Skip to main content
bioRxiv
  • Home
  • About
  • Submit
  • ALERTS / RSS
Advanced Search
New Results

CAMIO for deletion analysis of endogenous DNA sequences in multicellular organisms

Hui-Min Chen, Jorge Garcia Marques, Ken Sugino, Dingjun Wei, Rosa Linda Miyares, View ORCID ProfileTzumin Lee
doi: https://doi.org/10.1101/658088
Hui-Min Chen
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jorge Garcia Marques
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ken Sugino
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Dingjun Wei
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rosa Linda Miyares
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tzumin Lee
Howard Hughes Medical Institute, Janelia Research Campus, 19700 Helix Drive, Ashburn, VA 20147, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Tzumin Lee
  • For correspondence: leet@janelia.hhmi.org
  • Abstract
  • Full Text
  • Info/History
  • Metrics
  • Preview PDF
Loading

Abstract

The genome is the blueprint for an organism. Interrogating the genome, especially locating critical cis-regulatory elements, requires deletion analysis. This is conventionally performed using synthetic constructs, making it cumbersome and non-physiological. Thus, we created Cas9-mediated Arrayed Mutagenesis of Individual Offspring (CAMIO) to achieve high-throughput analysis of native DNA. CAMIO utilizes CRISPR that is spatially restricted to generate independent deletions. Controlled by recombination, a single guide RNA is stochastically chosen from a set targeting a specific DNA region. Combining two sets increases variability, leading to either indels at 1-2 target sites or inter-target deletions. Cas9 restriction to male germ cells elicits autonomous double-strand-break repair, consequently creating offspring with diverse mutations. Thus, from a single population cross, we can obtain a deletion matrix covering a large expanse of DNA at both coarse and fine resolution. We demonstrate the ease and power of CAMIO by mapping 5’UTR sequences crucial for chinmo’s post-transcriptional regulation.

Introduction

It never ceases to amaze that genomes, sequences composed of a seemingly simple four-letter code, serve as the fundamental blueprints for life. From these four nucleotides emanate layers upon layers of complexity. The central dogma depicts the basic information flow from DNA to RNA to protein. However, numerous mechanisms increase the complexity at each step and can feed backwards. Some examples include epigenetic modifications, promoter/enhancer usage, alternative splicing, post-transcriptional and post-translational modifications. Understanding how complex biology unfolds, advances, and evolves from genomic sequences requires development of precise and efficient tools to interrogate the genome. While spontaneous or induced mutations once served as the basis of our understanding about many biological processes, we now exploit sophisticated methods to directly manipulate genomes for systematic mechanistic studies.

Pioneering geneticists, like Dr. Barbara McClintock, enlightened us with fundamental understanding of genetic information and regulation at the level of genes and chromosomes. More recently, to understand gene regulation, molecular biologists have relied heavily on in vitro or cell culture-based assays to assess the function of DNA fragments. One example of this is promoter bashing used to pinpoint critical or regulatory sequence elements in a promoter1, 2. Also, in enhancer screening, larger DNA fragments upstream or downstream of a target gene are fused to reporter genes3–5. This synthetic approach often fails to recapitulate full endogenous patterns, and thus requires second-round rescue experiments to draw solid conclusions. Such indirect methods are inefficient and non-physiological, prompting the search for tailor-made sequence-specific DNA nucleases that permit targeted mutagenesis of native sequences.

In the early 2000s, zinc-finger nucleases (ZFNs)6, the first of the tailored nucleases, were heavily adopted7, 8. Although it seemed a promising strategy for genome editing, major setbacks, especially off-target toxicity limited its utility9. Therefore, the enthusiasm for ZFNs declined after the arrival of transcription activator-like effector nucleases (TALENs)10–12. The higher specificity of TALENs led to fewer off-target disruptions, and hence less cytotoxicity13. However, constructing a TALEN is technically challenging because the homologous sequences encoding the TALEN repeats are prone to recombine with each other9.

The newest technology, CRISPR (clustered regularly interspaced short palindromic repeats), was first exploited for targeted mutagenesis14 and then swiftly adopted to edit genomes of diverse organisms15–20. CRISPR’s popularity lies in its simplicity: a Cas9 nuclease plus an easily made guide RNA (gRNA) induces a double-strand break (DSB) targeted by DNA-RNA base pairing14, 16. Cells repair the DSBs either through nonhomologous end joining (NHEJ)21, leading to insertion or deletion (indel), or through homology-directed repair (HDR)22 which replaces discontinuous sequences with an available template. The fact that CRISPR can produce targeted DNA modifications with near unlimited specificity has ensured its rapid expansion throughout the biological and biomedical fields23. Indeed, CRISPR technology has already transformed studies from stem cell research and cancer biology to food production and pest control24.

Drosophila melanogaster has been a powerful model organism for decoding the genome to understand complex biology25. However, even with existing genetic tools, it remains quite challenging to interrogate the entire fly genome, especially non-coding regions. Enhancing fly genetics with CRISPR is particularly needed for large-scale genome-wide screens as well as focused, detailed sequence analyses26.

Here we describe a new high-throughput technology for deletion analysis called CAMIO (Cas9-mediated Arrayed Mutagenesis of Individual Offspring). We built a CRISPR-based mutagenesis pipeline in Drosophila male germ cells, to achieve massive production of independent indels in targeted loci with germline transmission27, 28. We further created a transgenic system for simultaneously targeting multiple sites with an array of gRNAs. This way, we can readily generate a huge collection of organisms harboring either diverse, small, localized indels or large, defined deletions (inter-target deletions). This will enable efficient deletion analysis of sizable genomic regions in vivo. We include here an example that demonstrates the power of CAMIO. In 2006 our lab discovered that the expression of temporal protein Chinmo was regulated via its 5’UTR29. Using CAMIO, we are able to rapidly ascribe a critical aspect of this temporal control to a 300-bp sequence of the 2kb UTR. In conclusion, CAMIO enables high-throughput organism-level genome structure-functional studies.

Results

Independent targeted mutagenesis in individual male germ cells

To mutate the genome in a high-throughput manner requires a germline pipeline for independent mutagenesis in individual germ cells rather than germline stem cells (GSCs). We have shown that the bam promoter can effectively and specifically drive flippase induction in female germ cells, and not in GSCs28. bam’s restriction to germ cells in both the male and female germline prompted us to explore whether we could conduct independent mutagenesis in individual germ cells.

To this end, we made bamP(898)-Cas9 and tested its ability to mutate gRNA-targeted sites in male as well as female germline. For proof of principle, we chose the ebony gene for targeted mutagenesis. Loss-of-ebony mutations are easy to detect and there was a readily available transgenic gRNA targeting ebony (Fig. 1a)19. We determined the mutagenesis efficiency in male versus female founders (Fig. 1b). Surprisingly, over 25% of male gametes as opposed to only ∼3% of female gametes carried loss-of-function ebony mutations. This result demonstrates that the male germline is particularly susceptible to bamP-Cas9-mediated genome editing.

Figure 1.
  • Download figure
  • Open in new tab
Figure 1. bamP-Cas9 induces efficient CRISPR targeted mutagenesis in male germ cells.

