube and protein concentration was measured by NanoDrop. At least 10 µg protein/lane was applied to 4-12% SDS-PAGE NuPage (Invitrogen) and SDS-PAGE was performed accordingly to the manufacture’s protocol. Afterwards, proteins were blotted on nitrocellulose membrane (Amersham) at 80 V for 1 h, followed by blocking of the membranes with 5% milk powder (in TBST, 150 mM NaCl, 20 mM Tris-HCl, pH 7.5, 0.1% Tween20) for 2 h at room temperature. To detect EHD2 protein level rabbit-anti-EHD2 (1:2,000) was applied over night at 4 °C. After washing with TBST the secondary antibody goat-anti-rabbit-HRP was added to the membrane for 2 h at room temperature. Detection of EHD2 bands results from ECL detection solution and intensities were obtained by ChemiDoc XRS (Biorad). Please see key resources table for all antibodies used in this study.
Blood plasma analysis
To measure distinct blood plasma parameter related to metabolic changes like adiponectin, insulin or free fatty acids blood was taken from EHD2 del/+ and EHD2 del/del mice immediately after cervical dislocation. All blood samples were taken at 10.00 am. Briefly, mice were opened and the thorax was partly removed to get access to the left heart ventricle, a cannula was inserted and blood samples were taken. After short centrifugation at high speed, the plasma fraction was transferred to a fresh tube and snap frozen in liquid nitrogen. The following assays were used to measure the described blood plasma markers: Plasma insulin levels were measured by Mouse Ultrasensitive Insulin ELISA (80-INSMSU-E10, Alpco). Plasma adiponectin and leptin levels were measured by Mouse Adiponectin/Acrp30 (DY1119) and Mouse/Rat Leptin (MOB00) ELISA kits (R&D Systems). Plasma lipids were quantified with commercially available kits: cholesterol (Cholesterol liquicolour colorimetric assay, Human, Wiesbaden, Germany), triglycerides/glycerol (Triglyceride/Glycerol Calorimetric Assay, Sigma) and non-esterified fatty acids (Wako Chemicals). All measurements were done according to manufacturers’ recommendations.
Fatty acid uptake assay
EHD2 del/+ and EHD2 del/del pre-adipocytes were seeded in 6-well plates (100.000 cells/well) and differentiated in mature adipocytes as described above. The fatty acid uptake assay was performed as described elsewhere (Dubikovskaya et al., 2014). Briefly, after 5 days of differentiation, adipocytes were starved for 1 h with serum-free DMEM. Next, 2 µM dodecanoic acid (FA12) labelled with BODIPY (Molecular probes #D3822) diluted in serum-free DMEM + 10 µg/ml insulin was added to the adipocytes and incubated for 5, 10, 20, 30 and 60 min at 37 °C. After washing twice with ice-cold PBS, 150 µl 0.25% trypsin/EDTA/PBS was applied to detach the cells. The adipocytes were treated with 500 µl ice-cold FACS buffer (HBSS/10%FBS/10 mM EDTA) and the cell solution was transferred to FACS tubes. Shortly before measurement, 1 µl/ml propidium iodide was added. FACS experiments were performed at LSR Fortessa 5Laser with the following parameters: FSH: A, H, W, Voltage 255; SSC: A, H, W, Voltage 203; A488: A, Voltage 198; PE: A, Voltage 341. For each FACS sample 30.000 cells were investigated. As negative control unstained EHD2 del/+ and EHD2 del/del adipocytes were examined at first and the obtained BODIPY intensity values were used as a reference for unstained cells. To exclude adipocytes which did not show any positive fatty acid uptake, all unstained cells were removed resulting in an only positive stained population (R1, illustrated in red in Fig. 3G and H). Within this R1 population adipocytes with strongly increased BODIPY intensity values were gated to population R2 (blue, Fig. 3G, H). Detailed analysis/gating and statistics was done by using FlyingSoftware2.5.1 (Perttu Terho, Cell Imaging Core, Turku Center for Biotechnology). For each experiment 15.000 cells were analyzed and gated to the unstained, R1 or R2 population. Next, the percentage of the cells gated to the populations were calculated for every time point and illustrated in the bar graph (Fig. 3I). R2 population was investigated in more detail by normalization to the R2 cell number of EHD2 del/+ adipocytes (Fig. 3J).
Glucose uptake assay
Glucose uptake of EHD2 del/+ and EHD2 del/del adipocytes was measured as described by BioVison (2-NBDG Glucose uptake assay). Briefly, adipocytes were treated as described for fatty acid uptake assay. However, after starvation 200 µM 2-NBDG (2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl) amino]-D-glucose, molecular probes #N13195) diluted in serum-free DMEM + 10 µg/ml insulin was applied to the cells followed by incubation times from 5-60 min. Staining analysis was done as mentioned for fatty acid uptake with the same FACS parameters and gating procedure whereby only one positive stained cell population was examined (R1, illustrated in Fig. S3A).
