New Results

MALT1 mediates IL-17 Neural Signaling to regulate C. elegans behavior, immunity and longevity

Sean M. Flynn, Changchun Chen, Murat Artan, Stephen Barratt, Alastair Crisp, Geoffrey M. Nelson, Sew-Yeu Peak-Chew, Farida Begum, Mark Skehel, Mario de Bono
doi: https://doi.org/10.1101/658617

Abstract

Besides well-known immune roles, the evolutionarily ancient cytokine interleukin-17 (IL-17) modulates neural circuit function. We investigate how IL-17 signals in neurons, and the extent to which this signaling can alter organismal phenotypes. We combine immunoprecipitation and mass spectrometry to biochemically characterize endogenous signaling complexes that function downstream of IL-17 receptors in C. elegans (Ce) neurons. We identify the Ce ortholog of MALT1 as a critical output of the pathway. MALT1 was not previously implicated in IL-17 signaling or in nervous system function. MALT1 forms a complex with homologs of Act1 and IRAK and functions both as a scaffold for IκB recruitment, and as a protease. MALT1 is expressed broadly in the Ce nervous system, and neuronal IL-17–MALT1 signaling regulates many phenotypes, including escape behavior, associative learning, immunity and longevity. Our data suggest MALT1 has an ancient role modulating neural function downstream of IL-17 to remodel physiological and behavioral state.

Immune signaling pathways regulate the development and function of the nervous system in both health and disease1–3. Many of these effects are mediated by cytokines, small, secreted proteins that can participate in neuroimmune and inter-neuronal communication. For example, low levels of IL-1β and TNFα regulate synaptic and homeostatic plasticity in healthy animals4, 5; pathological levels of proinflammatory cytokines during inflammation can disrupt foetal brain development, alter adult behavior6–9, and drive hyperalgesia and neuroinflammatory diseases10. Progression of neurodegenerative diseases, including Alzheimer’s, Parkinson’s and Amyotrophic lateral sclerosis (ALS), has also been associated with chronic inflammation11, 12.

Recent work shows that the interleukin 17 (IL-17) pro-inflammatory cytokine can modify neural circuit activity. In a rodent model of infection during pregnancy, IL-17 secretion during maternal immune activation drives autism-related behaviors in the pups13. This phenotype is associated with hyperactivity of a specific cortical sub-region that expresses IL-17 receptors (IL-17R)14. In mice, IL-17 has also been shown to lower the activation threshold of nociceptive neurons, and contributes to mechanical hyperalgesia15, 16. In C. elegans (Ce) IL-17Rs are expressed throughout the nervous system, and IL-17 has been shown to act on the RMG hub interneurons, increasing their response to presynaptic input from O2 sensors. The increased circuit gain conferred by IL-17 ensures this animal persistently escapes 21% O2, an aversive cue associated with surface exposure17. Specific sensory responses and behaviors are thus modulated by IL-17 across species, suggesting IL-17 has broad and conserved roles in regulating neuronal properties.

While IL-17 action on the nervous system is well established, its molecular effectors there are poorly understood. The extent to which IL-17 signaling contributes to brain function and physiology is also unclear, even in the well-defined Ce nervous system.

Here, we report that IL-17 signaling in the Ce nervous system is mediated by the paracaspase MALT-1. MALT1 has been studied extensively but almost exclusively in the mammalian immune system. It is a key signaling molecule in innate and adaptive immunity, acting downstream of ITAM- (immunoreceptor tyrosine-based activation domain) containing receptors, including the B-cell and T-cell receptors18–20. It has not been shown to mediate IL-17 signaling, although there has been speculation of such involvement. In situ hybridization suggests widespread expression of MALT1 in mouse brain, (Allen Mouse Brain Atlas, 2004), but no physiological role in neurons has been reported. We show that Ce MALT-1 is expressed throughout the nervous system and forms an in vivo complex with IL-17 signaling components, the Ce homologs of Act1, IRAK and IκBζ/IκBNS. We show that MALT-1 acts both as a protease and a scaffold to regulate neural function. These results represent the first described role for MALT1 signaling in the nervous system in any animal. Defects in IL-17/MALT-1 signaling lead to reconfigured gene expression, and altered behavior and physiology, including enhanced immunity and extended lifespan.

Results

Proteomic analysis of IL-17 signaling identifies an ACTL-1–IRAK–MALT-1– NFKI-1 complex in C. elegans

IL-17 appears to act mostly on the nervous system in Ce17. We studied this signaling using proteomics. We epitope tagged all soluble IL-17 pathway components highlighted by genetics17, immunoprecipitated (IP’d) them from Ce extracts, and identified interacting proteins using mass spectrometry (MS, Fig. 1a).

Figure 1
Figure 1

MALT-1 forms a complex with ACTL-1, PIK-1/IRAK and NFKI-1.

a Schematic for affinity-purification and LC-MS/MS analysis of epitope-tagged IL-17 signaling components from C. elegans extracts.

b-e Pull-down of ACTL-1-FLAG, PIK-1-Myc or NFKI-1::GFP specifically co-IPs MALT-1 (b-d). Conversely, pull-down of MALT-1::GFP specifically co-IPs ACTL-1, PIK-1 and NFKI-1 (E). Bars show total spectral counts, a semiquantitative readout of abundance64, and error bars represent SEM, N=2 (e), N=3 (f). Grey bars show levels of HSP-60, a common contaminant.

f Schematic of IL-17 signaling in O2-escape circuit. Upshifts in [O2] are sensed by URX neurons, which tonically signal to RMG hub interneurons. IL-17 signaling increases the responsiveness of RMG neurons to promote escape from 21% O2.

g malt-1 promotes Ce aggregation (N ≥ 4 assays). ***, P < 0.001, ANOVA with Tukey’s post hoc HSD.

h and i malt-1 mutants are strongly aroused by 21% O2 if stimulated immediately after transfer to the assay plate (h), but respond weakly to 21% O2 if allowed to settle over a 2h period (i), n ≥ 46 animals. Plots show average speed (line) and SEM (shaded regions). Time of assay after transfer is shown at top left. ***, P < 0.001, Mann-Whitney U test (speed). Here and in subsequent figures, black bars indicate time intervals used for statistical comparisons.

See also Supplementary Figures 1-4 and Supplementary Table 1.

ACTL-1 and PIK-1 are Ce orthologs of mammalian Act1 and IRAKs respectively, and signal downstream of the Ce IL-17 co-receptors ILCR-1 and ILCR-217. Genetic analysis suggests NFKI-1, a homolog of mammalian IκBζ and IκBNS, acts downstream of ACTL-1, PIK-1 and the IL-17Rs17.

We tagged endogenous ACTL-1 with a FLAG epitope, endogenous PIK-1 with a Myc epitope, and integrated an nfki-1::gfp transgene. We showed the tagged proteins were functional (Supplementary Fig. 1), and then IP’d them from Ce extracts. As controls, we also IP’d proteins unrelated to IL-17 signaling tagged with the same epitopes. Using mass spectrometry (LC-MS/MS) we then identified specific interactors for each signaling component (Fig. 1b-d and Supplementary Table 1a-c).

As expected from non-physiological co-IP experiments using mammalian tissue culture cells17, PIK-1 co-precipitated specifically with ACTL-1 (Fig. 1b), and reciprocally, ACTL-1 co-precipitated specifically with PIK-1 (Fig. 1c). IP of NFKI-1 also identified ACTL-1 and PIK-1/IRAK as specific interactors, suggesting these proteins form a complex in vivo (Fig. 1d). We identified many other apparently specific interactors for each component. These are listed in Supplementary Table 1 as a resource.

One interactor, the Ce ortholog of the paracaspase MALT1, consistently co-IP’d with each of ACTL-1, PIK-1 and NFKI-1 (Fig. 1b-d). MALT1 paracaspases are cysteine proteases with specificity for arginine residues21, 22. Their caspase-like protease domain is highly conserved, as is their domain organization, consisting of an N-terminal death domain (DD) followed by 2-3 Ig (immunoglobulin)-like motifs that flank the paracaspase domain (Supplementary Fig. 2a)23. Mammalian MALT1 signals downstream of B cell, T cell, and other cell surface receptors containing an ITAM motif, forming a filamentous complex called the CBM signalosome that contains a CARD domain protein, BCL10, and MALT118–20 (Supplementary Fig. 2b). MALT1 functions in the immune system are under intense scrutiny, but its roles elsewhere, and in invertebrates, have not been established.

To confirm these biochemical interactions we expressed functional, GFP-tagged MALT1 pan-neuronally, and identified interacting partners using IP/MS of extracts from the transgenic Ce strain. As a control, we performed IP/MS on extracts from strains expressing GFP-tagged neuronal proteins unrelated to IL-17 signaling. ACTL-1, PIK-1 and NFKI-1 each interacted specifically with MALT-1-GFP (Fig. 1e). We also identified other specific interactors (Supplementary Table 1d) including the Ce ortholog of mammalian SARM1, called TIR-1, which is implicated in the immune response24, 25, left/right asymmetry of an olfactory neuron26, and experience-dependent plasticity27. MALT-1 also interacted specifically with a large group of proteins implicated in RNA metabolism, including splicing factors and polyA binding proteins, suggesting it may localize to the nucleus or ribonucleoprotein particles (RNPs) (Supplementary Fig. 3).