(A) Ebony transcript shown with UTRs in turquoise. U6 drives guide RNA (gRNA-e), which targets 5’ end of ebony coding sequence. (B) Percent of progeny with ebony loss-of-function (LOF) mutations from female or male founders. Mean ± SEM (n=9). (C) Sequences of 10 randomly selected ebony LOF progeny from the same male founder. (D) Deletion profile of UAS-shibire transgene following CRISPR targeting collected from 919 phenotypically wildtype progeny. NGS data was analyzed and presented by Cas-analyzer, www.rgenome.net30. (E) Left, percentage of predicted indels (calculated by FORECasT31 using gRNA-shi and UAS-shibire sequences) grouped into 3 reading frames, 0 represents the in-frame indels. Right) Actual reading frame percentages from phenotypically wildtype progeny, calculated from mapping results (obtained with CAS-analyzer). Chi-square test assuming equal distribution was used to assess the significance. The result is below machine precision and thus set to zero.

To address if the Cas9-mediated editing events occurred independently, we sequenced a part of the ebony locus in individual mutants carrying ebony deficiency. From a single male founder, we analyzed ten progeny with ebony loss-of-function phenotypes. We uncovered seven different indels around the Cas9 cut site (Fig. 1c). One identical ebony mutation occurred in three siblings, possibly resulting from either differential deletion of GTC repeats or from microhomology-mediated repair32. The recovery of many distinct indels from a single founder argues for independent Cas9 actions in individual germ cells. This result encouraged us to establish bamP induced CRISPR in the male germline as a ‘targeted mutagenesis pipeline’.

A mutagenesis pipeline could be useful for producing novel alleles of a protein of interest. To explore this idea, we tested CRISPR’s usefulness to produce novel alleles of a well characterized gene, shibire. shibire encodes Drosophila Dynamin, a motor protein crucial for synaptic vesicle endocytosis33. shits1, a temperature sensitive allele containing a missense mutation, is widely used in behavioral assays to temporarily shut off neuronal activity34. We therefore designed a gRNA against the UAS-shibire transgene at the region where the temperature-sensitive shits1 point mutation is located, presuming that we could produce additional temperature-sensitive or dominant negative alleles.

We tested our mutagenized transgene by expressing it in the eye with GMR-Gal4 and screening at 29 degrees. Unfortunately, the rough eye phenotype was not confined to temperature-sensitive or dominant negative alleles, but was also the result of high transgene expression in the eye. Frameshift mutations in the beginning of shibire would lead to premature stop codons, and the resultant small truncated proteins are likely non-functional. By contrast, in-frame mutations would create essentially full-size proteins. However, loss of critical amino acids could disrupt key catalytic functions but preserve the protein’s ability to polymerize, thus creating a dominant negative allele. We therefore surveyed phenotypically wildtype offspring to see if they lacked in-frame mutations. We pooled around 1000 phenotypically normal progeny collected from 20 male founders for amplicon analysis with next generation sequencing (NGS). We obtained a large collection of diverse indels, with the majority of deletions smaller than 30 bps (Fig. 1d). Notably, there is a clear under-representation of in-frame mutations (Fig. 1e). The selective loss of such in-frame mutations is noteworthy, and supports the feasibility of making ‘novel’ useful proteins via deleting various amino acids of interest in a high-throughput manner.

Taken together, our data demonstrate that bamP(898) effectively restricts Cas9-mediated mutagenesis to germ cells. There is no evidence that clonal expansion contributes to the exceptionally high mutation efficiency in male founders.

Therefore, transgenic CRISPR, induced by bamP, can effectively serve as a pipeline for mass production of targeted mutations.

CAMIO: Cas9-mediated arrayed mutagenesis of individual offspring

Despite independent mutagenesis in each germ cell, using only one gRNA limits the offspring variation, as all indels are anchored around the same Cas9 cut site. To expand the diversity of deletions that one can recover from a single population cross, we next explored the possibility of multiplexing gRNA-targeted mutagenesis. Our vision for multiplexing gRNAs is to have a collection of gRNAs from which one is stochastically selected, rather than simultaneously expressing multiple gRNAs. Incorporating this multiplexed design into the male germline in combination with bamP(898)-Cas9 would enable both stochastically chosen gRNAs and offspring independent mutations. Supplying one gRNA at a time prevents contamination of rare deletions by much more frequent second-site mutations. This way, discrete clusters of simple deletions can be recovered from a single population cross. Therefore, we can tile a sizable DNA region with diverse small deletions with a repertoire of evenly spaced gRNAs.

To examine the feasibility of our multiplexing design, we targeted a UAS-mCD8::GFP transgene with four independent gRNAs. To stochastically activate only one out of the four gRNAs, we made a conditional U6-gRNA(x4) transgene that is dependent on PhiC31-mediated recombination (Fig 2a). Using the nos promoter, we control the induction of the phiC31 recombinase in GSCs. Thus, in each of the 12-24 GSCs per male fly founder35, the transgene is irreversibly recombined to express a single gRNA. Recombination occurs between a single attB site downstream of the U6 promoter and a choice of attP sites upstream of each gRNA; once reconstituted, the ubiquitous U6 promoter drives expression of only one of the gRNAs. The intra-chromosomal recombination excises an intervening 3xP3-RFP. Given the rather small size of each gRNA as compared to the large 3xP3-RFP, the differences in length between the attB site and the choice of any one attP site is therefore relatively trivial. Based on a previous, similar construct for multicolor imaging36, we expect that each gRNA should be expressed at comparable frequencies. For brevity, we name the conditional U6-gRNA transgene pCis, and then, in braces, add the number of gRNAs and the name of the targeted DNA. For example, to target the UAS-mCD8::GFP transgene, we created pCis-{4gRNAs_mCD8}. Also, when we describe the individual gRNAs, we number them in sequence from 5’ to 3’.

Figure 2.
  • Download figure
  • Open in new tab
Figure 2. CAMIO produces diverse arrayed mutations around selected gRNA target sites.

(A) Schematic of a conditional U6 gRNA transgene: pCis-{4gRNAs_mCD8}. The U6 promoter is separated from the gRNAs by a large fragment containing a 3xP3-RFP marker. With phiC31 recombination, the attachment site, attB can recombine stochastically with any of the four attP sites (black arrows), creating attR. The phiC31 recombinase is expressed in GSCs, controlled by nos. After recombination, a single gRNA is under the control of the U6 promoter (yellow oval) (B) 4 gRNA target sites along the mCD8 coding sequence were selected for pCis-{4gRNAs_mCD8} to disrupt mCD8::GFP expression. Simple or combined multiplexing mutagenesis can be achieved by incorporating one or more pCis-{4gRNAs_mCD8} transgenes. Here, we show two transgenes, each represented by four pair of scissors. Stochastically chosen gRNAs in each set are further marked in yellow. (C) Three categories of deletions arose from applying two copies of pCis-{4gRNAs_mCD8}: single-site deletion, defined deletion, and double-site deletion. Deletion size and count are depicted for single-site deletions. Right, use matrix of gRNA choices, deduced from sequencing GFP negative progeny.

