ABSTRACT
Black aspergilli are, the most causes of otomycosis and Aspergillus niger and A. tubingensis are two more frequently isolates. Although, amphotericin B was a gold standard for the treatment of invasive fungal infection for several decades, it replaced by fluconazole and /or voriconazole. Luliconazole, appears to offer the potential for in vitro activity against black aspergilli. The aim of the present study was to compare the in vitro activity of a novel antifungal agent, luliconazole, with commonly used antifungals against clinical and environmental strains of black aspergilli. Sixty seven strains of black aspergilli were identified using morphological and molecular tests (β-Tubulin gene). Antifungal susceptibility test was applied according to CLSI M38 A2. The results were reported as MIC/MEC range, MIC/MEC50, MIC/MEC90 and MIC/MECGM. It was found that the lowest MIC range, MIC50, MIC90, and MICGM was attributed to luliconazole in clinical strains. Aspergillus niger was the common isolate followed by, A. tubingensis and 54.1% (clinical) and 30% (environmental) of isolates were resistant to caspofungin. The highest resistant rate was found in amphotericin B for both clinical (86.5%) and environmental (96.7%) strains. Clinical strains of Aspergillus were more sensitive to voriconazole (86.7%) than environmental strains (70.3%). On the other hand, 83.8% of clinical and 70% of environmental isolates were resistant to posaconazole, respectively. In conclusion, luliconazole compare to routine antifungals is a potent antifungal for A. niger complex in vitro. The MIC range, MIC50, MIC90 and MICGM of luliconazole against black aspergilli were the lowest among the representative tested antifungals.
Introduction
Luliconazole (Luzu®), (-)-(E)-[(4R)-4-(2,4-dichlorophe-nyl)-1,3-dithiolan-2-ylidene] (1H-imidazol-1-yl) acetonitrile), is an imidazole antifungal with molecular formula: C14H9Cl2N3S2 [1]. Luliconazole was basically introduced as anti-dermatophytic antifungal in Japan and India [1, 2]. However, it has demonstrated activity in vitro against multiple Aspergillus spp. including Aspergillus fumigatus [3, 4], A. terreus [4, 5], A. flavus [4, 6], A. niger [4] and A. tubingensis [4]. The availability of a novel antifungal, luliconazole, appears to offer the potential for improved therapy for a wide range of invasive fungal infections, including aspergillosis, dermatophytosis, and onychomycosis [2, 7, 8].
While, amphotericin B was a Gold standard in the first-line treatment of invasive fungal infections for several decades [9], it has been replaced by several new antifungals including, voriconazole, posaconazole and caspofungin [10, 11]. Voriconazole was presented as the primary therapy for invasive pulmonary aspergillosis in a clinical trials [12]. Further studies have shown that posaconazole is a useful antifungal for invasive fungal infection including aspergillosis [13]. On the other hand, during 2-3 last decades, caspofungin was developed to improve the prognosis of invasive aspergillosis [14].
The section Nigri (A. niger, sensu lato) contains more than 19 accepted species including, A. niger, A. tubingensis, A. awamory, A. welwitschiae, A. acidus, A. brasiliensis and others [15-18]. The aspergilli in this section are comprised of several closely related species, and identification based on sequence analyses of β-tubulin gene [4]. Aspergillus niger and A. tubingensis isolates frequently isolated in clinical infections [16, 19-21]. Black aspergilli cause several types of aspergillosis among predisposed patients [22-25]. Out of them, otomycosis is the most common cutaneous infection caused by black aspergilli [4, 20].
The increasing of fungal opportunistic infections among patients receiving intensive chemotherapy, hematological malignancies and transplant patients during last decades is remarkable [10, 23, 26-28]. Invasive Aspergillus infections are one of the life threatening human disease. On the other hand, some species of Aspergillus have inherent resistance to some antifungal agents [29]. Moreover, some species have raised minimum inhibitory concentration (MIC) against specific antifungals. As a results, infection prevention consultant and the best choice antifungal are common clinical challenges.
Objectives
The aim of the present study was to compare the in vitro activity of a novel antifungal agent, luliconazole, with amphotericin B, voriconazole, posaconazole and caspofungin against clinical and environmental strains of black aspergilli. Furthermore, the potency of each antifungal against clinical and environmental isolates was compared.
