Abstract
The ESCRT-III membrane fission machinery1,2 restores nuclear envelope integrity during mitotic exit3,4 and interphase5,6. Whereas primary nuclei resealing takes minutes, micronuclear envelope ruptures appear irreversible and result in catastrophic collapse associated with chromosome fragmentation and rearrangements (chromothripsis), thought to be a major driving force in cancer development7-10. Despite its importance11-13, the mechanistic underpinnings of nuclear envelope sealing in primary nuclei and the defects observed in micronuclei remain largely unknown. Here we show that CHMP7, the nucleator of ESCRT-III filaments at the nuclear envelope3,14, and the inner nuclear membrane protein LEMD215 act as a compartmentalization sensor detecting the loss of nuclear integrity. In cells with intact nuclear envelope, CHMP7 is actively excluded from the nucleus to preclude its binding to LEMD2. Nuclear influx of CHMP7 results in stable association with LEMD2 at the inner nuclear membrane that licenses local polymerization of ESCRT-III. Tight control of nuclear CHMP7 levels is critical, as induction of nuclear CHMP7 mutants is sufficient to induce unrestrained growth of ESCRT-III foci at the nuclear envelope, causing dramatic membrane deformation, local DNA torsional stress, single-stranded DNA formation and fragmentation of the underlying chromosomes. At micronuclei, membrane rupture is not associated with repair despite timely recruitment of ESCRT-III. Instead, micronuclei inherently lack the capacity to restrict accumulation of CHMP7 and LEMD2. This drives unrestrained ESCRT-III recruitment, membrane deformation and DNA defects that strikingly resemble those at primary nuclei upon induction of nuclear CHMP7 mutants. Preventing ESCRT-III recruitment suppresses membrane deformation and DNA damage, without restoring nucleocytoplasmic compartmentalization. We propose that the ESCRT-III nuclear integrity surveillance machinery is a double-edged sword, as its exquisite sensitivity ensures rapid repair at primary nuclei while causing unrestrained polymerization at micronuclei, with catastrophic consequences for genome stability16-18.
The formation of dynamic endosomal sorting complex required for transport (ESCRT)-III filaments competent for membrane fission is exquisitely sensitive to balanced levels of the factors that control these filaments1,2,19. This is exemplified by depletion of the essential subunit CHMP2A that results in persistent accumulation of CHMP4B, the main component of ESCRT-III filaments, at the reforming nuclear envelope (NE) without successful sealing3. We found that these foci are similarly enriched for endogenous CHMP7 and LEMD2 (Fig. 1a, Extended Data Fig. 1a), consistent with the notion that these are key upstream regulators of the ESCRT-III machinery at the NE3,15. Considering the delicate balance of ESCRT-III polymerization19, we reasoned that overexpression of these targeting factors would phenocopy CHMP2A depletion. Surprisingly, whereas transient or inducible overexpression of CHMP7 rapidly induced CHMP4B foci, these were exclusively cytoplasmic in HeLa and RPE1 cell lines, consistent with reported localization for CHMP7 to the cytoplasm and endoplasmic reticulum (ER)14,20 (Fig. 1b top panel, Supplementary Video 1). This suggested that subcellular localization of CHMP7 could be a key determinant to position CHMP4B foci. The CHMP7 C-terminal motif previously annotated as a MIM1 motif2,21 closely resembles a type 1a high-affinity nuclear export signal (NES)22 (Fig. 1c), suggesting a mechanism to exclude this 45kDa protein from the nucleus23. Indeed, fusing this putative CHMP7 NES sequence, but not a mutated version (NES*), to REV-eGFP24 was sufficient to relocalize eGFP from nucleoli to the cytoplasm (Fig. 1d, Extended Data Fig. 1b). This was dependent on active export, as assayed by treatment with the Exportin 1 (XPO1) inhibitor leptomycin B (LMB) (Fig. 1d and Extended Data Fig. 1c), indicating that this sequence functions as a bona fide NES. Mutating the NES in CHMP7 (CHMP7NES*) was sufficient to drive formation of persistent CHMP4B foci associated with the NE as opposed to the ER (Fig. 1b, and Extended Data Fig. 1d-g). Similar results were observed when briefly inducing wild type CHMP7 in the presence of LMB (Fig. 1b) or upon fusion with 2 nuclear localization sequences (CHMP7NLS) (Fig. 1b lower panel), arguing against an effect due to functional perturbation of the putative MIM1.