For the multiplexed targeted mutagenesis of mCD8::GFP, we established male founders carrying UAS-mCD8::GFP, bamP(898)-Cas9, nos-phiC31, and pCis-{4gRNAs_mCD8}, and crossed them to act5C-Gal4 females for easy scoring of GFP fluorescence in the progeny. Overall, approximately 35% of the progeny lost GFP expression. We collected 30 GFP-negative offspring from two founder males. Sequencing the mCD8-coding region revealed that each GFP-negative offspring carried an indel corresponding to a single gRNA (Supplementary Fig. 1). Encouragingly, we recovered various deletions resulting from activation of each of the four gRNAs. However, the frequency of mutations at each target site varied. Both founders yielded many more deletions around the gRNA#1/#4 targets than the gRNA#2/#3 targets, possibly reflecting their different on-target potencies.

We found that the majority (83.3%) of deletions removed 20 or fewer bp and that the largest one eliminated 85 bp. To tile a sizable DNA region with such small deletions would require many gRNAs bombarding the region of interest at a density of around one gRNA per 100 bp. Alternatively, we should be able to create larger deletions spanning two Cas9 cuts elicited by two gRNAs acting at a distance. To explore co-employment of two gRNAs, we provided two copies of pCis-{4gRNAs_mCD8} for multiplexed dual mutagenesis of UAS-mCD8::GFP (Fig. 2b). We obtained a comparable loss-of-GFP mutation rate at ∼35% despite co-expressing two identical or distinct U6-gRNAs. This phenomenon implicates that Cas9 activity (either level or duration) limits the efficiency of gRNA-directed mutagenesis in germ cells. Nonetheless, we could recover various diverse mutations from the dual gRNA-derived GFP-negative progeny, including many single-site deletions (76.4%) and quite a few double-site deletions (two target sites with independent indels; 15.4%) as well as some large deletions spanning two gRNA target sites (inter-target deletions; 8.2%) (Fig. 2c). Notably, the single-site deletions greatly outnumbered those involving two sites. This outcome is favored in large-scale deletion analysis, as it increases the chance of recovering deletions without second-site contamination.

The above results demonstrate that using dual gRNA sets enables us to tile a region of interest not only with indels, but also with defined deletions. Random selection of a single gRNA from each of the two identical sets which contain four gRNAs will yield six possible defined deletions. Encouragingly, from a collection of only nine inter-target deletions, we recovered five of the six anticipated defined deletions. Nevertheless, physical hindrance may prevent two Cas9 complexes from acting simultaneously on very close gRNA targets. This may explain why we failed to recover the smallest defined deletion of 37 bp between the Cas9 cut sites of gRNA#2 and #3 targets. These results suggest that inter-target deletions utilizing two gRNAs can support rapid systematic DNA deletion analysis.

In sum, we established an effective strategy to express various permutations of two gRNAs in male GSCs. In combination with restricting Cas9 to male germ cells, we built a germline pipeline for multiplex targeted mutagenesis. We dub this genetic system CAMIO (Cas9-mediated arrayed mutagenesis of individual offspring), which can derive from a single population cross a matrix of variable deletions. This strategy enables deletion analysis of a substantial DNA region with both coarse (inter-target deletions) and fine (a variety of single- or double-site deletions) resolution. Below, we prove the power of CAMIO in structure-functional analysis of a 2.2kb-long genomic fragment.

Structure-functional analysis of chinmo 5’UTR

The Chinmo BTB-zinc finger nuclear protein is dynamically expressed in intricate spatiotemporal patterns in the developing Drosophila central nervous system. Such dynamic Chinmo expression governs various aspects of temporally patterned neurogenesis, including age-dependent neural stem cell proliferation37, 38 and birth order-dependent neuronal cell fate29, 39, 40. Notably, chinmo transcripts exist much more broadly than Chinmo proteins, indicating involvement of negative post-transcriptional regulation29, 38. Consistent with this notion, chinmo transcripts have long UTRs, including a 2.2kb 5’UTR and an 8.5kb 3’UTR41. To locate the involved regulatory elements in such long UTRs by conventional structure-functional analysis would be a daunting task.

Nonetheless, we started by making reporter transgenes carrying chinmo 5’ and/or 3’ UTR(s). For a functional readout, we utilized the development of the Drosophila mushroom body (MB), which involves an orderly production of γ, α’β’, and αβ neurons. We first determined the roles of the 5’ vs. 3’UTR in downregulation of Chinmo expression along MB neurogenesis29, by examining the change in expression of reporter transgenes (containing either or both UTRs) from early to late larval stages (Supplementary Fig. 2). Notably, presence of the chinmo 5’UTR drastically suppressed the reporter expression. Interestingly, only in the absence of the 3’UTR did we detect an enhanced 5’UTR-dependent suppression at the late larval stage. These phenomena ascribe the chinmo downregulatory mechanism(s) to the 5’UTR, and unexpectedly revealed some upregulation by the 3’UTR. This upregulation could potentially be a transgene-specific artifact, arguing for the importance of performing assessments in the native environment. We thus turned to CAMIO to carry out structure-functional analysis of the native chinmo 5’UTR.

chinmo’s 5’UTR is separated into 3 exons; the first two exons are neighboring and the distant 3rd exon is separated from the 2nd by 36kb (Fig. 3a). A gRNA set was designed to target each exon for CRISPR mutagenesis (Fig. 3b). We provided two copies of the same set for induction of both indels and inter-target deletions within an exon. Additionally, we paired gRNA sets for exon 1 and 2 to create larger deletions that span the exon1/2 junction. Thus, we could delete various parts of chinmo 5’UTR in its endogenous locus with simple fly pushing.

Figure 3.
  • Download figure
  • Open in new tab
Figure 3. Applying CAMIO on chinmo 5’ UTR.

(A) An illustration of the chinmo gene, UTRs are depicted in turquoise. (B) We selected 4 target sites on chinmo exon 1 (455 bps), 6 target sites on exon 2 (1061 bps), and 4 target sites on exon 3 (639 bps). Each exon was dissected by CAMIO with a pair of gRNA sets, depicted as a set of scissors. Additionally, we combined gRNA sets from exon1 and exon2. (C) Representation of larger deletions predicted by NGS of 984 offspring (300 each for individual exons and 84 for Ex1-Ex2). Predicted deletions over 100 bps were subject to Sanger sequencing for confirmation. Confirmed >100 bps deletions are marked in red and given an ID#. Selected homozygous viable deletions (marked in green) that cover larger proportions of each exons were selected for MB development studies.

Based on the previously observed deletion rate of around 35%, we collected 300 male progeny from each CAMIO genetic cross. We hoped to saturate each 5’UTR exon with ∼100 different deletions. In total, 1200 CAMIO males were harvested from the four different gRNA array combinations (exons 1, 2, 3, and 1+2). We mapped potential indels by sequencing indexed PCR products in a high-throughput manner.