MALT-1 promotes C. elegans aggregation and escape from 21% O2

Previous work has not implicated MALT1 in IL-17 signaling or neural function. In Ce, the IL-17 ILC-17.1 signals through the ILCR-1/ILCR-2 receptors on the RMG interneurons to increase RMG responsiveness to input from their pre-synaptic partner, the URX O2-sensing neurons (Fig. 1f). Increased RMG signaling enables Ce to strongly and persistently escape 21% O2 and to aggregate17, 28, 29. To probe the functional relevance of our proteomics data we asked if the large collection of mutants that yielded IL-17 pathway mutants17 included malt-1 loss-of-function alleles. This collection was isolated in a forward genetic screen for mutants defective in escape from 21% O2 and aggregation behavior. Four strains in the collection harbored malt-1 alleles; one introduced a premature stop codon; another mutated the highly conserved E464 residue (Supplementary Fig. 4a and b), known to be essential for catalytic activity in mammalian MALT130. We mapped the aggregation defect of this strain to an interval containing malt-1 (Supplementary Fig. 4c). Targeted disruption of malt-1 using CRISPR/Cas9 resulted in an aggregation-defective strain whose phenotype could be rescued using a wild-type malt-1 transgene (Fig. 1g; and Supplementary Fig. 4e). These data confirm that MALT-1, like IL-17 signaling, promotes aggregation.

C. elegans aggregate to escape 21% O2, which signals surface exposure31–33. 21% O2 evokes sustained arousal in wild Ce isolates34, and in npr-1 (neuropeptide receptor 1) mutants of the domesticated N2 lab strain35. npr-1 mutants defective in IL-17 signaling are not aroused by 21% O2 in the absence of additional recent mechanosensory stimulation. Moreover, the arousal evoked when such animals are stimulated by 21% O2 shortly after being mechanically disturbed (e.g by being picked) is not sustained17. malt-1 mutants showed this hallmark phenotype (Fig. 1h, i), consistent with MALT-1 playing a role in Ce IL-17 signaling.

MALT-1 modulates responsiveness of RMG interneurons

malt-1::GFP and malt-1::RFP transgenes were expressed broadly in the nervous system (Fig. 2), including in the O2-sensing neurons AQR, PQR and URX (Supplementary Fig. 5a and b) and their post-synaptic partner the RMG interneurons (Fig. 3a). malt-1 phenotypes were rescued by expressing malt-1 cDNA pan-neuronally, confirming that MALT-1 has neuronal functions (Fig. 1g, i). Selectively expressing malt-1 cDNA in the RMG interneurons, or the O2-sensing neurons restored aggregation to malt-1 mutants (Fig. 3b), but only partially rescued the O2-response defects (Fig. 3c). By contrast, we observed almost complete rescue when we expressed MALT-1 simultaneously in both sets of neurons (Fig. 3c; Supplementary Fig. 4e and f). Thus, like IL-17Rs17, MALT-1 functions in RMG and AQR, PQR and URX to promote escape from 21% O2.

Figure 2
Figure 2

MALT-1 is expressed widely in the nervous system.

A transgene expressing C-terminally GFP-tagged MALT-1 from its endogenous promoter (4kb of upstream DNA) is expressed broadly in the nervous system, including many neurons in the head (red box) and tail (blue box).

See also Supplementary Figure 5.

Figure 3
Figure 3

MALT-1 mediates IL-17 signaling in RMG interneurons.

a A MALT-1::mCherry translational fusion, expressed from its endogenous promoter (4kb), is expressed in RMG interneurons. RMG is recognized by its characteristic shape, location, and using a flp-5p::gfp reporter (c, Kim and Li, 2004).

b Expressing malt-1 cDNA from either the flp-5 promoter (RMG, ASG, PVT, I4, M4 and pharyngeal muscle), or the gcy-32 promoter (URX, AQR and PQR) rescues the aggregation defect of malt-1 mutants. N = 4 assays. **, P < 0.01, ***, P < 0.001, ANOVA with Tukey’s post hoc HSD.

c The O2-response defect of malt-1 mutants is partially rescued by expressing malt-1 cDNA from the flp-5 promoter (RMG, ASG, PVT, I4, M4 and pharyngeal muscle), or the gcy-32 promoter (URX, AQR and PQR), and almost completely rescued when malt-1 is expressed from both promoters simultaneously. Lines indicate average speed and shaded regions indicate SEM. n ≥ 46 animals. *, P < 0.05, **, P < 0.01, ***, P < 0.001, Mann-Whitney U test.

d and e Disrupting malt-1 attenuates Ca2+ responses evoked by 21% O2 in RMG (D, n ≥ 25 animals) but not URX (e, n ≥ 13 animals) neurons. The RMG defect can be rescued by expressing malt-1 cDNA in both RMG and URX, using the npr-1 promoter (d). Ca2+ responses are reported by YC2.60 cameleon. *, P < 0.05, ***, P < 0.001, Mann-Whitney U test.

f and g Null mutations in malt-1 and ilc-17.1 do not show additive phenotypes when either RMG Ca2+ transients (f, n ≥ 24 animals) or speed responses evoked by 21% O2 are measured (g, n ≥ 50 animals). *, P < 0.05, **, P < 0.01, Mann-Whitney U test.

h A transgene expressing malt-1 cDNA from the hsp-16.41 promoter does not rescue malt-1 phenotypes in the absence of heat-shock (n ≥ 33 animals).

i Heat-shock-induced cDNA expression in adults restores O2–evoked responses to malt-1 mutants. Plots show average speed (line) and SEM (shaded regions); n ≥ 35 animals. ***, P < 0.001, Mann-Whitney U test.

Ca2+ imaging revealed that O2-evoked Ca2+ responses in RMG were significantly reduced in malt-1 mutants, both in freely moving (Supplementary Fig. 4g) and immobilized animals (Fig. 3d). By contrast, O2-evoked Ca2+ responses in the URX sensory neurons appeared normal in malt-1 mutants (Fig. 3e). These phenotypes recapitulate those observed in IL-17 signaling mutants17. The RMG Ca2+ response defect was rescued by expressing malt-1 cDNA from the npr-1 promoter, which drives expression in RMG and the AQR, PQR and URX neurons (Fig. 3d).

The malt-1 and ilc-17.1 mutant phenotypes were not additive. Both the Ca2+ signaling (Fig. 3f) and behavioral response (Fig. 3g) defects of malt-1; ilc-17.1 double mutants resembled those of single mutants, suggesting MALT-1 and ILC-17.1 function in the same pathway. Similarly, the RMG response defects of malt-1 mutants were not enhanced by defects in PIK-1/IRAK (Supplementary Fig. 4g).

Together, our biochemical, genetic, behavioral and physiological data suggest that the paracaspase MALT-1 mediates IL-17 signaling in neurons, most likely via a signaling complex made up of ACTL-1–IRAK/PIK-1–MALT-1–NFKI-1. To examine if malt-1 is required developmentally, we expressed it selectively in adults using a heat-shock-inducible promoter. Without heat-shock, the phsp-16::malt-1 cDNA transgene did not rescue the O2-response phenotype of malt-1 mutants (Fig. 3h). Heat-shock-induced expression during the 4th larval stage was sufficient to restore behavioral responses (Fig. 3i), suggesting that MALT-1, like other IL-17 signaling components17, can alter circuit properties after the circuits have developed.

MALT-1 functions as a protease in the nervous system

In the mammalian immune system MALT1 functions both as a scaffold and as a protease. To examine if MALT-1 acts as a protease in neurons we mutated the active site cysteine of the endogeneous malt-1 gene to alanine. The equivalent mutation is used in a paracaspase-dead model in mice36–38. malt-1 C374A animals resembled malt-1 null mutants, and could be rescued by pan-neuronal expression of malt-1 cDNA (Fig. 4a; Supplementary Fig. 6a). By contrast, a malt-1 C374A transgene was unable to rescue the phenotype of malt-1(db1194) mutants (Fig. 4b). Unexpectedly, overexpressing malt-1 C374A in a WT background conferred a malt-1(null) phenotype (Fig. 4c), suggesting that catalytically dead MALT-1 can act as a dominant negative. Together these data suggest that MALT-1 signals as a protease in the C. elegans nervous system.

Figure 4
Figure 4

MALT-1 has scaffolding and enzymatic roles in IL-17 signaling.

a-c MALT-1’s function in the nervous system requires its proteolytic activity. (a) malt-1(syb296) mutants that express a catalytically inactive MALT-1 (C374A) show O2 response defects comparable to those of malt-1(null) animals. Pan-neuronal expression of malt-1 cDNA rescues this phenotype (n ≥ 29 animals). ***, P < 0.001, Mann-Whitney U test.

b cDNA encoding a MALT-1 C374A catalytically inactive protein, expressed from the rab-3 promoter, does not rescue the O2 response defects of malt-1 mutants (n ≥ 46 animals). Data corresponding to npr-1 and npr-1; malt-1; rab-3p::malt-1 in b are the same as those shown in Fig. 1i, and were obtained in parallel to the genotypes shown. ***, P < 0.001, Mann-Whitney U test.

c Overexpressing MALT-1 C374A cDNA in npr-1 animals inhibits the arousal response to 21% O2 (n ≥ 53 animals). ***, P < 0.001, Mann-Whitney U test.

d Endogenous ACTL-1 and PIK-1 co-IP with endogenous MALT-1 in npr-1 and npr-1; ilc-17.1 animals. Endogenous NFKI-1 was not detected. Tags were knocked in by CRISPR.

e and f Volcano plot showing quantitative LC-MS/MS of proteins that interact with NFKI-1::GFP in malt-1 and pik-1 mutants compared to wild type. NFKI-1::GFP was purified using GFP-Trap beads, and immunoprecipitated proteins labeled using tandem mass tags (TMT-labelling). The average relative abundance in two biological replicates is shown. Blue lines indicate a significance threshold of P= 0.05 (two sample t-test). The amount of PIK-1 that co-IPs with overexpressed NFKI-1::GFP is significantly reduced in malt-1 mutants (e). The relative amount of MALT-1 that co-IPs with NFKI-1 is not significantly decreased in pik-1 mutants (f).

g and h IPs of His10-tagged Ce ACTL-1-FLAG, MALT-1-HA, and NFKI-1-V5 recombinantly expressed in E. coli show that MALT-1 can directly bind NFKI-1 (g) and ACTL-1 (h).

i Elution profiles of ACTL-1, PIK-1, MALT-1 and NFKI-1 proteins in a C. elegans extract run on a Superose 6 Gel Filtration column and visualized by immunoblot. All four proteins can be found in very high molecular weight complexes.