In contrast, transient overexpression of LEMD2 did not induce CHMP4B foci, but rather resulted in the rapid degradation of nucleoplasmic CHMP4B (Fig. 1e; Extended Data Fig. 2a-c, Supplementary Video 2). This phenotype relied on the MAN1-Src1p C-terminal (MSC) domain of LEMD2 (Fig. 1e, Extended Data Fig.2d,e) that has been reported to mediate interaction with CHMP715. Strikingly, co-expression of LEMD2 with nuclear CHMP7 (CHMP7NES*) suppressed CHMP4B degradation and instead resulted in the formation of stable NE foci highly enriched for CHMP4B, CHMP7NES*, and LEMD2 (Fig. 1e, and Extended Data Fig. 2f). This phenotype was partially recapitulated in stable LEMD2-SNAPtag25, CHMP4B-eGFP cells where CHMP4B reversibly colocalized with LEMD2 enrichments upon nuclear retention of CHMP7 by LMB treatment (Fig. 1f and Extended Data Fig. 2g-j, Supplementary Video 3). These data show that XPO1-mediated export prevents untimely nuclear localization of CHMP7 and argue that nuclear influx of CHMP7 critically controls the formation of stable LEMD2-CHMP7 complexes that license polymerization of the CHMP4B filaments needed for repair3-6.
We exploited the subcellular mislocalization of CHMP7NES* to monitor effects of excessive nuclear CHMP7 and found that the CHMP4B foci corresponded to areas where the NE underwent architectural deformations, as indicated by enrichment of the ER marker KDEL (Fig. 2a upper panel), the inner nuclear membrane (INM) marker Lap2β, and Lamin A/C (Extended Data Fig. 3a upper and middle panel). The absence of the nucleoporin Nup58 (Fig. 2a lower panel) argued against these foci representing aggregates of aberrant nuclear pore complexes26,27. Correlative light and electron microscope (CLEM) analysis revealed these membrane distortions to be complex 3-dimensional networks with trabecular appearance (Fig. 2b). Whereas expression of CHMP7 resulted in remodelling of the ER without much effect on the NE (Fig.2b, left panel), CHMP7NLS selectively distorted the INM (Fig. 2b, right panel), with CHMP7NES* evolving a composite phenotype affecting both ER and INM (Fig. 2b, middle panel). Additionally, LMB treatment induced nuclear CHMP4B foci that transformed LEMD2-enriched parallel INM sheets into 3-dimensional membrane networks (Extended Data Fig. 3b). Considering the dramatic membrane deformation and the absence of Lamin B1 at these sites (Extended Data Fig. 3a lower panel)6,7,28, we assessed NE integrity upon expression of these CHMP7 alleles by monitoring nuclear exclusion of an mRuby3-NES compartmentalization marker. Whereas overexpression of LEMD2 or CHMP7 did not compromise nuclear integrity, CHMP7NLS expressing cells lost compartmentalization within a few hours (Fig. 2c). Cells expressing CHMP7NES* also decompartmentalized albeit slower than CHMP7NLS, in a fashion dependent on its membrane-binding VPS25-like domain14 (Fig. 2c and Extended Data Fig. 3 c, d). This was not due to defective mitotic NE reformation as it was readily observed in cells that did not traverse mitosis (Supplementary Video 1). Taken together, these data show that persistent ESCRT-III foci formed upon excessive nuclear influx of CHMP7 deform the NE to the point of irreversible rupture.
Whereas LEMD2 overexpression alone depleted all nuclear CHMP4B, CHMP4B associated with micronuclei (MN) was refractory to this phenomenon (Fig. 3a). Instead, these MN were highly enriched for endogenous CHMP7, suggestive of nuclear accumulation of CHMP7 (Fig. 3a). Similarly, a fraction (2.48% ± 0.36% SEM) of MN showed striking enrichment of CHMP4B-eGFP, endogenous LEMD2 and CHMP7 (Fig. 3b and Extended Data Fig. 4 a,b), as well as other ESCRT-III subunits (Extended Data Fig. 4c). Reasoning that these could represent MN with compromised MN envelope (MNE) integrity, we monitored CHMP4B dynamics at monopolar spindle 1 (MPS1)-inhibitor (AZ3146) induced MN as they underwent rupture. Following rupture, CHMP4B accumulated at the MNE within minutes, and this recruitment was reduced for a membrane-binding defective CHMP4B4DE mutant29 (Fig. 3c, Extended Data Fig. 4d-f, Supplementary Videos 4,5). Together with similar CHMP4B recruitment kinetics to primary nuclei (PN) and MN upon CHMP7NES* expression (Extended Data Fig. 4g), this argues that inherent defects in MN30 do not extend to ESCRT-III targeting. However, rather than the characteristic transient recruitment associated with successful repair3,5, CHMP4B progressively accumulated in multiple coalescing foci over hours, without any detectable MNE repair (Fig. 3c, Supplementary Video 4,5). This was associated with a dramatic increase of LEMD2 levels spreading from the site of rupture (Fig. 3d, Supplementary Video 6), a phenotype that depended on CHMP7 but less on CHMP4B (Fig. 3e, Supplementary Video 7). Subsequently, the MNE rapidly changed morphology from being smoothly round to becoming progressively more convoluted and condensed (Fig. 3f, Supplementary Video 7,8), most notably at sites of CHMP4B accumulation (Extended Data Fig. 4h). Depletion of CHMP4B or CHMP7 completely reverted this morphology in ruptured MN (Fig. 3f and Extended Data Fig. 4i). CLEM experiments consistently revealed ESCRT-III dependent complex trabecular membrane networks at sites of CHMP4B accumulations in ruptured MN (Fig. 3g, Extended Data Fig. 5, Supplementary Video 9). These complex 3-dimensional membrane networks showed striking architectural similarities to those observed at PN upon forced mislocalization of CHMP7 (Fig. 2b, Extended Data Fig. 6). This demonstrates a causal role for unrestrained ESCRT-III accumulation in driving MN catastrophe following MN rupture. As depletion experiments showed that ESCRT-III did not drive MN rupture (Extended Data Fig. 4j,k), it raises the interesting possibility that it generates secondary ruptures at sites of membrane distortion as the MN collapses (Fig. 2a-c and Extended Data Fig. 4h).