We detected numerous indels around each gRNA target site (Supplementary Fig. 3) and also recovered many inter-target deletions that together allow efficient coverage of the entire 5’UTR (Fig. 3c). We made organisms homozygous for the large inter-target deletions and examined MB morphology. Markedly, we found similar aberrant MB morphology with two exon 2 inter-target deletions, chinmoEx2L56 and chinmoEx2L130 (Fig. 4a). These deletions overlap by ∼300 bp. Variable defects in the perpendicular projection of the bifurcated αβ axon lobes appeared at comparable frequencies (∼30-50%) in homozygous as well as transheterozygous brains. Further, the penetrance of this phenotype is sensitive to Chinmo dosage, as a chinmo deficiency line effectively suppressed the phenotype (Fig. 4b). Marchetti and Tavosanis recently proposed that Chinmo downregulation plays a role in promoting α’β’ to αβ MB neuron fate transition at the prepupal stage42. Therefore, we assessed Chinmo levels, and observed aberrantly elevated Chinmo in young MB neurons around pupa formation in both chinmoEx2L56 and chinmoEx2L130 homozygous mutants (Fig. 4c). This is consistent with the notion that these overlapping deletions have uncovered the essential region for this prepupal downregulation of Chinmo. In summary, a single round of CAMIO allowed us to identify a 300 bp locus in the 2.2kb 5’UTR critical for proper MB development.

Figure 4.
  • Download figure
  • Open in new tab
Figure 4. Overlapping deletions in 5’UTR alter Chinmo expression and MB morphology.

(A) Stacked confocal images of adult MBs stained for FasII (green, αβ and γ lobes) and Trio (red, α’β’ and γ lobes). Missing or misshapen αβ lobes (arrows). Scale bars: 50 μm. (B) Percent of flies with abnormal αβ lobes. Homozygous and transheterozygous deletions have strong MB αβ lobe defects, whereas hemizygous deletions over a chinmo deficiency line (Df) are much less penetrant. (C) Single optical sections of MB lineages (OK107-Gal4, UAS-mCD8::GFP) immunostained for GFP and Chinmo at white pupa stage. Chinmo staining is elevated in newly derived MB neurons (weaker GFP signal, outlined by white dashed lines) in homozygous chinmoEx2L56 and chinmoEx2L130. Green: GFP; Magenta: Chinmo. Scale bars: 20 μm.

Meanwhile, notably absent were indels or large deletions involving the target sites g2_2 and g2_3. This area in exon 2 may carry essential sequences for Chinmo regulation that is critical for organism viability. Alternative explanations for the failure in recovering indels from that region include: a relatively shallow sequencing depth of the exon 2 region, our small sample size, unexpectedly low gRNA on-target strength for these gRNAs, or flawed design in the exon 2 gRNA set pCis-{6gRNAs_chinmo Exon2}. To address the last concern that bothered us most, we assessed the usage of specific gRNAs for the exon 2 set in progeny that do not contain Cas9 (Supplementary Fig. 4). While g2_2 and g2_3 were not recruited as frequently as others, they each still emerged 6-7% of the time. A rate of 6-7% should be sufficient for us to recover some indels, as gRNA#1 was selected ∼15% of the time and produced multiple indels in our CAMIO experiment.

To examine whether this region of the 5’UTR is indeed critical, we exploited mosaic analysis to create somatic mutations in different tissues. A transgene, dU6_g2+3, was hence assembled to ubiquitously express both g2_2 and g2_3. We began with MB-specific CRISPR mutagenesis by inducing UAS-Cas9 specifically in the MB lineage using a MB specific Gal4 (OK107-Gal4). We saw no temporal fate changes in the MB, the classic phenotype of chinmo misregulation in the MB. We next elicited CRISPR mutagenesis in all neural stem cells (neuroblast: NB) with NB-restricted Cas9 (dpn-Cas9) and dU6_g2+3. These animals were viable and showed no abnormal tumor-like NBs in larval or adult brains (typical of Chinmo overexpression)38. These data failed to provide evidence in support of presence of critical brain regulatory elements in the region targeted by g2_2 and g2_3. We strengthened this negative conclusion by directly removing various small-to-large fragments around g2_2 and g2_3 targets from the above chinmo UTR-containing GFP transgene. In developing MBs, we observed indistinguishable GFP expression profiles between wild-type and modified 5’UTRs (Supplementary Fig. 5). In contrast to our negative findings in the brain, we found severe embryonic or early larval lethality when we induced early ubiquitous somatic mutations with act5C-Cas9 and dU6_g2+3. This dominant lethality provides a direct explanation for our failure in recovering viable organisms carrying g2_2 or g2_3 induced indels. Together, these data suggest an essential role for chinmo 5’UTR outside of the brain.

In conclusion, a single round of CAMIO successfully led us to uncover two critical regions of the chinmo 5’ UTR. The first critical region lies around the g2_2 and g2_3 targets and carries essential sequences for organism viability, unrelated to Chinmo’s functions in the brain. The second critical region of the chinmo 5’UTR was uncovered by the overlapping chinmoEx2L56 and chinmoEx2L130 deletions. We determined that this ∼300bp region is essential to down-regulate Chinmo expression, ensuring proper MB development. This fruitful case-study exemplifies the power of CAMIO in high-throughput unbiased deletion analysis of the genome.

Discussion

Two innovations synergistically enable CAMIO, a germline pipeline for arrayed CRISPR mutagenesis. First, the bamP promoter can specifically limit Cas9 endonuclease activity to individual male germ cells—thus individual offspring receive independent mutations. Second, the random-choice gRNA arrays provide extensive coverage for deletion analysis, with both small indels and large deletions. Hence, the combination of bamP-Cas9 and gRNA arrays used in CAMIO enables in vivo targeted deletion analysis with both minimal molecular biology and minimal fly pushing.

We were happily surprised to discover a much higher CRISPR mutagenesis rate in male compared to female germ cells using bamP. This sex difference was also observed in CRISPR-induced gene targeting in our effort to improve Golic+ (manuscript in preparation). Currently, we do not know what leads to this phenomenon. bamP has a striking similar expression pattern in both the female and male germline: absence in GSCs and an early onset of expression during the four incomplete mitoses that produce the 16-cell germline cysts43. One possibility is that the bamP activity is higher in the male than the female germline. Another possibility has to do with the sex differences in meiotic recombination— meiotic recombination does not occur in male Drosophila. Perhaps reduced access to homologous chromosomes as templates for homology-mediated repair favors indels. In any case, this feature allows us to utilize bamP to build a high-efficiency pipeline for targeted CRISPR mutagenesis in male germ cells.

Conventional gRNA multiplexing provides all gRNAs at once as a cocktail, which expands indel diversity but inevitably creates complex and often biased deletion patterns. The off-target effects of a gRNA cocktail also accumulate in an additive manner. By contrast, CAMIO selects a single gRNA from each set and complexity can be added by increasing the number of sets. Thus, CAMIO confers every gRNA with some autonomy while achieving multiplexed mutagenesis as a whole. Off-target concerns in CAMIO can be adequately addressed by examining multiple independent mutations of similar kinds. Also, arrays of targeted mutations can be introduced into specific genetic backgrounds with CAMIO. For example, when performing CAMIO on the chinmo 5’ UTR, we purposefully targeted a 2L chromosome arm that also carries transgenes for twin-spot MARCM 44. Hence, all the CAMIO chinmo indels were immediately ready for mosaic analysis. Independent indels can be directly screened for visible phenotypes in mosaic organisms. However, we favor mapping the indels first by NGS, which can be conducted in a high-throughput manner via combinatorial sample indexing. We have also reduced the costs by pooling distinct amplicons for co-indexing.