See also Supplementary Figure 6.

We also asked if IL-17 signaling requires PIK-1/IRAK kinase activity. We created a single copy transgene in which the ATP-binding pocket lysine residue (K217) was mutated to alanine. The K217A transgene rescued pik-1(null) phenotypes (Supplementary Fig. 6b), suggesting that kinase activity is not essential for PIK-1 to regulate behavior.

MALT-1 promotes assembly of IL-17 signaling complexes

To extend our in vivo proteomic analyses we made a strain in which endogenous ACTL-1, PIK-1, MALT-1 and NFKI-1 were each tagged with different epitopes. To corroborate our LC-MS/MS data we first showed that ACTL-1 and PIK-1 specifically co-IP’d with MALT-1 (Fig. 4d). When we IP’d ACTL-1-FLAG and PIK-1-Myc from our knock-in strains we did not detect NFKI-1 by mass spectrometry (Supplementary Table 1a, b). We also failed to detect NFKI-1-V5 by Western blot when we IP’d MALT-1-HA (Fig. 4d) from a multiple knock-in strain. These results suggest the association of NFKI-1 with the complex may be transient or labile under basal conditions, and only detectable when NFKI-1 or MALT-1 is overexpressed (Fig. 1d, e).

To analyse the signaling complex further we carried out IPs from strains overexpressing NFKI-1-GFP. When we quantitatively compared NFKI-1 complexes from WT, malt-1 and pik-1 mutants, using IP/MS, we found that the amount of PIK-1/IRAK co-precipitating with NFKI-1 was reduced when MALT-1 was absent (Fig. 4e). By contrast, in pik-1 mutants the interaction between MALT-1 and NFKI-1 was not significantly reduced (Fig. 4f). These data suggest that NFKI-1 is recruited to signaling complexes by MALT-1.

To ask if MALT-1 and NFKI-1 interact directly, we expressed epitope-tagged versions of the proteins in E. coli, and performed pairwise tests for co-immunoprecipitation. MALT-1-HA IP’d NFKI-1-V5, and conversely NFKI-1-V5 IP’d MALT-1, supporting a direct physical interaction (Fig. 4g). MALT-1 also interacted directly with ACTL-1 (Fig. 4h). These data suggest that MALT-1 provides a bridge between IL-17R associated complexes and NFKI-1.

Sub-cellular localization of IL-17 signaling components

In the mammalian immune system IRAKs and MALT1 are core components of the Myddosome and CBM signalosome, respectively. These complexes are structurally related filamentous oligomers that assemble in the cytosol39, 40. IκB family proteins perform both cytoplasmic and nuclear functions downstream of signalosome assembly41. Fractionation of a Ce lysate by gel filtration revealed that ACTL-1 and PIK-1 exist mostly as high-molecular weight species; they eluted in the heaviest fractions, including the void, of a gel filtration column (Fig. 4i). MALT-1 and NFKI-1 ran mostly as smaller species (∼50-200kDa), but they were also detectable in the heavier ACTL-1- and PIK-1-containing fractions. These observations suggest that a ternary complex, potentially related to the Myddosome and the CBM signalosome but incorporating ACTL-1/PIK-1/MALT-1, may mediate IL-17 signaling in Ce neurons.

To determine the sub-cellular localization of IL-17 signaling components, we separated the nuclear and cytosolic fractions of our lysate. ACTL-1-FLAG, PIK-1-Myc and MALT-1-HA were detected in both cytoplasmic and nuclear fractions (Fig. 5a), while NFKI-1-V5 was predominantly in nuclear fractions (Fig. 5a). It is not clear what function IL-17 signaling proteins serve in the nucleus, however it is notable that NFKI-1 specifically co-IP’d chromatin state modifiers, including CREB binding protein (CBP), a histone acetyltransferase42, suggesting that NFKI-1 regulates transcription (Supplementary Table 1c).

Figure 5
Figure 5

MALT-1 and NFKI-1 provide partially parallel outputs of IL-17 signaling.

a Immunoblot analysis of IL-17 signaling components from nuclear and cytoplasmic fractions of Ce lysate. I,input, C, cytosolic, N, nuclear. NFKI-1 is predominately nuclear; ACTL-1, PIK-1 and MALT-1 are distributed between the nucleus and cytoplasm.

b Overexpressing malt-1 gDNA restores the arousal response to 21% O2 to actl-1 and pik-1 mutants (n ≥ 19 animals).

c and d Overexpressing malt-1 gDNA also rescues the aggregation phenotype (c, N ≥ 6 assays), but not the arousal defect of nfki-1 mutants (d, n ≥ 39 animals).

(e and f) The aggregation phenotype of malt-1 is rescued by overexpressing nfki-1 cDNA (e, N ≥ 4 assays), while speed defects are partially rescued (f, n ≥ 36 animals). ***, P < 0.001, Mann-Whitney U test (speed) or ANOVA with Tukey’s post hoc HSD (aggregation).

MALT-1 and NFKI-1 provide parallel outputs for IL-17 signaling

Overexpressing NFKI-1 suppresses actl-1 and pik-1 null phenotypes, suggesting NFKI-1 functions downstream of those signaling components17. Overexpressing MALT-1 also rescued the O2 arousal defects of actl-1 and pik-1 mutants (Fig. 5b). To test whether MALT-1 functions upstream or downstream of NFKI-1, we asked whether overexpressing either component rescued a null mutant of the other. Overexpressing NFKI-1 in malt-1(null) mutants, or MALT-1 in nfki-1(null) animals, fully rescued the aggregation defect but either did not restore, or only partly restored, the arousal response to 21% O2 (Fig. 5c-f). These data suggest MALT-1 and NFKI-1 provide partially parallel outputs for IL-17 signaling.

Disrupting IL-17 signaling reprograms gene expression

In mammalian tissues IL-17 acts globally to drive pro-inflammatory gene expression43. We defined a transcriptional fingerprint of Ce IL-17 signaling by comparing the whole-animal RNA-seq profiles of ilc-17.1, malt-1 and nfki-1 mutants to that of controls (Supplementary Table 2). Data analysis suggested that pathways implicated in neuropeptide signaling, metabolism, ageing, and immunity were significantly altered by IL-17 signaling (Fig. 6a and b, and Supplementary Table 2).

Figure 6
Figure 6

MALT-1 acts downstream of IL-17 signaling to reprogram behavior and physiology.

a and b Summary of number of genes that are significantly downregulated (a) and upregulated (b) in whole animal RNA-seq profiles of malt-1; npr-1, ilc-17.1; npr-1 and nfki-1; npr-1 mutants compared to npr-1. The gene ontology (GO) terms and KEGG pathways significantly overrepresented among genes dysregulated in all three mutant conditions are shown. All changes shown are statistically significant (q-value < 0.05), with a minimum log2(fold-change) of ±0.25.

c-f Mutants defective in malt-1 and other IL-17 signaling components are resistant to P. aeruginosa PA14. The enhanced survival of malt-1 mutants compared to N2 controls is rescued by pan-neuronal expression of malt-1 gDNA. *, P, < 0.05, **, P, < 0.01, ***, P, < 0.001, logrank test (n=120 animals).

g The enhanced resistance of malt-1 mutants to PA14 requires TIR-1. Like tir-1 mutants, malt-1; tir-1 double mutants are hypersensitive to PA14 infection. ***, P < 0.001, logrank test (n=120 animals).

h and i The lifespan of ilc-17.1 and malt-1 mutants is increased compared to N2 controls. The ilc-17.1 phenotype can be rescued by expressing ilc-17.1 cDNA from its endogenous promoter, and the malt-1 phenotype is rescued by expressing malt-1 gDNA pan-neuronally. **, P < 0.01, ***, P < 0.001, logrank test (n=180 animals).

j and k Salt chemotaxis after conditioning by food-withdrawal in the absence or presence of NaCl. j ilc-17.1, ilcr-1, ilcr-2, pik-1, actl-1, nfki-1 and malt-1 mutants show a NaCl association learning defect: they retain stronger chemotaxis to NaCl after conditioning than wild-type controls. k The salt chemotaxis learning defect of ilcr-1 mutants is rescued by driving ilcr-1 expression in many neurons (rab-3 or flp-21 promoters), or specifically in ASE (flp-6 promoter). For simplicity, only the chemotaxis index of animals previously conditioned with NaCl in the absence of food is shown. For each transgenic strain we compare the behavior of animals bearing the transgene to their non-transgenic siblings. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ANOVA with Tukey’s post hoc HSD, N ≥ 6 assays.

See also Supplementary Figure 7 and Supplementary Tables 2, 3, 4 and 5.

Figure 7
Figure 7

Model.