Gene expression analysis
EHD2 del/+ and EHD2 del/del adipocytes were differentiated for 5 days, washed twice with ice-cold PBS and RNA was isolated accordingly to the Qiagen protocol (RNeasy Mini Kit, Qiagen). SuperscriptIII First Strand Synthesis Kit (Invitrogen #18080051) was used to obtain corresponding cDNA, which then was used for real-time PCR. Gene expression levels were analyzed by GoTaq q-PCR (Promega, #A6001) Master Mix in Fast real time PCR cycler (Applied Biosystems) accordingly to instructor’s protocol. To measure the relative fold change of genes in EHD2 del/del adipocytes compared to EHD2 del/+, the comparative real-time PCR method was applied whereby actin was used as reference gene. Please see key resource table for detailed primer description.
Total mRNA from murine gonadal adipose tissue (gWAT) was extracted with RNeasy Mini Kit (QIAGEN GmbH, Hilden) according to manufacturer’s instructions. RNA was transcribed using the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT, Promega) according to manufacturer’s recommendations. Expression of mRNA was determined by quantitative real-time PCR on LightCycler 480 II/384 (Roche, Rotkreuz, Switzerland) using GoTaq Probe qPCR Master Mix (Promega, Madison, USA) applying TaqMan Gene Expression Assays. Target gene expression of was normalized to the mean expression of Eef2, Ppia and Actb in murine samples.
Actb
Left primer: TACGACCAGAGGCATACAG
Right primer: GCCAACCGTGAAAAGATGAC
Probe: TTGAGACCTTCAACACCCCAGCCA
Eef2 (Integrated DNA Technologies)
Left primer: CACAATCAAATCCACCGCCA
Right primer: TGAGGTTGATGAGGAAGCCC
Probe: TAAGCAGAGCAAGGATGGCT
Ehd2 (UPL, Roche)
Left primer: CAGCTGGAGCACCACATCT
Right primer: TCATGTGCCATCAACAGCTC
UPL probe: #80
Lipid composition
The measurement of lipid amount and its composition in tissue samples or cells were performed by Lipotype GmbH (Dresden, Germany). For this, tissue samples were homogenized accordingly to the supplied Lipotype protocol and diluted samples (1 mg/ml) were frozen and analyzed by Lipotype. MEF were split and the cell pellet was diluted in cold PBS to a final cell number of 30,000 cells/ml.
Type 2 Diabetes Knowledge Portal – Ehd2 gene info
Ehd2 mutations in patients suffering from T2D were investigated via the T2D knowledge portal: Type 2 Diabetes Knowledge Portal. EHD2. type2diabetesgenetics.org (NIH Accelerating Medicines Partnership, 2014). 2018 May 16, http://www.type2diabetesgenetics.org/gene/geneInfo/EHD2, http://exac.broadinstitute.org/gene/ENSG00000024422
Statistical analysis
At first, a normality distribution test (Kolmogorov-Smirnov test) was carried out for all experimental values. If the data was normally distributed, Student t-Test (two-tailed P-value) was applied, otherwise Mann-Withney-Rank-Sum (two-tailed P-value) test was used to calculate the significant difference between two groups. Cav1 and CD36 staining intensities were correlated for EHD2 wt and KO MEFs (Fig. 6D) by using Pearson correlation. The correlation and the 95% confidence interval was calculated by Prism (GraphPad software). Two-way-Anova tests were used to investigate LD size after CD36 siRNA knockdown, whereby for EHD2 wt and KO MEFs each CD36 siRNA#1-3 treated cells were compared to nonsense siRNA (negative control, Fig. 6F). Box plots, if not otherwise indicated in the figure legends, always represents median with whiskers from minimum to maximum, column bar graphs and line graphs represent mean with mean standard error of the mean (SE). Statistical calculations were carried out by using Prism (GraphPad software). Distribution of LD sizes represented in histograms were also obtained by using Prism. For all experiments including the examination of mice or mouse tissue, n represents the number of mice which were used (Fig. 1, 2, 4, 7, S6, S7) and all analyzed cryo/paraffin sections or caveolae are also indicated (e.g.: n = 80 caveolae/3 mice). In cell culture experiments (Fig. 3, 5, 6, S3, S4, S5), n represents the number of observed events (e.g.: lipid droplet area, staining intensity) and the number of independently performed experiments (e.g.: n = 80 lipid droplets/3 independent experiments). The following P-values were used to indicate significant difference between two groups: * P<0.05; ** P<0.001; *** P<0.0001.
Acknowledgments
We thank Petra Stallerow for taking care of the EHD2 delta E3 mouse strain, Karin Jacobi for advice with the animal application, Arnd Heuser and the pathophysiology facility for measuring the body composition, Vivian Schulz for helping with the genotyping of the mice, Claudio Shah for purifying the EHD2 antiserum, and the advanced light imaging facility at MDC for technical support. The authors acknowledge financial support from the Deutsche Forschungsgemeinschaft (DFG; SFB 958/A7 to V.H., A12 to O.D., A13 to A.S.) and support by The Initiative and Networking Fund of the Helmholtz Association.