In general, we recovered similar indel spectrums to what has been commonly described. For gRNAs that are inherently potent, like g1_4 for chinmo 5’ UTR, we obtained many indels around the cut site. Despite recovering numerous single-site deletions, we rarely see single-site deletions exceeding 30 bps in length. Therefore, the observed ease in creating diverse inter-target deletions by CAMIO is particularly valuable for systematic DNA dissection. In the case of CAMIO on chinmo 5’UTR, we recovered most of the predicted inter-target deletions with the exception of the ‘toxic’ g2_2 and g2_3. Notably, the largest inter-target deletion we have identified exceeds 2 kb in length. These observations suggest that we can be more aggressive in choosing more disperse gRNA targets to cover larger genomic regions.

After all, the capacity of CAMIO is mainly determined by how many gRNAs one can pack into a single set. Given the small size of gRNAs, we expect no problem in packing six or even more gRNAs without compromising the system. This intuition was largely supported by seeing reasonable recruitment frequencies for all six tandem gRNAs in the chinmo exon 2 set. Further, there is still room for improvement on the gRNA selection process. For instance, increasing the distance between the U6 promoter and the gRNA set would make the selection more impartial. In sum, we have shown that the CAMIO system holds great promise for in vivo deletion analysis. Yet, our demonstrations have not nearly reached the limitations of CAMIO as far as the number of targets and size of DNA that can be evaluated in a single experiment.

We used CAMIO to perform deletion analysis on the 5’UTR of chinmo, which has important roles in governing Chinmo protein levels. There evidently exist multiple mechanisms governing chinmo expression throughout development. We successfully identified a region responsible for Chinmo downregulation in the MB around pupa formation. The resulting elevated Chinmo expression affected MB morphogenesis, possibly due to abnormal neuronal fate transition. In addition, we found a large region critical for embryo viability. While roles for Chinmo have been described in the brain and as a downstream target of JAK/STAT in the testes45, our data suggest another essential role for Chinmo in embryonic development. The identification of discrete non-coding regions regulating different biological processes within a single UTR has exemplified the utility of CAMIO in resolving complex UTR functions. Given its multiplex and combinatorial power, CAMIO should also greatly aid the dissection of promoters, enhancers, long non-coding RNAs, DNA repeats and more.

In theory, CAMIO should work for any organism where a bamP-like promoter exists. Particularly, if a founder parent (possibly a father) can produce a large number of targeted mutants, CAMIO may become a desirable genetic screening platform for interrogating the genome. A mouse gene, Gm114, was identified as a putative ortholog of Drosophila bam46. Encouragingly, strikingly similar to bam, Gm114 is greatly enriched in undifferentiated spermatocytes and spermatids but absent or extremely low in undifferentiated spermatogonia. Orthologs of bam and Gm114 were also found in zebrafish, chicken, macaque, and others. We have pioneered CAMIO as a germline pipeline for arrayed CRISPR mutagenesis in Drosophila. CAMIO can expedite systematic structure-functional analysis of the genome across diverse model organisms.

Methods

Fly strains

We used the following fly strains in this work: (1) bamP(898)-Cas9 in attP2; (2) U6:3-gRNA-e19; (3) Df(3R)ED10838/TM2 (BDSC #9485); (4) dU6-3-gRNA-shi in attP40; (5) UAS-shibire in attP2; (6) GMR-Gal4; (7) nos-phiC31-nls #12; (8) 10XUAS-mCD8::GFP in attP4047; (9) act5C-Gal4/TM6B; (10) pCis-{4gRNAs_mCD8} P element insertion line #3, #10 on II, and #9, #12 on III; (11) 13XLexAop2-5’ UTR-smGFP-OLLAS in VK00027, 13XLexAop2 –smGFP-cMyc-3’ UTR in attP40, and 13XLexAop2-5’ UTR-smGFP-V5-3’ UTR in su(Hw)attP5; (12) 41A10-KD; (13) DpnEE-KO-LexAp65; (14) pCis-{4gRNAs_chinmo Exon1} P element insertion line #23, #25 on II, and #4, #5 on III; pCis-{6gRNAs_chinmo Exon2} #7, #11 on II, and #14 on III; pCis-{4gRNAs_chinmo Exon3} #5 on II, and #2, #3 on III; (15) FRT40A,UAS–mCD8::GFP,UAS–Cd2-Mir/CyO,Y44; (16) OK107-Gal4; (17) UAS-Cas919; (18) dU6_g2+3 in VK00027; (19) Dpn-Cas9 (unpublished reagent); (20) act5C-Cas919; (21) 13XLexAop2-53UTR-smGFP-V5-d, 13XLexAop2-53UTR-smGFP-V5-bD, and 13XLexAop2-53UTR-smGFP-V5-D23 in attP40.

Molecular biology

To create bamP(898)-Cas9, the full bam promoter (−898)27 was ordered from gBlocks, IDT, and Cas9 was also flanked by bam 3’ UTR. To create UAS-shibire, codon-optimized shibire coding sequence that carries the gRNA-shi target site was ordered from GeneArt gene synthesis, and then cloned into pJFRC2848. To generate dU6-3-gRNAs, we replaced 10XUAS-IVS-GFP-p10 of pJFRC28 with dU6-3 promoter and gRNA scaffold fragment from pTL228. For dU6-3-gRNA-shi, GTATGGGGTATCAAGCCGAT was selected as the spacer. To create dU6_g2+3, we first generated dU6-3-g2_2 and dU6-3-g2_3 separately, and cloned dU6-3-g2_2 into the backbone of dU6-3-g2_3.

To create conditional U6-gRNA set construct, pCis-{4gRNAs_mCD8}, a U6 promoter-AttB fragment was synthetized by PCR amplification from pCFD319 and cloned into pCaST-elav-VP16AD, which contained the p-Element inverted repeats (Addgene, #15308). Then, we inserted a DNA fragment (Genscript) containing 4 different gRNAs targeting the mCD8 protein tag. These gRNAs were selected based on their ON and OFF target scores (Benchling). Each of these gRNAs was preceded by an AttP site and a HammerHead ribozyme49. Finally, a 3Xp3-RFP-polyA(α-tubulin) fragment was synthetized by PCR amplification, using pure genomic DNA from a fly line in which this cassette was used as a marker (Bloomington, #54590). Then, this fragment was inserted upstream of this gRNA region. In the final construct, the AttB and AttP sites were separated by a 3.7 Kb region containing an ampicillin resistance gene, an origin of replication in bacteria and the 3Xp3-RFP-polyA marker.

pCis-{gRNAs_chinmo-Exon1/Exon2/Exon3}: following the same design described above, a DNA fragment was synthetized (Genscript), which contained 4 gRNAs (6 for Exon2) either targeting the corresponding exon or the exon-intron junction. This fragment was then inserted into pCis-{4gRNAs_mCD8}, thus removing the previous gRNAs cassette.