CHMP7-dependent spreading of LEMD2 accumulation across the MNE (Fig. 3e) suggested that MN lack the capacity to restrict CHMP7-LEMD2 complexes to the site of rupture, thus licensing unrestrained formation of ESCRT-III filaments at sites along the MNE. To test this hypothesis, we performed in silico experiments of NE rupture at PN and MN using INM concentrations of LEMD2-CHMP7 complexes as readout (Extended Data Fig. 7, materials and methods). Upon rupture, continuous influx of cytoplasmic CHMP7 rapidly overloaded the MN pool of LEMD2 along the entire MNE (Fig. 3h top panel), while at PN CHMP7-LEMD2 accumulation remained restricted to the site of rupture. Including influx of new LEMD2 molecules upon saturation (Extended Data Fig. 7a), the concentration of LEMD2-CHMP7 complexes at MN far exceeded that at PN over the course of 30 minutes, a time range reflecting physiological nuclear envelope repair (Fig. 3h). Similar differences between MN and PN were observed when assuming CHMP7 exclusively membrane-associated as opposed to cytoplasmic14,20 (Extended Data Fig. 7b,c). Considering the delicate balance governing ESCRT-III function19, these simulations suggest that MN inherently lack the capacity to restrict CHMP7-LEMD2 complexes to sites of rupture and to the physiological concentration required to drive membrane repair. Excessive CHMP7-LEMD2 complexes subsequently license unrestrained CHMP4B polymerization at numerous sites along the MNE, diverting ESCRT-III machinery activity from rapid membrane fission to persistent membrane distortion.
Considering the ESCRT-III induced morphological changes at PN and ruptured MN, we explored the relation between ESCRT-III accumulation and the stability of the underlying genome. We exploited ectopic nuclear localization of CHMP7NES* to PN as a tractable model. CHMP7NES*-induced nuclear ESCRT-III foci were associated with rosettes of γH2Ax (Extended Data Fig. 8a), and were enriched for the single-stranded DNA (ssDNA)-binding replication protein A2 (RPA2)31 (Fig. 4a). The facts that RPA2 enrichment was restricted to CHMP4B foci at the nuclear surface (Manders’ colocalization coefficient RPA/CHMP4B 0.79 ± 0.23 SD) and that RPA2 was apparent even in the absence of NE ruptures (Extended Data Fig. 8b,c) argued against influx of cytoplasmic stressors underlying these phenotypes. Because of the dramatic membrane distortions combined with accumulation of chromatin-associated proteins like LEMD232, we investigated whether RPA2 foci corresponded to areas subject to DNA torsional stress33. Strikingly, we found that Topoisomerase IIb (Top2B), the enzyme that relieves torsional stress in chromatin topological domains by transiently generating chromosome breaks34, was highly enriched at these foci (Fig. 4b and Extended Data Fig.8d). As Top2B has previously been linked to chromosome rearrangements34 we tested the consequences of this torsional stress on chromosome integrity by performing metaphase spreads following induction of CHMP7 alleles. Whereas overexpression of wild-type CHMP7 induced a low-level of DNA breaks, induction of CHMP7NES* dramatically increased the frequency of chromosome breaks and fragmentation (Fig. 4c,d).