Materials and Methods
Fungal isolates
Thirty seven clinical isolates of black aspergilli were previously isolated from otomycosis samples, identified based on morphology characteristics and preserved at Medical Mycology laboratory affiliated to Ahvaz Jundishapur University of Medical Sciences. Environmental strains (30 strains) of black aspergilli were trapped from airborne spores using Sabouraud dextrose agar (SDA) (BioLife, Italia) plates. Primary screening of black aspergilli strains was applied based on macroscopic (Black colony) and microscopic morphology. All strains (clinical and environmental) were subcultured on SDA and re-identified using molecular tests.
DNA extraction
All strains (clinical and environment isolates) were subcultured on SDA plates and incubated at 29°C for 24 - 48 hours. Mycelia were collected in cryo-tubes containing 300 µL lysis buffer and 0.46 g glass beads and kept at 4°C for 72 hours. The tube contents were homogenized using a SpeedMill PLUS Homogenizer (Analytikjena, Germany) for 6 minutes (3 cycles) and boiled at 100°C for 20 minutes. 300 µL of sodium acetate (3 molar) was added to each tube and stored at -20°C for 10 minutes. Supernatants were removed after a centrifugation at 12000 rpm for 10 minutes. DNA was purified using phenol-chloroform-isoamyl alcohol according to a protocol devised by Makimura et al. [30]. Finally purified DNA was preserved at -20 °C for further tests.
Molecular identification
β-Tubulin gene was used for the molecular detection of strains using primers pair, βt2a (forward), 5’ GGTAACCAAATCGGTGCTGCTTTC 3’ and βt2b (reverse) 5’ ACCCTCAGTGTAGTGACCCTTGGC 3’ [31]. PCR products subjected for sequence analysis and then sequences were manually verified by MEGA6 software package (https://www.megasoftware.net/) and aligned using the CLUSTALW algorithm. All sequences were compared to reference sequences in the GenBank (NCBI) and CBS database via the nucleotide BLAST ™ algorithm to obtain a definitive identification (similarity values ≥ 99%). Finally, all nucleotide sequences representative were deposited in the GenBank database.
Antifungal susceptibility assay
Twofold serial dilutions of antifungals including, luliconazole (APIChem Technology, China) (from 0.00012 to 0.25 µg/mL), amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL), voriconazole (Sigma - Aldrich, Germany) (from 0.0078 to 4 µg/mL), posaconazole (Sigma - Aldrich, Germany) (from 0.0312 to 4 µg/mL), and caspofungin (Sigma - Aldrich, Germany) (from 0.0078 to 1µg/mL) were prepared in RPMI 1640 (Bio Idea, Iran). Antifungal susceptibility test was performed according to CLSI M38 A2 [32]. A standard suspension (0.5 McFarland) of 48 - 72 hours cultures on SDA was prepared in sterile saline (0.85%) with 0.2% Tween 20 (Merck, Germany). Then, 100 µL of diluted suspension (1:50) and 100 µL of serial dilutions of each antifungal were added to each well of 96-well microplates. Microplates incubated at 35°C for 24 to 72 hours and results were recorded as MIC. Finally, MIC/MEC range, MIC/MEC50, MIC/MEC90 and MIC/MECGM were calculated. CLSI or EUCAST have not been defined any clinical or epidemiologic breakpoints/cut offs for amphotericin B, voriconazole, posaconazole, caspofungin and Aspergillus species. Strains susceptibility / resistance to each antifungals was evaluated according to commonly utilized breakpoints (Table 1).
Statistical analysis
The Chi-squared test using the Social Science Statistics software (Online) was applied to determine the significant between variables and P value < 0.05 is considered as significance level.
Results
Molecular detection of isolates
37 clinical strains of black aspergilli were detected using molecular and sequencing techniques. Aspergillus niger (21, 56.8%) was the common strain followed by, A. tubingensis (11, 29.8%), A. luchuensis (1, 2.7%), and black aspergilli (4, 10.8%) (Table 2). Furthermore, out of 30 environmental black aspergilli isolates, 15 (50%) was identified as A. niger followed by, A. tubingensis (13, 43.3%), A. piperis (1, 3.3%) and black aspergilli (1, 3.3%). However, we could not identified four clinical and one environmental black aspergilli, using molecular technique due to inadequate DNA sample size.