Activation of nematode IL-17Rs engages ACTL-1, the Ce ACT1-like adaptor, probably via their SEFIR domains. ACTL-1 recruits the Ce IRAK and MALT1 homologs to form the ACT1-IRAK-MALT1 signalosome in the cytoplasm. This serves a scaffolding function to recruit IκBζ/NFKI-1, and modulate its actvity by an unknown mechanism. IκBζ, probably orchestrates changes in the transcriptome of RMG and other cells that result in increased neuronal output by cooperating with other transcriptional regulators in the nucleus,. MALT1-mediated cleavage of unknown substrate(s) positively regulates IκBζ signaling. In parallel to this pathway, MALT-1 forms a complex with TIR-1/SARM1 to promote PMK-1/p38 MAPK activation and drive the expression of immune genes.

To extend our analysis, we compared our dataset to a previous study that identified genes differentially expressed in animals acclimated to 21% and 7% O229. Most of the neuropeptides regulated by IL-17 were not regulated by O2 experience29 (Supplementary Table 3), suggesting IL-17 elicits transcriptional changes not explained by altered activity of the O2-sensing circuit. These data suggested that IL-17 signaling may directly or indirectly alter many features of Ce behavior and global physiology.

Neural IL-17–MALT-1 signaling suppresses immunity and reduces lifespan

To explore immune functions of IL-17 we measured survival on Pseudomonas aeruginosa, a bacterial pathogen that colonizes the intestine of C. elegans44. We carried out these experiments in animals having the N2 version of the npr-1 neuropeptide receptor, npr-1 215V, which inhibits aggregation behavior and escape from 21% O232, 45; this ensures differences in hyperoxia avoidance do not contribute to altered pathogen resistance.

Animals lacking malt-1, or harboring the malt-1 protease-dead allele malt-1(C374A), were resistant to PA14 infection compared to N2 controls (Fig 6c and d). PA14 resistance in malt-1(null) mutants was rescued by pan-neuronal expression of malt-1 cDNA (Fig. 6c), suggesting that MALT-1 acts in the nervous system to regulate the immune response. Like malt-1 mutants, ilcr-1 and nfki-1 mutants survived signficantly longer on PA14 than controls (Fig. 6e, f).

Ce innate immune responses to P. aeruginosa are regulated by both insulin/insulin-like growth factor signaling (IIS) and the p38 MAPK pathway46. The p38 MAPK pathway functions downstream of TIR-1 (Toll/Interleukin-1 Receptor domain protein), the C. elegans ortholog of SARM1 (Sterile alpha and TIR motif containing protein)24, 25. MALT-1 strongly and specifically co-IP’d TIR-1 (Supplementary Table 1d). TIR-1 regulates expression of anti-microbial peptides, including the ShK-like toxin T24B8.5 in the intestine47, 48. Like tir-1 mutants48, malt-1 mutants showed reduced T24B8.5 expression (Supplementary Fig. 7a). This reduction was rescued by intestine-specific or nervous system-specific expression of malt-1 (Supplementary Fig. 7A).

TIR-1 regulates T24B8.5 expression by promoting phosphorylation of the p38 MAPK PMK-125. Like tir-1 mutants, malt-1 mutants showed reduced PMK-1 phosphorylation (Supplementary Fig. 7b). Therefore, mutants defective in IL-17/MALT-1 signaling exhibit PA14 resistance despite having apparently reduced PMK-1 activity. PA14 resistance was, however, greatly reduced in malt-1; tir-1 double mutants compared to malt-1 (Fig. 6g), indicating that TIR-1/SARM can still promote PA14 resistance in malt-1 mutants. Together, these data indicate that while overall IL-17 signaling negatively regulates the Ce immune response to PA14, this effect may reflect the net outcome of opposing influences.

To determine whether IL-17 mutants alter lifespan, as well as pathogen resistance, we measured survival on the standard laboratory food source of C. elegans, E. coli OP50. ilc-17.1 and malt-1 mutants lived significantly longer than N2 controls (Fig. 6h, i). Expression of ilc-17.1 cDNA from its endogenous promoter not only rescued the phenotype of the null mutant, but significantly reduced lifespan compared to non-transgenic N2 controls (Fig. 6h). We could also rescue the extended lifespan of malt-1 mutants by pan-neuronal expression of malt-1 gDNA (Fig. 6i), suggesting that IL-17 signaling acts in the nervous system to regulate longevity.

IL-17 signaling modulates associative learning

The widespread expression of malt-1 and IL-17 pathways genes in the nervous system made us speculate that IL-17 signaling shapes other behaviors. We previously showed that mutants in ilc-17.1, pik-1 and nfki-1 retained normal basal responses to salt and odors17. We wondered, however, if IL-17 signals might alter how experience shapes sensory responses. To test this hypothesis, we used a salt chemotaxis paradigm, in which associating an environment high in NaCl with food withdrawal, leads to decreased salt attraction when animals are subsequently tested in a chemotaxis assay49. All Ce IL-17 mutants tested showed stronger attraction to salt than N2 controls shortly after conditioning (Fig. 6j). We could rescue the ilcr-1 phenotype by selectively expressing cDNA encoding the ILCR-1 receptor in the ASE salt-sensing neurons (flp-6p), but not in the RMG interneurons (flp-5p) or the O2 sensors (gcy-32p) (Fig. 6k). Thus, the IL-17 pathway promotes salt chemotaxis learning, and IL-17 signaling in the nervous system is not restricted to the O2-sensing circuit.

In summary, our data suggest that IL-17 signals through a MALT-1 signalosome to modify neural properties and remodel the behavior and physiology of C. elegans.

Discussion

Our data show that MALT1 modulates neural circuit function in C. elegans, by acting as a protease and a scaffold. MALT-1 forms an ACTL-1-IRAK-MALT-1 signaling complex that mediates IL-17 signaling. The high molecular weight of this complex in Ce extracts suggests it may form a structure related to the MYD88-IRAK4-IRAK2 Myddosome39, 40 and CARMA1-BCL10-MALT1 CBM signalosome (Qiao et al., 2013). MALT-1 directly binds ACTL-1 in vitro, and yeast two hybrid data suggest ACTL-1 directly binds Ce IRAK50. MALT-1 also interacts directly with NFKI-1, a homolog of mammalian IκBζ/IκBNS, and can signal through both NFKI-1-dependent and independent mechanisms to alter neuron function and change behavior. The ACTL-1-IRAK- MALT-1-NFKI-1 pathway is present in most neurons of the C. elegans nervous system, and appears to mediate a major neuromodulatory axis that impacts multiple phenotypes.

IL-17Rs are found throughout metazoa51. We speculate that the ACTL-1-IRAK-MALT-1 complex we have identified is the original and primary mechanism by which IL-17Rs signal in non-amniote animals, from cnidarians to cephalochordates. In amniotes, ACT1 orthologs have lost a death domain (DD) that is present in ACT1 orthologs from other lineages51. DD mediate homotypic interactions in large immune complexes such as the Myddosome52, and are present in both MALT1 and IRAKs. The DD – SEFIR domain architecture of ACT1 present in non-amniotes resembles the DD – TIR domain structure of MYD88, since TIR and SEFIR domains are related53. Interestingly, proximity labelling studies find MALT1 associates with MYD88 in DLBCL cells54. Recent studies have also speculated that mammalian MALT1 is recruited to IL-17 signaling complexes55, 56. Direct evidence for this is lacking, but if correct, this would mirror our results in C. elegans.

One area of future investigation will involve studying how MALT-1 alters neural function. Although we find that MALT-1 protease activity is essential, we have not identified its neural substrate(s). Substrates of mammalian MALT1 with orthologs in C. elegans include the RNA binding proteins roquin-1/2 (RLE-1), which target RNAs for degradation, the endoribonuclease regnase-1 (REGE-1), and the CYLD (CYLD-1) deubiquitinase57–59. We did not detect specific behavioral defects in mutants for these genes (unpublished data). However, our IP/MS data indicate that besides binding NFKI-1, MALT-1 interacts with multiple RNA binding proteins, including splicing and polyadenylation factors. A plausible hypothesis is that in the nervous system, like in the mammalian immune system, MALT-1 can regulate gene expression at the RNA level. MALT-1 also binds the Ce ortholog of SARM1, called TIR-1. TIR-1 regulates Ce gustatory and olfactory plasticity27, and proteostasis60, by modulating MAPK pathways, making it a plausible target for regulation by MALT-1.

The closest mammalian homolog of NFKI-1, IκBζ, is a nuclear-localized protein that acts as a transcriptional regulator, and is rapidly induced by inflammatory stimuli, including IL-17. IκBζ is thought to mediate its effects on gene expression primarily by regulating chromatin structure, although how it is recruited to target genes is not completely understood since it lacks a DNA binding domain61, 62. Our IP/MS data find NFKI-1 physically interacts with the CREB binding protein (CREBBP), cbp-1, which is a histone acetyltransferase, consistent with NFKI-1 acting to modify chromatin structure. While our RNA-seq studies may highlight some genes regulated by NFKI-1, most of the gene expression changes we report likely reflect secondary consequences of signalling defects. Interestingly, the small number of specific MALT-1 interactors we identify by IP/MS includes the nuclear hormone receptors NHR-49 and NHR-71. NHR-49 is the Ce ortholog of hepatocyte nuclear factor 4A/G63.

Our biochemical and genetic analyses of IL-17 signaling in the Ce model have identified functional roles and biochemical interactions previously undescribed in mammals. An outstanding challenge is to examine which of these are conserved in mammals. To name a few examples, does MALT1 play a role in modulating mammalian neural function, given that neurons can express receptors with an ITAM (immunoreceptor tyrosine-based activation motif)18–20, as well as GPCRs, that in immune cells signal through MALT1? Does MALT1 contribute to known neuronal responses to IL-17? Does mammalian MALT1 physically interact with IκBζ, IκBNS, or SARM1? In summary, we have used an invertebrate model system, with the relative simplicity this offers, and its advantages for genetics, biochemistry and single neuron analysis, to probe how key immune molecules signal in neurons to alter circuit function.