Reasoning that this same phenomenon could drive chromosome fragmentation in ruptured MN, we monitored RPA2 accumulation at MN. Indeed, RPA2 colocalized with CHMP4B foci at MN (Manders’ colocalization coefficient RPA/CHMP4B 0.94 ± 0.05 SD). Live-cell imaging showed that upon MN rupture RPA2 accumulated rapidly at sites of CHMP4B enrichment along the MNE (Fig. 4e,f and Extended Data Fig. 8e, Supplementary Video 10). Micronuclear RPA2 accumulation required unrestrained ESCRT-III driven membrane distortion as depletion of CHMP4B or CHMP7 and LEMD2 suppressed RPA2 accumulation without restoring MN integrity (Fig. 4g, Supplementary Video 10). These data show that unrestrained accumulation of ESCRT-III at PN and MN has catastrophic effects on the underlying DNA, inducing torsional stress, the generation of ssDNA and chromosome fragmentation.
Taken together our data suggest a compartmentalization sensing mechanism for loss of NE integrity. Rupture of the NE permits local nuclear influx of CHMP7 and its association with LEMD2 to license ESCRT-III activation required for sealing (Extended Data Fig. 9). The inherent weakness of this system is highlighted at MN, which lack the capacity to restrict CHMP7-LEMD2 complexes to the site of rupture, and instead allow unrestrained activation of ESCRT-III along the surface of the INM (Extended Data Fig. 9). This phenomenon is associated with dramatic membrane distortion and consequent DNA torsional stress, formation of ssDNA, chromosome damage, as well as the recruitment of exonucleases such as TREX1 (Extended Data Fig. 8f-h) 35,36. This ultimately drives the fragmentation of chromosomes, possibly in combination with stress ensuing from defective DNA replication and premature chromosome condensation frequently associated with ruptured micronuclei7,9. In conclusion, our work highlights the ESCRT-III machinery as a double-edged sword, and suggests that it presents a conditional non-genetic driver of genome instability and the development of cancer.
Author contributions
M.V. and C.C. conceived and designed the study with important contributions from H.S. and S.W.S.. M.V. generated cell lines, performed light microscopy, analysed data, and prepared figures. S.W.S. performed and analysed EM experiments, and prepared figures. A.Be. generated cell lines, performed light microscopy, analysed data, and prepared figures. C.M.J. performed and analysed the simulation experiments, and prepared figures. C.R., E.S., E.K., R.T., and A.J. performed light microscopy and analysed data. C.R.J.P. performed metaphase spreads experiments. P.C. provided comments and infrastructure. R.L.K. provided comments and contributed to the simulation setup. S.N.G. and H.K. supervised the simulation experiments. A.Br. supervised and performed EM experiments and provided conceptual input. F.M. supervised and analysed the metaphase spreads experiments. H.S. provided infrastructure and co-supervised the study. C.C. supervised the study, generated constructs and cell lines, performed light microscopy, analysed data, and prepared figures. M.V. and C.C. wrote the paper with contributions from all authors.
Methods
Cell cultures
Cell lines were cultured as recommended by ATCC guidelines. For live-cell imaging, cells were seeded into glass bottom imaging dishes (Lab-Tek, Nunc; MatTek, MatTek Corporation). For immunofluorescence studies, cells were grown on high Precision cover glass (Marienfeld). For confocal microscopy, cells were fixed with 4% EM grade Formaldehyde (Polysciences) for 5 minutes at 37 °C. Cells were then permeabilized by treatment with 0.16% Triton X-100 for 2 minutes. Primary and secondary antibodies were diluted in PBS/0.05% Saponin and incubated for 1 to 2 hours. After antibody staining, samples were mounted on microscope slides (Menzel-Glaser) with Mowiol for standard confocal imaging or SlowFade Gold Antifade Reagent (Life Technologies) for Airyscan microscopy. RPE1 and HeLaK cell lines stably expressing inducible CHMP7 or LEMD2 alleles were treated with 500 ng/ml doxycycline (DOX, Sigma-Aldrich). XPO1 inhibition was carried on by incubating cells with 2.5 ng/ml Leptomycin B (LMB, InvivoGen) for up to 3 hours. Loss of XPO1 activity was monitored my nuclear localization of 2xmRuby3-NES. Micronucleation was induced by MPS1 inhibitor AZ3146 (Selleckcem) used at a concentration of 2 μM. RPE1 cell lines were depleted for p53 before AZ3146 treatment.