Clinical isolates
It was found that the lowest MIC range (0.00024 - 0.125 µg/mL), MIC50 (0.00195 µg/mL), MIC90, (0.125 µg/mL) and MICGM (0.00295 µg/mL) was attributed to luliconazole (Table 3). The minimum effective concentration (MEC) range for all clinical Aspergillus species was 0.0078 - 1 μg/ml for caspofungin. In addition, the 50% and 90% MEC (MEC50, MEC90) values were 0.125 and 0.5 μg/ml for caspofungin. 54.1% of isolates were resistant to caspofungin. The results have shown that the MIC range of amphotericin B for tested isolates was 0.25 - 16 µg/mL. However, MIC50, MIC90 was similar, 8 µg/mL. The highest resistant rate was found in amphotericin B (86.5%). The MIC ranges for clinical isolates of black aspergilli were 0.0078 - 4 and 0.0625 - 4 µg/mL of voriconazole and posaconazole, respectively. However, the MICGM for voriconazole (0.77 µg/mL) was lower than posaconazole (1.45 µg/mL). In our study, 29.7% and 83.8% of isolates were resistant to voriconazole and posaconazole, respectively.
Environmental isolates
Table 4 summarizes the in vitro susceptibilities of 30 environmental Aspergillus Nigri against several antifungals. The same as clinical isolates, the lowest MIC range was 0.00049 - 0.00781 μg/ml for luliconazole. Moreover, the MIC50, MIC90 and MICGM were 0.00195, 0.00391 and 0.00195 μg/ml, respectively. The MEC range, MEC50, MEC90 and MECGM for caspofungin were 0.0078 - 0.5, 0.0625, 0.25, and 0.0507 μg/ml, respectively. Furthermore, 30% of environmental strains were resistant to caspofungin. As shown, the MIC range for amphotericin B was 2 - 16 μg/ml followed by, MIC50, MIC90 and MICGM were 8, 8 and 6.063 μg/ml, respectively. Moreover, 96.7% of strains were resistant to antifungal. Totally, the MIC range voriconazole for environmental isolates of Aspergillus was 0.0625 - 2 μg/ml, whereas MIC90 2 μg/ml, MIC50 0.5 and MICGM 0.4665 μg/ml). Our results indicated that only 4 (13.3%) of strains were resistant to voriconazole. The tested isolates were inhibited at MIC range 0.0625 - 4 μg/ml by posaconazole. Furthermore, the MIC50, MIC90 and MICGM were 2, 4 and 1.2599 μg/ml, respectively. In addition, 70% of strains were resistant to posaconazole.
Caspofungin was significantly more effective against environmental than clinical strains (P = 0.048). However, the inhibitory effect of other antifungals (amphotericin B, posaconazole and voriconazole) against both strains (clinical and environmental) was similar (amphotericin B, P=0.147; voriconazole, P=0.109; posaconazole, P=0.178). When we compared the effect antifungals against A. niger and A. tubingensis among clinical and environmental strains, it is found that caspofungin was more effective on A. niger with environmental sources than clinical strains (P=0.0482). Whereas, the effect of other antifungals against both species was not significant.
Our results showed that 32 (86.5%) of clinical strains were resistant to 2, 3 or 4 antifungals, 2 (5.4%) isolates were resistant to one antifungal and 3 (8.1%) were fully susceptible to antifungals (Table 5). Two strains of A. tubingensis, one A. niger and one black aspergilli were resistant to all antifungals (except luliconazole). On the other hand, in environmental strains, 21 (70%) of strains were resistance to 2 - 4 antifungals and only 30% of strains were resistance to one antifungals (Table 6). Two strains of A. niger and one A. tubingensis were resistant to all antifungals (except luliconazole).
Discussion
Aspergillus strains isolated from clinical and air borne samples were identified using classical morphological features and molecular methods. Moreover, their susceptibilities to several antifungals including luliconazole, voriconazole, posaconazole, amphotericin B, and caspofungin were assayed. Aspergillus tubingensis, A. luchuensis and A. piperis were identified as the cryptic species of A. niger sensu lato by the sequence analysis of β-tubulin gene. Several reports have shown that A. niger is generally as common causative agent of otomycosis and one of the most important agent for invasive aspergillosis [20, 22, 26, 39, 40]. However, new molecular techniques are indicating that this species comprises 19 cryptic species [4, 16, 21].