The Chinmo UTRs were amplified from Drosophila genomic DNA. smGFP50 fused to V5, cmyc or ollas were amplified from previously existing plasmids. Standard molecular biology techniques were used to clone the smGFP fusions containing one or two Chinmo UTRs into 13XLexAop2 (pJFRC15,47). If the construct ended with Chinmo 3’UTR, the SV40 signal was removed from the vector backbone. 13XLexAop2-5’ UTR-GFP-3’ UTR was further modified to create d, bD, and D23 reporters containing various deletions in the 5’ UTR.

Drosophila genetics

ebony and UAS-shibire mutagenesis by bamP(898)-Cas9

Female or male founders (bamP(898)-Cas9/U6:3-gRNA-e) were mated to Df(3R)ED10838/TM6B, and chromosomes over Df(3R)ED10838 were scored for ebony loss-of-function phenotype. In total, 709 progeny from 5 female founders and 1574 progeny from 9 male founders were collected and phenotype was assessed. Male UAS-shibire mutagenesis founders were crossed with GMR-Gal4, and the wildtype-eyed 919 progeny were sacrificed for next generation sequencing (NGS).

CAMIO on UAS-mCD8::GFP

Male founders (UAS-mCD8::GFP, bamP(898)-Cas9, nos-phiC31, and one or two copies of pCis-{4gRNAs_mCD8} were mated with act5C-Gal4 females for scoring of loss of green fluorescence in the progeny. For one copy of pCis-{4gRNAs_mCD8}, we screened 807 progeny from 20 founder males. 30 loss-of-GFP progeny from two founders were further subject to sequence analysis. For two copies of pCis-{4gRNAs_mCD8}, we screened 570 progeny from 16 founders. 110 loss-of-GFP progeny were analyzed and grouped into three deletion categories.

CAMIO on chinmo 5’ UTR

After mating with females carrying a second chromosome balancer for stock keeping, 1200 male progeny from 4 CAMIO on chinmo 5’ UTR gRNA set combinations were sacrificed for genomic study. We designed primer sets that produce amplicons covering exon 1, 2, 3, and exons 1+2. Males from combination 1 were intentionally numbered 1-300, and their genomic amplicons were carefully matched and mixed with counterparts from combination 2 and 3. Finally, 300 DNA mixtures plus 84 amplicons from combination 4 were tagmented (Nextera XT DNA Library Prep Kit, illumina) and barcoded (Nextera XT Index Kit v2) for NGS.

Immunohistochemistry and confocal imaging

Fly brains at indicated larval, pupal, and adult stages were dissected, fixed, and immunostained as described previously29, 44. The following primary antibodies were used in this study: chicken GFP polyclonal antibody (1:500, Invitrogen, A10262); rat anti-Deadpan (1:100, abcam, ab195173); mouse 1D4 anti-Fasciclin II (1:50, DSHB); rabbit polyclonal anti-Trio (1:1000)51; rat anti-Chinmo (1:500, a gift from the Sokol lab)41. Secondary antibodies from Molecular Probes were all used in a 1:200 dilution. The immunofluorescent signals were collected using Zeiss LSM 880 confocal microscope and processed using Fiji and Adobe Illustrator.

Bioinformatics

Sequence reads (FASTQ data) were first processed with cutadapt [https://github.com/marcelm/cutadapt] to remove adapter sequences with options: --overlap=7 --minimum-length=30 -a “CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGCAGACCG”. Then they were mapped to the genomic sequence corresponding to the chinmo region using Bowtie252 with the following options: --local --score-min G,20,0 -D 20 -R 3 - L 20 -i S,1,0.50 --no-unal. Resulting SAM files were parsed with Pysam [https://github.com/pysam-developers/pysam] to extract deletion/insertion information from the Cigar strings. When the cigar string contained ‘D’ or ‘N’, we extracted mapped sequences as deletions and designated them as type D. When the cigar string contained ‘I’, we extracted them as insertions and designated them as type I. While parsing the SAM file, soft clipped reads (reads partially mapped to the genome) were detected and clipped (unmapped) portions were set aside in a FASTA file. The sequences in this FASTA file were then re-mapped using bowtie2 to the genomic sequence encompassing the chinmo gene. Then, mapped portions of the first mapping and that of the second mapping (when the second one existed) were merged to form a deletion event which we denoted as type L (large gap). This type of gap often contained inserted sequences in the middle. We discarded any events with less than 10 reads.

Author contributions

H.-M.C. and T.L. conceived the project. H.-M.C. performed the CAMIO experiments. J.G.M. conceptualized the design of CAMIO gRNA multiplexing and generated the CAMIO gRNA sets. K.S., H.-M.C., and T.L. contributed to the design, execution, and analyses of the CAMIO NGS project. D.W. contributed to the sample preparation for CAMIO NGS. R.L.M. designed the chinmo-UTRs reporter constructs. K.S. provided statistical data analyses. H.-M.C., R.L.M. and T.L. wrote the manuscript. T.L. supervised the project.

Competing interests

The authors declare no competing interests.

Supplementary information

Supplementary figure legends

Supplementary Figure 1.
  • Download figure
  • Open in new tab
Supplementary Figure 1. Targeted mutagenesis of mCD8::GFP with pCis-{4gRNAs_mCD8}.

pCis-{4gRNAs_mCD8} was created to target four different sites along the mCD8 coding sequence of UAS-mCD8::GFP. We analyzed 30 GFP-negative progeny from two different male founders. Each GFP-negative progeny carried a indel located at one of the four target sites. The location, size, and overall counts of these 30 indels are summarized here.

Supplementary Figure 2.
  • Download figure
  • Open in new tab
Supplementary Figure 2. Three 13XLexAop2-GFP reporters for investigating chinmo 5’ and 3’ UTRs.

Top: diagram of 13XLexAop2-GFP reporters flanked by both chinmo 5’ and 3’ UTRs, only the 5’ UTR, or only the 3’ UTR. Bottom: GFP transgene expression was induced and restricted in MB lineages by immortalizing a transient MB NB expression (41A10-KD) into a sustained MB NB production of these three GFPs, with this genetic setup: DpnEE-KO-LexAp65; 13XLexAop2-GFP-UTRs; 41A10-KD. Their expression profile is shown by immunostaining for GFP at two time points (48 and 72 hours after larval hatching, ALH). GFP with the 3’ UTR is expressed at a much higher level than GFP with both 5’ and 3’ UTRs. Expression of GFP with the 5’ UTR decreases over time. Green: GFP; Red: Deadpan. Scale bars: 20 μm.

Supplementary Figure 3.
  • Download figure
  • Open in new tab
Supplementary Figure 3. The small indels created by CAMIO in chinmo Exon 1, 2, and 3.

We sequenced 984 progeny (300 each for individual exons, and additional 84 for Ex1-Ex2) from our CAMIO on chinmo 5’ UTR experiment. The size, location, and corresponding stock ID of the predicted deletions (marked in red) and insertions (marked in blue) are depicted here.