Stable cell lines
A stable HeLa “Kyoto” cell line expressing CHMP4B-eGFP was obtained from Anthony Hyman1. All other stable cell lines were lentivirus-generated pools. To achieve low expression levels, the weak PGK promoter was used for transgene expression. For higher expression levels CMV or EF1α promoters were used. Third generation Lentivirus was generated using procedures and plasmids as previously described2. Briefly, (eGFP/mNG/mCherry/SNAP/FLAG fusions of) transgenes were generated as Gateway ENTRY plasmids using standard molecular biology techniques, with all CHMP4B-fusions containing the LAPtag module1. From these vectors, Lentiviral transfer vectors were generated by recombination into lentiviral destination vectors (Addgene plasmids # 19067, 19068, 41393; and vectors derived from pCDH-EFlα-MCS-IRES-PURO (SystemBiosciences, inc.)) using Gateway LR reactions. VSV-G pseudotyped lentiviral particles were packaged using a third generation packaging system3 (Addgene plasmids # 12251, 12253, 12259). HeLaK or RPE1 cells were then transduced with low virus titers (MOI ≤1) and stable expressing populations were generated by antibiotic selection. Detailed cloning procedures are available on request. The stable cell lines used in this study are listed in Supplementary Data 1.
Transient plasmid transfections
For transient expression of CHMP7 and LEMD2 alleles, cells were grown on Precision cover glass in 24-well plates or into glass bottom imaging dishes and transfected with 0.5 μg DNA construct complexed with Fugene6 (Promega) following the manufacturer’s instruction. Cell were then fixed or imaged by live-cell imaging 12 to 24 hours after transfection. Non-targeting control Silencer Select siRNA (pre-designed, Cat. No. 4390844) was used as control. The plasmids used in this study are listed in Supplementary Data 1, and detailed cloning procedures are available on request.
siRNA transfections
All siRNAs were purchased from Ambion and contained the Silencer Select modification. Cells at 50% confluency were transfected with Lipofectamine RNAiMAX transfection reagent (Life Technologies) following the manufacturer’s instruction. Cells were transfected with 50 nM CHMP2A siRNA (AAGAUGAAGAGGAGAGUGAtt) or p53 (GUAAUCUACUGGGACGGAAtt) for 48 hours. CHMP4B (CAUCGAGUUCCAGCGGGAGtt), CHMP7 (AGGUCUCUCCAGUCAAUGAtt) and LEMD2 (AGCUGGUAAUUUUGAGUGUtt) were silenced by 2x serial transfections with 50 nM siRNA concentration for a total of 72 hours.
Antibodies
Rabbit anti-human CHMP4B antibody (WB 1:2000, IF 1:1000) and rabbit anti-CHMP3 (IF 1:1000) were produced as previously described4,5. Rabbit anti-CHMP2A (Proteintech #10477-1-AP; WB 1:500, IF 1:100), rabbit anti-CHMP7 (Proteintech #16424-1-AP; Sigma-Aldrich; WB 1:250), mouse anti-CHMP7 (Abnova #H00091782-B01; IF 1:100), rabbit anti-LEMD2 (Abnova #PAB20940; WB 1:500; IF 1:100), mouse anti-CHMP1A (Abcam, #ab104100; IF 1:150), rabbit anti-VPS4 (Sigma-Aldrich #SAB4200025; WB 1:500, IF 1:200), mouse anti-γH2Ax (Millipore 05-636; IF 1:100), mouse anti-Emerin (NeoMarkers MS-1751; IF 1:100), mouse anti-RPA2 (Abcam #ab2175; IF 1:100), rabbit anti-TREX1 (Abcam #ab185228; IF 1:200), mouse anti-TOP2B (scbt #sc-25330; IF 1:200), mouse anti-β-Actin (Sigma-Aldrich; WB 1:30000), mouse anti-GFP (Roche #1814460001; WB 1:1000; IF 1:200), rabbit anti-FLAG (Cell Signaling Technology 2368; WB 1:1000; IF 1:400), rabbit anti-Histone H3 (Abcam #ab1791; WB) and mouse anti-Lamin B1 (scbt #sc365962; WB 1:1000) were used as primary antibodies. DNA was labelled with Hoechst 33342 (2 μg/ml, Life Technologies. Secondary antibodies included anti-mouse-, anti-rabbit- and anti-goat-Alexa488 (Jackson), Alexa568 (molecular Probes) and Alexa647 (Jackson).
Confocal microscopy
Fixed samples were imaged with a Zeiss LSM 710 or 780 confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany) equipped with an Ar-Laser Multiline (458/488/514 nm), a DPSS-561 10 (561 nm), a Laser diode 405-30 CW (405 nm), and a HeNe-laser (633 nm). The objective used was a Zeiss Plan-Apochromat 63x/1.40 Oil DIC M27. Image processing was performed with basic software ZEN 2009 (Carl Zeiss MicroImaging GmbH, Jena, Germany) and ImageJ software6 (National Institutes of Health, Bethesda, MD, USA).