Author contributions

S.F., C.C., M.A., S.B. and M.d.B. conceived experiments; S.F., C.C., M.A., and S.B. performed experiments; A.C. and G.N. performed sequence analysis; S-Y C-P and F.B performed mass spectrometry analysis; S.F. and M.d.B. wrote the manuscript.

Competing interests

The authors declare no competing interests.

Methods

Strains and genetics

C. elegans were maintained on nematode growth medium (NGM) at room temperature (22°C) with E. coli OP50 food.

Whole genome sequencing showed that the aggregation-defective AX3621 strain was defective in malt-1. We used SNP mapping66 to investigate if the aggregation defect was linked to malt-1. We crossed AX3621 animals with the AX288 [lon-2(e678) npr-1(ad609)] strain; AX288 was constructed by backcrossing lon-2 npr-1(ad609) X 16x into the CB4856 (Hawaiian) wild strain. The npr-1(ad609) allele confers stronger aggregation than the CB4856 Hawaiian strain routinely used for mapping. We ‘singled’ 40-60 F2 animals, and scored their progeny for aggregation. Animals from non-aggregating F3 lines were pooled, and their DNA extracted and sequenced. Sequencing libraries were made using the Nextera DNA Library kit, and sequenced on a HiSeq 2500 (Illumina) machine with 125bp paired-end reads. Sequencing data was analyzed on using CloudMap66.

Molecular Biology

C. elegans expression constructs were generated using MultiSite Gateway Recombination (Invitrogen). To amplify the malt-1 promoter (4kb) we used primers ggggACAACTTTGTATAGAAAAGTTGctgc cggtggattccaacatattg and ggggACTGCTTTTTTGTACAAACTTGtctgaaattggggttcaagaaatttatttttgatttttaaaata, to amplify the malt-1 ORF (gDNA): ggggACAAGTTTGTACAAAAAAGCAGGCTtttcagaaaaatgaacacaaacttggcggagttc and ggggACCACTTTGTACAAGAAAGCTGGGTActgtagacatttgattcttgtaatcaa aatatgaccaatatc and to amplify malt-1 cDNA: ggggACAAGTTTGTACAAAAAAGCAGGCTtttcagaaaaatgaacacaaacttggcggagttc and ggggACCACTTTGTACAAGAAAGCTGGGTATTACTGTAGACATTTGATTC TTGTAATCAAAATATGACCAATATCAACATTC.

The Q5 Site-Directed Mutagenesis Kit (NEB) was used to create malt-1(C374A) cDNA, with the following primers: TCTTGATGTCgcCAGAAAATTTGTTCCATATG and gcgcgtcaagttgtGCCTGACGACGAGTTGTGCTGTTTTAGAGCTAGAA.

To generate deletions in the malt-1 locus by CRISPR/Cas9 we expressed a gaucagguauccaccguag short guide from the rpr-1 promoter, as described67. The primers used to amplify this sequence for insertion into an EcoRI-cut expression plasmid (addgene #48961) were gcgcgtcaagttgtGgatcaggtatccaccgtagGTTTTAGAGCTAGAA and TTCTAGCTCTAAAACctacggtggatacctgatcCacaacttgacgcgc.

Expression constructs were injected at 50 ng/µl, with the exception of CRISPR-Cas9 mixes that were prepared as previously described67: 30ng ng/µl eft-3::cas9, 100 ng/µl sgRNA, 30ng ng/µl cc::GFP.

The following alleles were generated by SunyBiotech (Fuzhou, China) using CRISPR/Cas9-based genome editing: malt-1(syb296), actl-1(syb412), pik-1(syb378), malt-1(syb573), and nfki-1(syb617). We verified modified sequences using Sanger sequencing (Supplementary Table 6).

Behavioral assays

Behavioral assays were performed at room temperature (22°C). Aggregation was assayed as previously described45. Briefly, 60 young adults were picked onto a plate seeded with 100 µl OP50 48h previously. Animals were left undisturbed for 2h and then scored blind to genotype. The % of animals in groups was calculated, with a group defined as 3 or more animals in contact with one another.

Locomotory responses to O2 stimuli were measured as described previously29, 68 with minor modifications. 15-25 young adults were picked onto a plate seeded with 20 µl OP50 14-18h previously, and covered with a microfluidic PDMS chamber. Defined O2 mixtures (balance nitrogen) were bubbled through H2O and delivered to the PDMS chamber at a rate of 1.4ml/min using a PHD 2000 Infusion syringe pump (Harvard Apparatus). Video recordings were acquired at 2fps with FlyCapture software, using a Point Grey Grasshopper camera mounted on a Leica MZ6 microscope. Speed and reversals were measured using Zentracker custom software (https://github.com/wormtracker/zentracker). To measure phenotypes associated with IL-17 signaling defects, worms were left undisturbed for 2h on assay plates prior to recording.

To measure thrashing, single animals were placed into individual wells containing 50 µl M9 buffer. The number of complete body bends per minute was measured by a scorer who was blind to genotype.

Heat-shock

As reported previously, the hsp-16.41 heat shock promoter is leaky in animals grown at room temperature. We therefore kept animals at 15°C until the time of heatshock (late L4). To induce heat-shock, parafilm-wrapped plates were submerged in a 34°C water bath for 30 min, and then recovered at room temperature until the time of assay.

Light microscopy

Worms were immobilized with 25 mM sodium azide on 2% agarose pads. Z stacks from animals expressing MALT-1::GFP and MALT-1::RFP were acquired on an Inverted Leica SP8 confocal microscope using a 63x/1.20 water objective. Figure panels were obtained using the Z-project (average intensity) function in Image J.

We quantified GFP intensity in L4 animals expressing the agIs219(pT24B8.5::GFP) transgene48 using a Nikon Ti2 microscope with a Niji LED light source (Bluebox Optics, Huntingdon, UK and a NEO scientific CMOS camera (Andor, Belfast, UK), with a 10x objective (Nikon, Tokyo, Japan) and 50 ms exposure time.

Calcium Imaging

Animals expressing cameleon YC2.60 were imaged with a 2x AZ-Plan Fluor objective (Nikon) on a Nikon AZ100 microscope fitted with ORCA-Flash4.0 digital cameras (Hamamatsu). Excitation light was provided from an Intensilight C-HGFI (Nikon), through a 438/24nm filter and an FF458DiO2 dichroic (Semrock). Emission light was split using a TwinCam dual camera adaptor (Cairn Research) and passed through CFP (483/32nm) and YFP (542/27) filters, and a DC/T510LPXRXTUf2 dichroic. We acquired movies using NIS-Elements, with 100 ms exposure time.

To image neural activity in freely moving animals (Supplementary Fig. 4g), single young adults were transferred to peptone-free agar plates spotted with 4 µl of concentrated OP50 food in M9 buffer, and imaged at 2x zoom. For all other figures, 4-8 young adults were transferred to peptone-free agar plates, immobilized on a 2µl patch of concentrated OP50 in M9 buffer using Dermabond adhesive, leaving the nose exposed, and imaged at 4x zoom.

Immunoprecipitation from C. elegans

For co-IP experiments analyzed by LC-MS/MS, C. elegans lysis and affinity purification was performed as previously described69 with minor modification. Lysis buffer A was prepared with 50 mM HEPES (pH 7.4), 1 mM EGTA, 1 mM MgCl2, 100 mM KCl, 10% glycerol, 0.05% NP40, 1mM DTT, 0.1 M PMSF and 1 complete EDTA-free proteinase inhibitor cocktail tablet (Roche Applied Science) per 12 ml. Unsynchronized worms grown in liquid were washed twice in M9 and once in ice-cold lysis buffer A, then snap-frozen by dropwise addition to LN2 in preparation for cryogenic grinding. Worm “popcorn” was pulverized using a Freezer/Mill (SPEX SamplePrep). Crude extract was clarified at 4°C for 10 min at 20,000g, and again for 20 min at 100,000g with a TLA-100 rotor (Beckman Coulter). For IP, roughly equal volumes of sample and control lysate were incubated with 100 µl GFP-Trap MA (ChromoTek gtma), Myc-Trap MA (ChromoTek ytma), or anti-FLAG M2 magnetic beads (Sigma M8823) for 3-4h at 4°C, then washed twice with 50mM HEPES, 100mM KCl. Purified complexes were eluted in SDS-sample buffer at 95°C and fractionated by SDS-PAGE prior to characterization by LC-MS/MS.

For co-IP experiements analysed by Western blot, the following modifications were made. Lysis buffer B contained 50 mM HEPES (pH 7.4), 100 mM KCl, 0.05% NP40, 1 mM DTT, 0.1 M PMSF and 1 complete EDTA-free proteinase inhibitor cocktail tablet (Roche Applied Science) per 12ml. Crude extract was clarifired at 4°C for 30 min at 14,000 rpm. For immunoprecipitation, samples were incubated with anti-HA agarose (Sigma A2095), anti-HA magnetic beads (Cell Signaling #11846), anti-FLAG M2 magnetic beads, or anti-V5 agarose (Sigma A7435) for 3-4h at 4°C, then washed 5x with 50 mM HEPES, 100 mM KCl.