Supplementary Figure 4.
  • Download figure
  • Open in new tab
Supplementary Figure 4. Examining gRNA array selection of pCis-(6gRNAs_chinmo Exon2).

We studied how frequently each gRNA gets selected after nos-phiC31 mediated recombination by scoring progeny of male nos-phiC31; pCis-(6gRNAs_chinmo Exon2). (A) gRNA choices of 92 progeny from 9 male founders are presented in this heat map. (B) Counts for each gRNA from all the founders are aggregated and whether there is bias in selection is tested by Chi-square test assuming equal distribution. g2_2 (6.5%, 6/92) and g2_3 (7.6%, 7/92) are underrepresented.

Supplementary Figure 5.
  • Download figure
  • Open in new tab
Supplementary Figure 5. Three 5’UTR-GFP-3’UTR reporters carrying small to large chinmo Exon 2 deletions for studying the region around g2_2 and g2_3 target sites.

We generated three additional chinmo 5’ UTR-GFP-3’ UTR reporters: d (50 bps deletion around g2_3), bD (larger 158 bps deletion), and D23 (removing all the Exon 2 sequence upstream of g2_3). GFPs were induced in the same 41A10-KD immortalization strategy. We did not observe difference in expression among the four GFP UTR reporters at three development time points: 48h AEL (after egg laying), 96h AEL and, white pupa. Scale bars: 30 μm.

Acknowledgements

We thank Janelia Fly Core and Quantitative Genomics for technical support. We thank Crystal Di Pietro and Kathryn Miller for administrative support. This work was supported by Howard Hughes Medical Institute.

References

  1. ↵
    Chalfie, M. & Kain, S. R. Green fluorescent protein: properties, applications and protocols. Vol. 47 (John Wiley & Sons, Inc., 2005).
  2. ↵
    Boulin, T., Etchberger, J. F. & Hobert, O. Reporter gene fusions. (WormBook, ed. The C. elegans Research Community, WormBook, 2006).
  3. ↵
    Kvon, E. Z., Stampfel, G., Yanez-Cuna, J. O., Dickson, B. J. & Stark, A. HOT regions function as patterned developmental enhancers and have a distinct cis-regulatory signature. Genes Dev 26, 908–913, doi:10.1101/gad.188052.112 (2012).
    OpenUrlAbstract/FREE Full Text
  4. Pennacchio, L. A. et al. In vivo enhancer analysis of human conserved non-coding sequences. Nature 444, 499–502, doi:10.1038/nature05295 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  5. ↵
    Dupuy, D. et al. A first version of the Caenorhabditis elegans Promoterome. Genome research 14, 2169–2175, doi:10.1101/gr.2497604 (2004).
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Kim, Y.-G., Cha, J. & Chandrasegaran, S. Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proceedings of the National Academy of Sciences 93, 1156–1160 (1996).
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Bibikova, M., Golic, M., Golic, K. G. & Carroll, D. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics 161, 1169–1175 (2002).
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Beumer, K. J. et al. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proceedings of the National Academy of Sciences 105, 19821–19826 (2008).
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Kim, H. & Kim, J.-S. A guide to genome engineering with programmable nucleases. Nature Reviews Genetics (2014).
  10. ↵
    Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. Nature biotechnology 29, 143–148 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  11. Boch, J. et al. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509–1512 (2009).
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Moscou, M. J. & Bogdanove, A. J. A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501–1501 (2009).
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Mussolino, C. et al. TALENs facilitate targeted genome editing in human cells with high specificity and low cytotoxicity. Nucleic acids research 42, 6762–6773 (2014).
    OpenUrlCrossRefPubMed
  14. ↵
    Jinek, M. et al. A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012).
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013).
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Hwang, W. Y. et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature biotechnology 31, 227–229 (2013).
    OpenUrlCrossRefPubMed
  17. Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823–826 (2013).
    OpenUrlAbstract/FREE Full Text
  18. Gratz, S. J. et al. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029–1035 (2013).
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Port, F., Chen, H. M., Lee, T. & Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 111, E2967–2976, doi:10.1073/pnas.1405500111 (2014).
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Komor, A. C., Badran, A. H. & Liu, D. R. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell 169, 559, doi:10.1016/j.cell.2017.04.005 (2017).
    OpenUrlCrossRefPubMed
  21. ↵
    Lieber, M. R. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annual review of biochemistry 79, 181–211, doi:10.1146/annurev.biochem.052308.093131 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    San Filippo, J., Sung, P. & Klein, H. Mechanism of eukaryotic homologous recombination. Annual review of biochemistry 77, 229–257, doi:10.1146/annurev.biochem.77.061306.125255 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  23. ↵
    Fellmann, C., Gowen, B. G., Lin, P. C., Doudna, J. A. & Corn, J. E. Cornerstones of CRISPR-Cas in drug discovery and therapy. Nature reviews. Drug discovery 16, 89–100, doi:10.1038/nrd.2016.238 (2017).
    OpenUrlCrossRefPubMed
  24. ↵
    Wang, H., La Russa, M. & Qi, L. S. CRISPR/Cas9 in Genome Editing and Beyond. Annual review of biochemistry 85, 227–264, doi:10.1146/annurev-biochem-060815-014607 (2016).
    OpenUrlCrossRefPubMed
  25. ↵
    Hales, K. G., Korey, C. A., Larracuente, A. M. & Roberts, D. M. Genetics on the Fly: A Primer on the Drosophila Model System. Genetics 201, 815–842, doi:10.1534/genetics.115.183392 (2015).
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Bier, E., Harrison, M. M., O’Connor-Giles, K. M. & Wildonger, J. Advances in Engineering the Fly Genome with the CRISPR-Cas System. Genetics 208, 1–18, doi:10.1534/genetics.117.1113 (2018).
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Chen, D. & McKearin, D. M. A discrete transcriptional silencer in the bam gene determines asymmetric division of the Drosophila germline stem cell. Development 130, 1159–1170 (2003).
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Chen, H. M., Huang, Y., Pfeiffer, B. D., Yao, X. & Lee, T. An enhanced gene targeting toolkit for Drosophila: Golic+. Genetics 199, 683–694, doi:10.1534/genetics.114.173716 (2015).
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Zhu, S. et al. Gradients of the Drosophila Chinmo BTB-zinc finger protein govern neuronal temporal identity. Cell 127, 409–422, doi:10.1016/j.cell.2006.08.045 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  30. ↵
    Park, J., Lim, K., Kim, J. S. & Bae, S. Cas-analyzer: an online tool for assessing genome editing results using NGS data. Bioinformatics (Oxford, England) 33, 286–288, doi:10.1093/bioinformatics/btw561 (2017).
    OpenUrlCrossRefPubMed
  31. ↵
    Allen, F. et al. Predicting the mutations generated by repair of Cas9-induced double-strand breaks. Nat Biotechnol, doi:10.1038/nbt.4317 (2018).
    OpenUrlCrossRef
  32. ↵
    Sfeir, A. & Symington, L. S. Microhomology-Mediated End Joining: A Back-up Survival Mechanism or Dedicated Pathway? Trends in biochemical sciences 40, 701–714, doi:10.1016/j.tibs.2015.08.006 (2015).
    OpenUrlCrossRefPubMed
  33. ↵
    Ferguson, S. M. & De Camilli, P. Dynamin, a membrane-remodelling GTPase. Nature reviews. Molecular cell biology 13, 75–88, doi:10.1038/nrm3266 (2012).
    OpenUrlCrossRefPubMed
  34. ↵
    Kitamoto, T. Conditional modification of behavior in Drosophila by targeted expression of a temperature-sensitive shibire allele in defined neurons. Journal of neurobiology 47, 81–92 (2001).
    OpenUrlCrossRefPubMedWeb of Science
  35. ↵
    Lehmann, R. Germline stem cells: origin and destiny. Cell stem cell 10, 729–739, doi:10.1016/j.stem.2012.05.016 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  36. ↵
    Kanca, O., Caussinus, E., Denes, A. S., Percival-Smith, A. & Affolter, M. Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development 141, 472–480, doi:10.1242/dev.102913 (2014).
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Narbonne-Reveau, K. et al. Neural stem cell-encoded temporal patterning delineates an early window of malignant susceptibility in Drosophila. eLife 5, doi:10.7554/eLife.13463 (2016).
    OpenUrlCrossRefPubMed
  38. ↵
    Dillard, C., Narbonne-Reveau, K., Foppolo, S., Lanet, E. & Maurange, C. Two distinct mechanisms silence chinmo in Drosophila neuroblasts and neuroepithelial cells to limit their self-renewal. Development 145, doi:10.1242/dev.154534 (2018).
    OpenUrlAbstract/FREE Full Text
  39. ↵
    Kao, C. F., Yu, H. H., He, Y., Kao, J. C. & Lee, T. Hierarchical deployment of factors regulating temporal fate in a diverse neuronal lineage of the Drosophila central brain. Neuron 73, 677–684, doi:10.1016/j.neuron.2011.12.018 (2012).
    OpenUrlCrossRefPubMed
  40. ↵
    Ren, Q. et al. Stem Cell-Intrinsic, Seven-up-Triggered Temporal Factor Gradients Diversify Intermediate Neural Progenitors. Current biology: CB 27, 1303–1313, doi:10.1016/j.cub.2017.03.047 (2017).
    OpenUrlCrossRef
  41. ↵
    Wu, Y. C., Chen, C. H., Mercer, A. & Sokol, N. S. Let-7-complex microRNAs regulate the temporal identity of Drosophila mushroom body neurons via chinmo. Dev Cell 23, 202–209, doi:10.1016/j.devcel.2012.05.013 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Marchetti, G. & Tavosanis, G. Steroid Hormone Ecdysone Signaling Specifies Mushroom Body Neuron Sequential Fate via Chinmo. Current biology: CB 27, 3017–3024.e3014, doi:10.1016/j.cub.2017.08.037 (2017).
    OpenUrlCrossRef
  43. ↵
    Fuller, M. T. & Spradling, A. C. Male and female Drosophila germline stem cells: two versions of immortality. Science 316, 402–404, doi:10.1126/science.1140861 (2007).
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Yu, H.-H., Chen, C.-H., Shi, L., Huang, Y. & Lee, T. Twin-spot MARCM to reveal the developmental origin and identity of neurons. Nature neuroscience 12, 947–953 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  45. ↵
    Flaherty, M. S. et al. chinmo is a functional effector of the JAK/STAT pathway that regulates eye development, tumor formation, and stem cell self-renewal in Drosophila. Dev Cell 18, 556–568, doi:10.1016/j.devcel.2010.02.006 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  46. ↵
    Tang, H., Ross, A. & Capel, B. Expression and functional analysis of Gm114, a putative mammalian ortholog of Drosophila bam. Dev Biol 318, 73–81, doi:10.1016/j.ydbio.2008.03.001 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  47. ↵
    Pfeiffer, B. D. et al. Refinement of tools for targeted gene expression in Drosophila. Genetics 186, 735–755 (2010).
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Pfeiffer, B. D., Truman, J. W. & Rubin, G. M. Using translational enhancers to increase transgene expression in Drosophila. Proceedings of the National Academy of Sciences 109, 6626–6631 (2012).
    OpenUrlAbstract/FREE Full Text
  49. ↵
    He, Y. et al. Self-cleaving ribozymes enable the production of guide RNAs from unlimited choices of promoters for CRISPR/Cas9 mediated genome editing. Journal of genetics and genomics = Yi chuan xue bao 44, 469–472, doi:10.1016/j.jgg.2017.08.003 (2017).
    OpenUrlCrossRef
  50. ↵
    Viswanathan, S. et al. High-performance probes for light and electron microscopy. Nat Methods 12, 568–576, doi:10.1038/nmeth.3365 (2015).
    OpenUrlCrossRefPubMed
  51. ↵
    Awasaki, T. et al. The Drosophila trio plays an essential role in patterning of axons by regulating their directional extension. Neuron 26, 119–131 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  52. ↵
    Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359, doi:10.1038/nmeth.1923 (2012).
    OpenUrlCrossRefPubMedWeb of Science
View Abstract
Back to top
PreviousNext
Posted June 25, 2019.
Download PDF
Email