Confocal Airyscan microscopy
Fixed cells were imaged with a Zeiss LSM 880 Airyscan microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany), equipped with an Ar-Laser Multiline (458/488/514nm), a DPSS-561 10 (561nm), a Laser diode 405-30 CW (405 nm), and a HeNe-laser (633nm). The objective used was a Zeiss plan-Apochromat 63xNA/1.4 oil DICII. The images were acquired with the Airyscan detector with a voxel size of 0.035 × 0.035 × 0.144μm for high resolution imaging and super-resolution processing resulting in a final resolution of 120 × 120 × 350 nm. Image acquisition, processing and analysis were performed with the ZEN 2.3 SP1 basic software (Carl Zeiss), or with ZEN 2.3 Blue (Carl Zeiss). 3D visualization of z-stacks was done using Imaris 7.7.2 (Bitplane AG, Zürich, Switzerland). Manders’ and Pearson’s colocalization measurements were done in ZEN 2.3 Blue with a Costes automatic thresholding. Bitplane Imaris software was used to generate surface renderings of 3D-SIM images.
Live microscopy
Cells seeded into glass bottom imaging dishes were imaged on a DeltaVision microscope (Applied Precision) equipped with Elite TruLight Illumination System, a CoolSNAP HQ2 camera and a 40× or 60× Plan Apochromat (1.42 NA) lenses. For temperature control during live observation, the microscope stage was kept at 37 °C by a temperature-controlled incubation chamber. Time-lapse images deconvolved using the softWoRx software (Applied Precision, GE Healthcare) and processed with ImageJ for presentation and quantifications. Cells were imaged in DMEM gfp-2 anti-bleaching live-cell imaging medium (Evrogen) supplemented with 10% fetal bovine serum (FBS). Environmental control was provided by a heated stage and an objective heater (20-20 Technologies). SNAP-Cell® 647-SiR (SiR-SNAP 1:2000) (New England Biolabs) was used to detect SNAP-tagged alleles. SiR-DNA (1:2000) (SpiroChrome)7 was used to monitor nuclei and MN. Images were deconvolved using softWoRx software and processed in ImageJ/FIJI6 or Imaris. Nuclear ruptures are identified by compromised nucleocytoplasmic compartmentalization as visualized by the equalization of 2xmRuby3-NES intensity between the (micro-)nucleus and cytoplasm. For quantification of nucleo-cytoplasmic compartmentalization in living cells (Fig.2a, Extended Data Fig.3c, 8c), regions of interest (ROIs) were drawn in the nucleus and cytoplasm, followed by extraction of the mean fluorescence intensity, background fluorescence subtraction, and calculation of [N]/[C] ratios. For cells with intact nuclei [N]/[C] ratio approximates 0.5, while for cells with ruptured nuclei this ratio approximates 1.
High-content microscopy
For quantification of LEMD2-CHMP7-CHMP4B positive MN and TREX1 enrichment experiments Olympus ScanR system (illumination system with an UPLSAPO 40X objective) was used for imaging of a large number of cells in fixed samples and stained for the proteins of interest.
Correlative light and electron microscopy
Cells for CLEM experiments were grown on photo-etched coverslips (Electron Microscopy Sciences, Hatfield, USA). Fixation was done with 4% formaldehyde, 0.1% glutaraldehyde in 0.1 M PHEM (240 mM PIPES, 100 mM HEPES, 8 mM MgCl2, 40 mM EGTA), pH 6.9, for 1h. The coverslips were washed with 0.1 M PHEM buffer and mounted with Mowiol containing 1 μg/ml Hoechst 33342. The cells were examined with a Zeiss LSM710 confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany) equipped with a Laser diode 405-30 CW (405nm), an Ar-Laser Multiline (458, 488, 514 nm), a DPSS-561 10 (561 nm) and a HeNe-laser (633 nm). Cells of interest were identified by fluorescence microscopy and a Z-stack covering the whole cell volume was acquired. The relative positioning of the cells on the photo-etched coverslips was determined by taking a low magnification DIC image. The coverslips were removed from the object glass, washed with 0.1 M PHEM buffer and fixed in 2% glutaraldehyde/0.1 M PHEM overnight. Cells were postfixed in osmium tetroxide and potassium ferry cyanide, stained with tannic acid, and uranyl acetate and thereafter dehydrated stepwise to 100% ethanol followed by flat-embedding in Epon. Serial sections (80 nm – 200 nm) were cut on a Ultracut UCT ultramicrotome (Leica, Germany) and collected on formvar coated slot-grids. Thin sections were observed at 80 kV in a JEOL-JEM 1230 electron microscope and images were recorded using iTEM software with a Morada camera (Olympus, Germany). Sections of 200 nm thickness were observed at 200 kV in a Thermo ScientificTM TalosTM F200C microscope and recorded with a Ceta 16M camera. Consecutive sections were used to align electron micrographs with fluorescent images in X, Y and Z. For tomograms, image series of 200 nm thick section were taken between −60° and 60° tilt angles with 2° increment. Single-tilt axes series were recorded with a Ceta 16M camera. Tomograms were computed using weighted back projection using the IMOD package. Display, segmentation and animation of tomograms were also performed using IMOD software version 4.98.