Identification of protein-protein interactions by MS

Gel samples were destained with 50% v/v acetonitrile and 50 mM ammonium bicarbonate, reduced with 10 mM DTT, and alkylated with 55 mM iodoacetamide. Proteins were digested with 6 ng/µl trypsin (Promega, UK) overnight at 37°C, and peptides extracted in 2% v/v formic acid 2% v/v acetonitrile, and analysed by nano-scale capillary LC-MS/MS (Ultimate U3000 HPLC, Thermo Scientific Dionex) at a flow of ∼ 300 nL/min. A C18 Acclaim PepMap100 5 µm, 100 µm × 20 mm nanoViper (Thermo Scientific Dionex), trapped the peptides prior to separation on a C18 Acclaim PepMap100 3 µm, 75 µm × 250 mm nanoViper. Peptides were eluted with an acetonitrile gradient. The analytical column outlet was interfaced via a nano-flow electrospray ionisation source with a linear ion trap mass spectrometer (Orbitrap Velos, Thermo Scientific). Data dependent analysis was performed using a resolution of 30,000 for the full MS spectrum, followed by ten MS/MS spectra in the linear ion trap. MS spectra were collected over a m/z range of 300–2000. MS/MS scans were collected using a threshold energy of 35 for collision-induced dissociation. LC-MS/MS data were searched against the UniProt KB database using Mascot (Matrix Science), with a precursor tolerance of 10 ppm and a fragment ion mass tolerance of 0.8 Da. Two missed enzyme cleavages and variable modifications for oxidised methionine, carbamidomethyl cysteine, pyroglutamic acid, phosphorylated serine, threonine and tyrosine were included. MS/MS data were validated using the Scaffold programme (Proteome Software Inc).

Quantification of NFKI-1 interacting peptides by TMT labeling

On-beads trypsin digestion

Protein samples on beads were reduced with 10 mM DTT at 56°C for 30 min and alkylated with 15 mM iodoacetamide (IAA) in the dark at 22°C for 30 min. Alkylation was quenched by adding DTT and the samples digested with trypsin (Promega, 1.25µg) overnight at 37°C. After digestion, supernatants were transferred to a fresh Eppendorf tube, the beads were extracted once with 80% acetonitrile/ 0.1% TFA and combined with the corresponding supernatant. The peptide mixtures were then partially dried in a Speed Vac and desalted using home-made C18 (3M Empore) stage tip filled with 4 µl of poros R3 (Applied Biosystems) resin. Bound peptides were eluted sequentially with 30%, 50% and 80% acetonitrile in 0.1%TFA and lyophilized.

Tandem mass tag (TMT) labeling

Dried peptide mixtures from each condition were re-suspended in 40µl of 250mM triethyl ammonium bicarbonate. 0.8mg of TMT 6plex reagents (Thermo Fisher Scientific) was re-constituted in 41µl anhydrous MeCN. 20µl of TMT reagent was added to each peptide mixture and incubated for 1 hr at r.t. The labeling reactions were terminated by incubation with 4.4µl of 5% hydroxylamine for 15min. For each condition, the labeled samples were pooled, Speed Vac to remove acetonitrile, desalted and then fractionated with home-made C18stage tip using 10mM ammonium bicarbonate and acetonitrile gradients. Eluted fractions were acidified, partially dried down in speed vac and ready for LC-MSMS.

LC-MSMS

Peptides were separated on an Ultimate 3000 RSLC nano System (Thermo Scientific), using a binary gradient consisting of buffer A (2% MeCN, 0.1% formic acid) and buffer B (80% MeCN, 0.1% formic acid). Eluted peptides were introduced directly via a nanospray ion source into a Q Exactive Plus hybrid quardrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific). The mass spectrometer was operated in standard data dependent mode, performed survey full-scan (MS, m/z = 350-1600) with a resolution of 140000, followed by MS2 acquisitions of the 15 most intense ions with a resolution of 35000 and NCE of 33%. MS target values of 3e6 and MS2 target values of 1e5 were used. Dynamic exclusion was enabled for 40s.

Data analysis – MaxQuant

The acquired MSMS raw files were processed using MaxQuant (Cox and Mann) with the integrated Andromeda search engine (v.1.5.5.1). MSMS spectra were searched against the Caenorhabditis elegans UniProt Fasta database (July 2017). Carbamidomethylation of cysteines was set as fixed modification, while methionine oxidation and N-terminal acetylation (protein) were set as variable modifications. Protein quantification required 1 (unique+ razor) peptide. Other parameters in MaxQuant were set to default values. MaxQuant output file, proteinGroups.txt was then processed with Perseus software (v 1.5.5.0). After uploading the matrix, the data was filtered, to remove identifications from reverse database, modified peptide only, and common contaminants. Each peptide channel was normalized to the median and log2 transformed.

Sub-cellular fractionation

Nuclear/cytoplasmic fractionation was perfomed as described previously70. Briefly, young adult worms were washed 3-5 times in M9, and twice in hypotonic buffer (15mM HEPES, 10mM KCl, 5mM MgCl2, 0.1mM EDTA, 350mM sucrose). Lysis was on ice in complete hypotonic buffer plus 1mM DTT and 1 complete EDTA-free proteinase inhibitor cocktail tablet (Roche Applied Science) per 12ml, using a motorized pellet pestle (Sigma Z359971, Z359947) until most worm carcases were homogenized. Worm debris was pelleted at 500g (2 × 5min), and 5% of the resultant supernatant was kept as the input fraction. Nuclei were pelleted at 4,000g (5 min), and the resulting supernatant centrifuged again at 17,000g and kept as the cytoplasmic fraction. Nuclear pellets were washed twice in complete hypotonic buffer and dissolved in complete hypertonic buffer (15mM HEPES, 400mM KCl, 5mM MgCl2, 0.1mM EDTA, 0.1% Tween 20, 10% glycerol, 1mM DTT, complete EDTA-free proteinase inhibitor as above).

Size-exclusion chromatography

C. elegans lysate was prepared as described above for LC-MS/MS, and loaded onto a Superose 6 Increase 10/300 GL column. The column was equilibrated with Lysis buffer A and 1ml fractions were collected.

Immunoblotting

After SDS-PAGE using Bolt 4-12% Bis-Tris Plus gels (ThermoFisher Scientific), protein was transferred to PVDF membrane (0.45-micron pore size, ThermoFisher Scientific) using the XCell II Blot Module (ThermoFisher Scientific). Membranes were blocked with 5% milk for 1h, then incubated with primary antibody overnight at 4°C, followed by secondary antibody for 1h at RT. Unbound antibody was washed away with PBST (3 × 5min), and SuperSignal West Pico PLUS Cemiluminescent Substrate (ThermoFisher Scientific) used for detection. The following commercially available antibodies were used: anti-FLAG M2-Peroxidase (Sigma A8592), anti-Myc (Cell Signaling #2276), anti-HA (Cell Signaling #3956), anti-V5 (Bethyl Laboratories A190-120A), anti-phospho-p38 MAPK (Cell Signaling #4511), anti-Histone H3 (Cell Signaling #9715), anti-alpha tubulin (abcam ab40742). phospho-PMK-1 western blot assays were performed as described in71.

RNA-seq

RNA preparation

10 Gravid adults were left to lay eggs for 2h on an OP50 lawn seeded 24h previously, before being picked away. 8-10 plates were used per replicate, and all genetics backgrounds were prepared in parallel. Once animals reached late L4 stage, they were washed twice in M9 and frozen in LN2. 1ml Qiazol Lysis Regaent (Qiagen) and 300-400µl 0.7mm Zirconia beads (BioSpec) were added to worm pellets in preparation for mechanical disruption. Samples were disrupted with a TissueLyser (Qiagen), using 1min at maximum power followed by 1min on ice (repeated 4 times). RNA was extracted using the RNeasy Plus Universal Mini Kit (Qiagen), following the manufacturer’s instructions with the exception that 1-Bromo-3-chloropropane (Sigma, B673) was used instead of chloroform.

Library preparation, sequencing and analysis

Libraries were prepared using the TruSeq Stranded mRNA kit (Illumina) with polyA capture for mRNA, and sequenced on a HiSeq 4000 platform (Illumina) with 50 bp single-end reads. We sequenced five independent biological replicates for npr-1 ilc-17.1, and six for npr-1, malt-1; npr-1, and npr-1 nfki-1. Reads were aligned to the C. elegans genome using TopHat v2.1.0, and expression quantified using Cufflinks v2.2.1. For statistical comparisons a q- value <0.05 was considered significant. Only genes for which the FPKM (Fragments Per Kilobase of transcript per Million mapped reads) was ≥ 1 in npr-1, and for which the log2(fold change) between conditions was ≥0.25 were included in Fig. 6. Genes whose expression oscillates during development72 were excluded.

GO enrichment

GO terms for these genes were retrieved and GO enrichment calculated using g:Profiler (version e94_eg41_p11_592d91765). Terms with multiple testing corrected p-values < 0.05 were considered enriched.

Associative learning assay

Chemotaxis assays were performed as previously described73 with minor modification. To establish salt gradients 100mM NaCl agar plugs were left overnight on assay plates containing 1mM CaCl2, 1mM MgSO4, 25mM K2HPO4 pH 6. Plugs were removed immediately before the assay, and replaced with 1µl 1M NaN3. Another 1µl NaN3 was added equidistant from the starting point as a control. The chemotaxis index was calculated as (A – B)/N, where A was the number of animals within 1 cm of the peak of the salt gradient, B was the number of animals within 1 cm of the control spot, and N was the number of all animals. Conditioning was performed as described previously49. Briefly, synchronized young adults raised on OP50 were washed three times in CTX buffer (5 mM K2HPO4 pH 6, 1 mM CaCl2 and 1 mM MgSO4), then left for 4h on NGM agar with no NaCl (mock) or 300mM NaCl (conditioned).