Some studies have shown a high efficacy of luliconazole against dermatophytes and onychomycosis agents both in vivo and in vitro [1, 2, 7, 8, 41]. Furthermore, recently a few studies examined the potency of luliconazole against different species of Candida, A. fumigatus, A. terreus and Fusarium species [5, 6, 42]. However, the potency profile of luliconazole against A. niger, complex is unknown. Our results showed that, although the MIC range for strains was extremely low, this range for environmental strains (0.00781-0.00049 μg/ml) was lower than clinical strains (0.125 - 0.00024 μg/ml). As shown in table 5, only five clinical strains (A. niger sensu stricto, 4 isolates and A. tubingensis, 1 isolate) have a MIC = 0.125 μg/ml. 30/30 (100%) of environmental and 83.8% of clinical strains had the lowest MICs (MICs < 0.00781 μg/ml) against luliconazole. Moreover, the MICGM for environmental and clinical strains were 0.00195 and 0.00295 μg/ml, respectively. Abastabar et al. [3] and Omran et al. [6] were tested luliconazole against A. fumigatus and A. flavus, and found that the antifungal has the lowest MICs against A. fumigatus (MIC90 0.002 μg/ml) and A. flavus (MIC90 0.032 μg/ml), respectively.
There are the limited data in in vitro efficacy of antifungals against the black aspergilli both from clinical and environmental sources. While, the clinical and environmental strains had the same MIC ranges for caspofungin, the resistant to antifungal showed the clear differences between clinical and environmental strains (P = 0.048), where the clinical isolates showed higher resistant rate than the environmental strains. In a report by Badali et al., only 6.1% of environmental strains of A. niger were resistant to caspofungin and all clinical isolates ranged at 0.008–0.063 μg/ml [21].
The in vitro activities of posaconazole, voriconazole, and amphotericin B against clinical Aspergillus strains have been reported by Arikan et al. [10]. They reported that voriconazole was the most active antifungal against A. niger. Comparable to our results, voriconazole was more potent than the other tested antifungals (with exception luliconazole) against both clinical and environmental strains. Aspergillus tubingensis resistant strains to amphotericin B was very common both in environment and clinical settings, followed by posaconazole, caspofungin, and voriconazole. However, the resistant rate to amphotericin B was lower among environmental than clinical strains. Hashimoto et al., finding suggests that A. tubingensis is intrinsically resistant to azole antifungals [15]. Antifungal susceptibility testing of our A. tubingensis strains revealed 90.9% and 53.8% of clinical and environmental isolates were resistant to posaconazole.
In conclusion, luliconazole compare to amphotericin B, voriconazole, posaconazole and caspofungin is a potent antifungal for A. niger sensu lato in vitro. The MIC range, MIC50, MIC90 and MICGM of luliconazole against black aspergilli were the lowest among the representative tested antifungals. However, these results suggest luliconazole can be a viable option for the treatment of infections due to black aspergilli and should be further investigated in vivo. There is no available systemic formulation of luliconazole and it is strongly suggested that systemic formulation of drug test in vivo.
Authors’ Contribution
Study concept and design, Ali Zarei Mahmoudabadi; isolation and preparing clinical and environmental isolates, Marzieh Halvaeezadeh and Sahar Hivary; conducting the experiments, Sahar Hivary; data analysis and interpretation of the results, Ali Zarei Mahmoudabadi, Mahnaz Fatahinia, and Sahar Hivary; drafting of the manuscript, Ali Zarei Mahmoudabadi; Critical editing Mahnaz Fatahinia.
Funding support
This study was a part of MSc thesis (Sahar Hivary) supported by a grant (No: OG-96148) from the Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.
Conflict of interest
No conflict of interest declared.
Ethics statement
This project was approved by the ethical committee of Ahvaz Jundishapur University of Medical Sciences (IR.AJUMS.REC.1396.1066).
Acknowledgments
We would like to thank the Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences for their support.