Immunoblotting
Cells were lysed in 2x sample buffer (100 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 200 mM DTT, bromophenol blue). The whole-cell lysate was subjected to SDS-PAGE on a 4-20% gradient gel. Proteins were transferred to Immobilon-P membrane (Millipore). Immunodetection was performed using fluorescently-labeled secondary antibodies and Odyssey® or ChemiDoc™ developer. Western blot images are representatives for at least three independent experiments.
Real-Time quantitative PCR (RT-qPCR) analysis
Total RNAs were extracted using RNeasy® Mini Kit, ref. 74106, Qiagen, Germany. Reverse transcription was performed on 500 ng of DNAseI treated total RNA, with high-capacity cDNA reverse transcription kit, following manufacturer’s recommendations (Applied Biosystems, ref. 4368814, USA). RT-qPCR was performed on 2 μl of 1/25 diluted cDNA with a CFX-96 (Biorad) thermocycler, using SsoAdvanced™ Universal SYBR Green Supermix 2X, Biorad. The following primers were used (Invitrogen): CHMP7 (Forward GTCACAGTCCTCGAGCAGAA / Reverse CGTCATTGACTGGAGAGACCT), CHMP7-FLAG (Forward GTCACAGTCCTCGAGCAGAA / Reverse TACGTCGTTAACAGGGCTCA), GAPDH (Forward TCGGAGTCAACGGATTTGGT / Reverse TATGATTCCACCCATGGCAA) at a final concentration of 250 nM. All measurements were normalized to the expression of GAPDH. Results were analysed using the 2−ΔΔCT method and are presented as the mean of three independent experiments.
Metaphase spreads
RPE1 cells stably expressing 2xmRuby-NES and DOX-inducible CHMP7-FLAG or CHMP7NES*-FLAG were treated with 500 ng/ml DOX. After 4 hours, colchicine was added to the medium, the cells were incubated for another 20 hours, and harvested according to Mandahl (1992). Chromosomes of the dividing cells were then G-banded with Wright stain (Merck, Darmstad, Germany). The subsequent cytogenetic analysis and karyotypic description followed the recommendations of the International System for Human Cytogenetic Nomenclature (ISCN 2106).
In silico experiments
The geometry of the in silico experiments consists of a spherical cell and a smaller, concentric nucleus, populated by two types of particle, CHMP7 and LEMD2. LEMD2 is located on the INM and CHMP7 is either located in the cytoplasm or on the outer nuclear membrane (ONM)/ER. During the in silico experiments, the number of the LEMD2 sites bound with CHMP7 is monitored following simulated rupture of the nuclear envelope. The interaction is a reversible reaction with a forward rate of FL and a backwards rate DL. The values for all relevant variables are listed in Supplementary Table 1.
For localization, two settings for CHMP7 are considered. In the first case, CHMP7 is treated as soluble and is free to diffuse in the cytoplasm in 3D. In the second case, CHMP7 is tethered to the ONM/ER and diffusion is restricted to 2D on the surface. Since the surface area of the ER is orders of magnitude larger than the nuclear membrane, we assume the CHMP7 particles on the ONM are in contact with a reservoir: when a particle moves from the outer to inner membrane, a new particle is placed randomly on the ONM in order to keep the concentration constant.
Three phenomena were modeled to capture the full behaviour of the system: diffusion, reactions and decay. In free (3D) diffusion, a particle is expected to move a distance 〈δx〉 after a time of δt as given by 〈δx2〉 = 6Dδt, where D is the diffusion constant of the particle. In our model we implement this by allowing each particle to jump a distance, j, in 3D space at each time-step with a probability, Pwalk, given by where τ is the waiting time of the particle and Δt is the time-step of the simulation. The value of τ is chosen to ensure consistency between our simulation and the expected physical results:
This particular implementation was chosen to simplify the calculation of reaction probabilities.
In the soluble (3D) CHMP7 scenario, if the jump would take the particle through a membrane barrier, the particle is bounced off the membrane instead, unless it would pass through the nuclear envelope rupture. Once a CHMP7 particle is bound to a LEMD2 particle it is immobilized until the complex decays.