P. aeruginosa killing assays

Slow killing assays were performed as described71 with 10µM 5-fluorodeoxyuridine (FUdR). Synchronized L4s raised on OP50 were added to 0.35% peptone NGM plates, seeded the day before with PA14. Animals were scored every 12h, and counted as dead if they did not respond to prodding. Logrank tests with Bonferroni correction were performed using OASIS (On- line Application for Survival Analysis, http://sbi.postech.ac.kr/oasis74).

Lifespan analyses

Life span was measured as described75, starting at day 1 of adulthood. Scoring and statistical analyses were performed as described above for P. aeruginosa killing assays.

Statistics

Statistical tests and n values used for experiments in this paper are indicated in the corresponding figure legend or methods section. For salt chemotaxis and aggregation behavior, statistical significance between groups was determined using one-way ANOVA with Tukey’s post hoc HSD. Differences in locomotory response and FRET levels (yellow cameleon) were evaluated by Mann-Whitney U test. Logrank tests with Bonferroni correction were used to compare genotypes in lifespan and PA14 survival assays.

Acknowledgements

We thank the Caenorhabditis Genetics Center (funded by National Institutes of Health Infrastructure Program P40 OD010440) and the Japanese knockout consortium for strains, the Cambridge Research Institute Genomics Core for whole genome sequencing, Adeline Colussi and Harvey McMahon for reagents, and de Bono lab members for comments on the manuscript. This work was supported by the Medical Research Council UK, the European Research Council (Advanced Grant 269058 to M.d.B), and Wellcome (209504/Z/17/Z Investigator Award to M.d.B.).