Thank you for your interest in spreading the word about bioRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Enter multiple addresses on separate lines or separate them with commas.
CAMIO for deletion analysis of endogenous DNA sequences in multicellular organisms
(Your Name) has forwarded a page to you from bioRxiv
(Your Name) thought you would like to see this page from the bioRxiv website.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
CAMIO for deletion analysis of endogenous DNA sequences in multicellular organisms
Hui-Min Chen, Jorge Garcia Marques, Ken Sugino, Dingjun Wei, Rosa Linda Miyares, Tzumin Lee
bioRxiv 658088; doi: https://doi.org/10.1101/658088
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
CAMIO for deletion analysis of endogenous DNA sequences in multicellular organisms
Hui-Min Chen, Jorge Garcia Marques, Ken Sugino, Dingjun Wei, Rosa Linda Miyares, Tzumin Lee
bioRxiv 658088; doi: https://doi.org/10.1101/658088

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Subject Area

  • Genomics
Subject Areas
All Articles
  • Animal Behavior and Cognition (2408)
  • Biochemistry (4756)
  • Bioengineering (3294)
  • Bioinformatics (14573)
  • Biophysics (6586)
  • Cancer Biology (5125)
  • Cell Biology (7365)
  • Clinical Trials (138)
  • Developmental Biology (4308)
  • Ecology (6817)
  • Epidemiology (2057)
  • Evolutionary Biology (9836)
  • Genetics (7305)
  • Genomics (9463)
  • Immunology (4502)
  • Microbiology (12580)
  • Molecular Biology (4897)
  • Neuroscience (28074)
  • Paleontology (198)
  • Pathology (796)
  • Pharmacology and Toxicology (1372)
  • Physiology (1993)
  • Plant Biology (4447)
  • Scientific Communication and Education (965)
  • Synthetic Biology (1293)
  • Systems Biology (3889)
  • Zoology (716)