In the case of membrane-bound CHMP7 (2D), diffusion is modeled on a spherical surface. The particles were created on the sphere by picking their location uniformly for θ ∈ [0,2π) and cosφ ∈[−1,1), since picking the positions uniformly in φ would result in an overrepresentation of particles at the poles20. To ensure that a particle moves in a uniform manner, a temporary particle P0 was generated on the sphere a distance j away from the north pole at an angle ψ ∈ [0,2π). The particle is then rotated twice about the origin of the sphere, using the same rotations that would carry the pole of the sphere on to the old position of the particle at (θ, φ). As distances are conserved during the rotation, the new particle is now a distance j away from its old position at a uniformly distributed angle, as we required. This means the resultant position P is given by; where RY and RZ are the standard 3D rotation matrices.
Following a CHMP7 particle jump, the distance to the closest LEMD2 particle is measured. If this distance is within a collision distance, rc, the probability for a CHMP7 particle to combine with a LEMD2 particle and act as a single complex until decay is given by where NA is the Avogadro’s constant.
The full derivation of this is given in 21. From eq. 5, we are free to choose the value of rc to fix PCHMP7+LEMD2 (or the probity to fix the radius) Decreasing the collision radius increases the accuracy of the simulation, provided we do not allow P > 1. To prevent exceeding this limit, a constant value of rc = 50 nm for both reactions is chosen.
As the reaction are bi-directional, separation of the complexes was also considered. Provided that the decay rate is much lower than the frequency of the simulation time steps, the probability of a CHMP7·LEMD2 complex dissociating into its separate component particles per time-step is defined as,
Data visualization focused on the density of the LEMD2-bound CHMP7 particles and the location of these complexes.
Image processing
For measurement of LEMD2 intensity increase and changes in MN circularity upon rupture (Fig. 3e,f), the perimeter of the MN was manually drawn using LEMD2 signal as membrane proxy. The z-section corresponding to the middle plane of each MN was chosen. For quantification of CHMP4B-eGFP and CHMP4B4DE-eGFP intensity at MN (Extended Data Fig. 4d), MN area was segmented by Otzu thresholding based on the DNA channel. The ImageJ function “Analyze Particles” was then used to define ROIs and the mean intensity for the GFP channel of each ROI was measured. A band-shaped ROI around MN was used to measure mean intensity of the cytoplasm as regularization factor. Image processing was performed using ImageJ/FIJI software6. For quantification of TOP2B accumulation (Extended Data Fig. 8d), the area around nuclei was selected according to DNA staining and number of TOP2B foci was measured by using the “Count Maxima” function with tolerance values determined for each experiment depending on the imaging parameters. For measurement of CHMP4B and RPA2 fluorescence intensity at MN (Extended Data Fig. 8e), MN area was segmented by Otzu thresholding based on the DNA channel. The ImageJ function “Analyze Particles” was then used to define ROIs and the mean intensity for the CHMP4B and the RPA2 channels of each ROI were measured. A band-shaped ROI around MN was used to measure mean intensity of the cytoplasm in both channels as regularization factor. For quantification of DOX wash out experiments, cells were washed twice with 1x PBS after 16 hours of DOX incubation (500 ng/ml) and fresh DMEM-F12 complete media without DOX was added to the cells. The same protocol was used for confocal microscopy, western blot and RT-PCR (Extended Data Fig.1d-f). For quantification of the number CHMP4B foci at each time point, the area around nuclei was selected according to DNA staining, and the number of CHMP4B foci was measured for each cell using the Image J/FIJI “Count Maxima” function. Tolerance values were determined for each experiment, depending on the imaging parameters. Three independent experiments were performed.
All data points were plotted using Graphpad Prism.
Data availability
The datasets generated and/or analyzed during the current study are available from the corresponding authors on reasonable requests.
Acknowledgements
We thank U. Dahl Brinch, M. Smestad and L. Kymre for assistance with EM, K. Schink for cell lines, E. Rønning, A. Bergersen, and A. Baumeister for technical support, A. Engen for assistance with cell culture, and C. Bassols for IT support. We also thank V. Nähse, T. Stokke, R. Syljuåsen, T. Liyakat Ali for valuable discussions. The National Core Facility for Human Pluripotent Stem Cells, the Advanced Light Microscopy Core Facility (Oslo University Hospital), the Advanced Electron Microscopy Core Facility (Oslo University Hospital), the Norwegian Advanced Light Microscopy Imaging Network (University of Oslo), and the Section for Cancer Cytogenetics (Oslo University Hospital) are acknowledged for providing facilities. C.C. was supported by the Research Council of Norway (project number 262375). H. S. was supported by the Norwegian Cancer Society (project number 182698) and the South-Eastern Norway Regional Health Authority (project number 2016087). This work was partly supported by the Research Council of Norway through its Centres of Excellence funding scheme (project number 262652).