References

  1. 1.↵
    Boulanger, L. M. Immune Proteins in Brain Development and Synaptic Plasticity. Neuron 64, 93–109 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.
    Deverman, B. E. & Patterson, P. H. Cytokines and CNS Development. Neuron 64, 61–78 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    Stephan, A. H., Barres, B. A. & Stevens, B. The Complement System: An Unexpected Role in Synaptic Pruning During Development and Disease. Annu. Rev. Neurosci. 35, 369–389 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  4. 4.↵
    Goshen, I. et al. A dual role for interleukin-1 in hippocampal-dependent memory processes. Psychoneuroendocrinology 32, 1106–1115 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Stellwagen, D. & Malenka, R. C. Synaptic scaling mediated by glial TNF-α. Nature 440, 1054–1059 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  6. 6.↵
    Estes, M. L. & McAllister, A. K. Immune mediators in the brain and peripheral tissues in autism spectrum disorder. Nat Rev Neurosci 16, 469–486 (2015).
    OpenUrlCrossRefPubMed
  7. 7.
    Iori, V., Frigerio, F. & Vezzani, A. ScienceDirect Modulation of neuronal excitability by immune mediators in epilepsy. Current Opinion in Pharmacology 26, 118–123 (2016).
    OpenUrl
  8. 8.
    Klein, R. S., Garber, C. & Howard, N. Infectious immunity in the central nervous system and brain function. Nat Immunol 18, 132–141 (2017).
    OpenUrlCrossRefPubMed
  9. 9.↵
    Miller, A. H. & Raison, C. L. The role of inflammation in depression: from evolutionary imperative to modern treatment target. Nat Rev Immunol 16, 22–34 (2016).
    OpenUrlCrossRefPubMed
  10. 10.↵
    Pinho-Ribeiro, F. A., Verri, W. A., Jr. & Chiu, I. M. Nociceptor Sensory Neuron–Immune Interactions in Pain and Inflammation. Trends in Immunology 38, 5–19 (2017).
    OpenUrlCrossRef
  11. 11.↵
    Ellwardt, E., Walsh, J. T., Kipnis, J. & Zipp, F. Understanding the Role of T Cells in CNS Homeostasis. Trends in Immunology 37, 154–165 (2016).
    OpenUrlCrossRefPubMed
  12. 12.↵
    Schwartz, M. & Deczkowska, A. Neurological Disease as a Failure of Brain–Immune Crosstalk: The Multiple Faces of Neuroinflammation. Trends in Immunology 37, 668–679 (2016).
    OpenUrlCrossRefPubMed
  13. 13.↵
    Choi, G. B. et al. The maternal interleukin-17a pathway in mice promotes autism-like phenotypes in offspring. Science 351, 933–939 (2016).
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    Shin Yim, Y. et al. Reversing behavioural abnormalities in mice exposed to maternal inflammation. Nature 549, 482–487 (2017).
    OpenUrl
  15. 15.↵
    Segond von Banchet, G. et al. Neuronal IL-17 receptor upregulates TRPV4 but not TRPV1 receptors in DRG neurons and mediates mechanical but not thermal hyperalgesia. Molecular and Cellular Neuroscience 52, 152–160 (2013).
    OpenUrlCrossRefPubMed
  16. 16.↵
    Ebbinghaus, M. et al. Interleukin-17A is involved in mechanical hyperalgesia but not in the severity of murine antigen- induced arthritis. Sci. Rep. 7, 10334 (2017).
  17. 17.↵
    Chen, C. et al. IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses. Nature 542, 43–48 (2017).
    OpenUrlCrossRefPubMed
  18. 18.↵
    Jaworski, M. & Thome, M. The paracaspase MALT1: biological function and potential for therapeutic inhibition. Cellular and Molecular Life Sciences 73, 459–473 (2016).
    OpenUrl
  19. 19.
    Ruefli-Brasse, A. A. Regulation of NF- B-Dependent Lymphocyte Activation and Development by Paracaspase. Science 302, 1581–1584 (2003).
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    Ruland, J., Duncan, G. S., Wakeham, A. & Mak, T. W. Differential Requirement for Malt1 in T and B Cell Antigen Receptor Signaling. Immunity 19, 749–758 (2003).
    OpenUrlCrossRefPubMedWeb of Science
  21. 21.↵
    Hachmann, J. et al. Mechanism and specificity of the human paracaspase MALT1. Biochem. J. 443, 287–295 (2012).
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    Uren, A. G. et al. Identification of Paracaspases and Metacaspases: Two Ancient Families of Caspase-like Proteins, One of which Plays a Key Role in MALT Lymphoma. Molecular Cell 6, 961–967 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  23. 23.↵
    Hulpiau, P., Driege, Y., Staal, J. & Beyaert, R. MALT1 is not alone after all: identification of novel paracaspases. Cellular and Molecular Life Sciences 73, 1103–1116 (2015).
    OpenUrl
  24. 24.↵
    Couillault, C. et al. TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARM. Nat Immunol 5, 488–494 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  25. 25.↵
    Liberati, N. T. et al. Requirement for a conserved Toll/interleukin-1 resistance domain protein in the Caenorhabditis elegans immune response. Proc Natl Acad Sci USA 101, 6593–6598 (2004).
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    Chuang, C. F. & Bargmann, C. I. A Toll-interleukin 1 repeat protein at the synapse specifies asymmetric odorant receptor expression via ASK1 MAPKKK signaling. Genes & Development 19, 270–281 (2005).
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    Inoue, A. et al. Forgetting in C. elegans Is Accelerated by Neuronal Communication via the TIR-1/JNK-1 Pathway. Cell Reports 3, 808–819 (2013).
    OpenUrl
  28. 28.↵
    Macosko, E. Z. et al. A hub-and-spoke circuit drives pheromone attraction and social behaviour in C. elegans. Nature 458, 1171–1175 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  29. 29.↵
    Laurent, P. et al. Decoding a neural circuit controlling global animal state in C. elegans. eLife 4, e04241 (2015).
  30. 30.↵
    Cabalzar, K. et al. Monoubiquitination and Activity of the Paracaspase MALT1 Requires Glutamate 549 in the Dimerization Interface. PLoS ONE 8, e72051–1 (2013).
    OpenUrl
  31. 31.↵
    Cheung, B. H. H., Arellano-Carbajal, F., Rybicki, I. & de Bono, M. Soluble Guanylate Cyclases Act in Neurons Exposed to the Body Fluid to Promote C. elegans Aggregation Behavior. Current Biology 14, 1105–1111 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  32. 32.↵
    Cheung, B. H. H., Cohen, M., Rogers, C., Albayram, O. & de Bono, M. Experience-Dependent Modulation of C. elegans Behavior by Ambient Oxygen. Current Biology 15, 905–917 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  33. 33.↵
    Gray, J. M. et al. Oxygen sensation and social feeding mediated by a C. elegans guanylate cyclase homologue. Nature 430, 317–322 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  34. 34.↵
    Persson, A. et al. Natural variation in a neural globin tunes oxygen sensing in wild Caenorhabditis elegans. Nature 458, 1030–1033 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  35. 35.↵
    Rogers, C., Persson, A., Cheung, B. & de Bono, M. Behavioral Motifs and Neural Pathways Coordinating O2 Responses and Aggregation in C. elegans. Current Biology 16, 649–659 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  36. 36.↵
    Jaworski, M. et al. Malt1 protease inactivation efficiently dampens immune responses but causes spontaneous autoimmunity. The EMBO Journal 33, 2765–2781 (2014).
    OpenUrlAbstract/FREE Full Text
  37. 37.
    Gewies, A. et al. Uncoupling Malt1 Threshold Function from Paracaspase Activity Results in Destructive Autoimmune Inflammation. CellReports 9, 1292–1305 (2014).
    OpenUrl
  38. 38.↵
    Bornancin, F. et al. Deficiency of MALT1 Paracaspase Activity Results in Unbalanced Regulatory and Effector T and B Cell Responses Leading to Multiorgan Inflammation. The Journal of Immunology 194, 3723–3734 (2015).
    OpenUrl
  39. 39.↵
    Lin, S.-C., Lo, Y.-C. & Wu, H. Helical assembly in the MyD88–IRAK4–IRAK2 complex in TLR/IL-1R signalling. Nature 465, 885–890 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  40. 40.↵
    Qiao, Q. et al. Structural Architecture of the CARMA1/Bcl10/MALT1 Signalosome: Nucleation-Induced Filamentous Assembly. Molecular Cell 51, 766–779 (2013).
    OpenUrlCrossRefPubMedWeb of Science
  41. 41.↵
    Hayden, M. S. & Ghosh, S. Shared Principles in NF-κB Signaling. Cell 132, 344–362 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  42. 42.↵
    Bannister, A. J. & Kouzarides, T. The CBP co-activator is a histone acetyltransferase. Nature 384, 641–643 (1996).
    OpenUrlCrossRefPubMedWeb of Science
  43. 43.↵
    Amatya, N., Garg, A. V. & Gaffen, S. L. IL-17 Signaling: The Yin and the Yang. Trends in Immunology 38, 310–322 (2017).
    OpenUrl
  44. 44.↵
    Tan, M. W., Mahajan-Miklos, S. & Ausubel, F. M. Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proc Natl Acad Sci USA 96, 715–720 (1999).
    OpenUrlAbstract/FREE Full Text
  45. 45.↵
    de Bono, M. & Bargmann, C. I. Natural Variation in a Neuropeptide Y Receptor Homolog Modifies Social Behavior and Food Response in C. elegans. Cell 94, 679–689 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  46. 46.↵
    Kim, D. H. et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297, 623–626 (2002).
    OpenUrlAbstract/FREE Full Text
  47. 47.↵
    Troemel, E. R. et al. p38 MAPK Regulates Expression of Immune Response Genes and Contributes to Longevity in C. elegans. PLoS Genet 2, e183–1 (2006).
    OpenUrlCrossRefPubMed
  48. 48.↵
    Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J. & Kim, D. H. Tissue-Specific Activities of an Immune Signaling Module Regulate Physiological Responses to Pathogenic and Nutritional Bacteria in C. elegans. Cell Host & Microbe 6, 321–330 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  49. 49.↵
    Saeki, S., Yamamoto, M. & Iino, Y. Plasticity of chemotaxis revealed by paired presentation of a chemoattractant and starvation in the nematode Caenorhabditis elegans. Journal of Experimental Biology 204, 1757–1764 (2001).
    OpenUrlAbstract
  50. 50.↵
    Li, S. et al. A Map of the Interactome Network of the Metazoan C. elegans. Science 303, 540–543 (2004).
    OpenUrlAbstract/FREE Full Text
  51. 51.↵
    Ryzhakov, G., Blazek, K. & Udalova, I. A. Evolution of Vertebrate Immunity: Sequence and Functional Analysis of the SEFIR Domain Family Member Act1. J Mol Evol 72, 521–530 (2011).
    OpenUrlCrossRefPubMed
  52. 52.↵
    Park, H. H. et al. The Death Domain Superfamily in Intracellular Signaling of Apoptosis and Inflammation. Annu. Rev. Immunol. 25, 561–586 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  53. 53.↵
    Novatchkova, M., Leibbrandt, A., Werzowa, J., Neubüser, A. & Eisenhaber, F. The STIR-domain superfamily in signal transduction, development and immunity. Trends in Biochemical Sciences 28, 226–229 (2003).
    OpenUrlCrossRefPubMedWeb of Science
  54. 54.↵
    Phelan, J. D. et al. A multiprotein supercomplex controlling oncogenic signalling in lymphoma. Nature 560, 387–391 (2018).
    OpenUrlCrossRef
  55. 55.↵
    Israël, L. & Bornancin, F. Ways and waves of MALT1 paracaspase activation. Cell Mol Immunol 15, 8–11 (2017).
    OpenUrl
  56. 56.↵
    Israël, L. et al. A CARD10-Dependent Tonic Signalosome Activates MALT1 Paracaspase and Regulates IL-17/TNF-α–Driven Keratinocyte Inflammation. Journal of Investigative Dermatology 138, 2075–2079 (2018).
    OpenUrl
  57. 57.↵
    Jeltsch, K. M. et al. Cleavage of roquin and regnase-1 by the paracaspase MALT1 releases their cooperatively repressed targets to promote TH17 differentiation. Nat Immunol 15, 1079–1089 (2014).
    OpenUrlCrossRefPubMed
  58. 58.
    Uehata, T. et al. Malt1-Induced Cleavage of Regnase-1 in CD4+ Helper T Cells Regulates Immune Activation. Cell 153, 1036–1049 (2013).
    OpenUrlCrossRefPubMedWeb of Science
  59. 59.↵
    Staal, J. et al. T-cell receptor-induced JNK activation requires proteolytic inactivation of CYLD by MALT1. The EMBO Journal 30, 1742–1752 (2011).
    OpenUrlAbstract/FREE Full Text
  60. 60.↵
    Finger, F. et al. Olfaction regulates organismal proteostasis and longevity via microRNA-dependent signaling. Nature Metabolism 1, 350–359 (2019).
    OpenUrl
  61. 61.↵
    Yamamoto, M. et al. Regulation of Toll/IL-1-Receptor- Mediated Gene Expression by the Inducible Nuclear Protein IκBζ. Nature 430, 218–222 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  62. 62.↵
    Motoyama, M., Yamazaki, S., Eto-Kimura, A., Takeshige, K. & Muta, T. Positive and Negative Regulation of Nuclear Factor-κB-mediated Transcription by IκB-ζ, an Inducible Nuclear Protein. Journal of Biological Chemistry 280, 7444–7451 (2005).
    OpenUrlAbstract/FREE Full Text
  63. 63.↵
    Van Gilst, M. R., Hadjivassiliou, H., Jolly, A. & Yamamoto, K. R. Nuclear Hormone Receptor NHR-49 Controls Fat Consumption and Fatty Acid Composition in C. elegans. PLoS Biol 3, e53–1 (2005).
    OpenUrlCrossRefPubMed
  64. 64.↵
    Lundgren, D. H., Hwang, S.-I., Wu, L. & Han, D. K. Role of spectral counting in quantitative proteomics. Expert Review of Proteomics 7, 39–53 (2014).
    OpenUrl
  65. 65.↵
    Reimand, J. et al. g:Profiler—a web server for functional interpretation of gene lists (2016 update). Nucleic Acids Research 44, W83–W89 (2016).
    OpenUrlCrossRefPubMed
  66. 66.↵
    Minevich, G., Park, D. S., Blankenberg, D., Poole, R. J. & Hobert, O. CloudMap: A Cloud-Based Pipeline for Analysis of Mutant Genome Sequences. Genetics 192, 1249–1269 (2012).
    OpenUrlAbstract/FREE Full Text
  67. 67.↵
    Chen, C., Fenk, L. A. & de Bono, M. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Research 41, e193–e193 (2013).
    OpenUrlCrossRefPubMed
  68. 68.↵
    Fenk, L. A. & de Bono, M. Environmental CO 2inhibits Caenorhabditis elegansegg-laying by modulating olfactory neurons and evokes widespread changes in neural activity. Proc Natl Acad Sci USA 112, E3525–E3534 (2015).
    OpenUrlAbstract/FREE Full Text
  69. 69.↵
    Zanin, E. et al. in Caenorhabditis elegans: Molecular Genetics and Development 106, 289–322 (Elsevier, 2011).
    OpenUrl
  70. 70.↵
    Mata-Cabana, A., Sin, O., Seinstra, R. & Nollen, E. Nuclear/Cytoplasmic Fractionation of Proteins from Caenorhabditis elegans. BIO-PROTOCOL 8, 1–15 (2018).
    OpenUrl
  71. 71.↵
    Jeong, D.-E. et al. Mitochondrial chaperone HSP-60 regulates anti-bacterial immunity via p38 MAP kinase signaling. The EMBO Journal 36, 1046–1065 (2017).
    OpenUrlAbstract/FREE Full Text
  72. 72.↵
    Hendriks, G.-J., Gaidatzis, D., Aeschimann, F. & Großhans, H. Extensive Oscillatory Gene Expression during C. elegans Larval Development. Molecular Cell 53, 380–392 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  73. 73.↵
    Bargmann, C. I., Hartwieg, E. & Horvitz, H. R. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74, 515–527 (1993).
    OpenUrlCrossRefPubMedWeb of Science
  74. 74.↵
    Yang, J.-S. et al. OASIS: Online Application for the Survival Analysis of Lifespan Assays Performed in Aging Research. PLoS ONE 6, e23525–1 (2011).
    OpenUrlCrossRefPubMed
  75. 75.↵
    Artan, M. et al. Food-derived sensory cues modulate longevity via distinct neuroendocrine insulin-like peptides. Genes & Development 30, 1047–1057 (2016).
    OpenUrlAbstract/FREE Full Text
Back to top
Posted June 03, 2019.
Download PDF
Email
MALT1 mediates IL-17 Neural Signaling to regulate C. elegans behavior, immunity and longevity
Sean M. Flynn, Changchun Chen, Murat Artan, Stephen Barratt, Alastair Crisp, Geoffrey M. Nelson, Sew-Yeu Peak-Chew, Farida Begum, Mark Skehel, Mario de Bono
bioRxiv 658617; doi: https://doi.org/10.1101/658617
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area