New Results

Checkpoint kinase 2 regulates prostate cancer cell growth through physical interactions with the androgen receptor

Huy Q Ta, Natalia Dworak, Melissa L Ivey, Daniel Gioeli
doi: https://doi.org/10.1101/759142

ABSTRACT

We have previously demonstrated that CHK2 is a critical negative regulator of AR transcriptional activity, PCa cell growth, and androgen sensitivity. We have now uncovered that the AR directly interacts with CHK2, and ionizing radiation (IR) increases this interaction, which crests one hour after IR-induced DNA damage. This IR-induced increase in CHK2–AR interactions requires AR phosphorylation on both serine81 and serine308 and CHK2 kinase activity. Kinase-impaired CHK2 variants, including the K373E variant associated with 4.2% of PCa, blocked IR-induced CHK2–AR interactions. The destabilization of CHK2-AR interactions induced by the CHK2 variants impairs CHK2 function as a negative regulator of cell growth. CHK2 depletion in LNCaP cells increases transcription of DNAPK and RAD54 and increases clonogenic survival. The data support a model where CHK2 sequesters the AR through direct binding which in turn decreases AR transcription and leads to suppression of PCa cell growth.

INTRODUCTION

Mammalian cells are continuously being bombarded by endogenous and exogenous forces that jeopardize the integrity of DNA. In response to DNA damage, a conserved network of signaling pathways known as the DNA damage response (DDR) is activated to maintain cell viability and genome stability [1]. Prostate cancer (PCa) remains one of the leading causes of death among men of all races (cdc.gov), as castration-resistant prostate cancer (CRPC) is currently incurable. Recently, the DDR has been a focus of PCa research since the androgen receptor (AR), a major driver of PCa, modulates the transcription of DDR genes [2] and DNA repair [3]. We have previously shown that checkpoint kinase 2 (CHK2) negatively regulates androgen sensitivity and PCa cell growth [4].

CHK2 is a serine/threonine protein kinase that plays a crucial role in sensing DNA damage and initiating the DDR, comprising of cell cycle arrest, DNA repair, and apoptosis [5]. CHK2 consists of an amino-terminal SQ/TQ cluster domain (SCD) where threonine 68 serves as a substrate for phosphorylation by ataxia-telangectasia mutated (ATM) kinase [6]; a carboxy-terminal kinase domain (KD) and nuclear localization sequence [7]; and a central forkhead-associated domain (FHA) that provides an interface for interactions with phosphorylated proteins [8]. Currently, there are approximately 24 CHK2 substrates in human cells that have been experimentally validated, including polo-like kinase 1 (PLK1), promyelocytic leukemia protein (PML), E2F1, p53, and cell division cycle 25C (CDC25C) [9]. These studies show that one mechanism CHK2 utilizes to affect cellular function is through direct protein-protein interactions.

For example, the association of CHK2 with PLK1 leads to its localization at centrosomes where it regulates mitotic entry [10]. CHK2 autophosphorylation and activation are regulated by the tumor suppressor PML within PML-nuclear bodies, which are nuclear matrix-associated structures [11]. Binding to PML keeps CHK2 in an inactive state within these PML-nuclear bodies. In return, activated CHK2 can phosphorylate PML on S117 and induce PML-mediated apoptosis. CHK2 can also modify the transcription of apoptotic genes through binding and S364 phosphorylation of the E2F1 transcription factor in response to DNA damage, which stabilizes E2F1 and activates gene transcription [12]. Another way that CHK2 regulates apoptosis is through p53 phosphorylation, resulting in the promotion of p53-mediated cell death [13]. The interaction with the core domain of p53 induces an allosteric change in CHK2 which permits p53 S20 phosphorylation [14]. Moreover, CHK2 modulates CDC25C localization by associating with and phosphorylating CDC25 on S216, which creates a binding site for 14-3-3 proteins [15]. 14-3-3 proteins in turn sequester CDC25C in the cytoplasm and block the G2/M transition since cyclin dependent kinase 1 (CDK1) cannot be activated. Finally, our group has shown that CHK2 co-immunoprecipitated with AR in PCa cells and regulated growth, suggesting that AR may be a novel substrate of CHK2 [4]. Thus, given the importance of CHK2 and AR to the DDR and prostate cancer, a full understanding of the functional consequences of the CHK2–AR interaction is required, with the hope of possible clinical applications towards CRPC.

Here, we uncovered novel molecular interactions between CHK2 and AR that provide mechanistic insight into our observation that CHK2 negatively regulates prostate cancer growth. We demonstrate that AR directly binds CHK2, and that this interaction increases with ionizing radiation (IR) peaking one hour following exposure. The IR-induced increase in CHK2–AR interaction requires AR phosphorylation on both serine 81 and serine 308. The binding of CHK2 with AR is disrupted with CHK2 kinase inhibitors, suggesting that the kinase activity of CHK2 is required for the IR-induced CHK2–AR interaction. This was verified using kinase-impaired CHK2 variants, including the K373E variant associated with 4.2% of PCa. Furthermore, these CHK2 variants exhibit diminished effect on prostate cancer cell growth. Interestingly, CHK2 depletion in LNCaP cells increase transcription of DNAPK and RAD54, as well as clonogenic survival, following IR while decreasing radiation-induced DNA damage repair.

RESULTS

CHK2 directly binds AR

We previously showed that AR coimmunoprecipitated with CHK2 immune complexes in several prostate cancer cell lines [4]. To determine whether this co-association was through direct protein-protein interaction, we performed far western blotting. To generate purified protein for the far westerns, 293T cells were transfected with mammalian plasmids expressing Flag-wtAR, Flag-ERK2, or V5-wtCHK2 (Fig. 1A). We used Flag-ERK2 as a positive control since it has been reported that CHK2 physically associated with ERK1/2 in cancer cells [16]. Flag-ERK and Flag-wtAR targets were immunoaffinity purified and resolved by SDS-PAGE. The target proteins (AR and ERK) on the membrane were probed with purified V5-wtCHK2 protein, crosslinked, and stained with V5 antibodies to detect bound V5-wtCHK2. Membranes were also immunoblotted with AR and ERK1/2 antibodies to confirm that the molecular weight of AR and ERK1/2 corresponded with the CHK2 signal, which then indicates direct protein-protein interaction. We found that V5-wtCHK2 bound to Flag-wtAR, as well as the control Flag-ERK2. Moreover, we observed similar results when we performed the converse experiment and observed that the HA-wtAR probe directly associated with the target protein Flag-wtCHK2 (Fig. 1B). These data indicate that the interaction of AR with CHK2 is authentic and direct.

Figure 1.
Figure 1. CHK2 directly binds AR.

293T cells were transfected with Vector, Flag-wtAR, Flag-wtCHK2, Flag-ERK2, HA-wtAR, or V5-wtCHK2 using Fugene 6. 48hrs following transfection, Flag, HA, and V5 were immunoprecipitated, and far western blotting was performed. Membranes were blotted with the following antibodies: Flag, HA, V5, AR, CHK2, and ERK2. Blots were visualized using the Odyssey CLx. (A) Probe = V5-wild-type CHK2; Targets = Flag-wtAR and Flag-ERK2. Representative blots are shown, n=3. (B) Probe = HA-wtAR; Targets = Flag-wtCHK2. Representative blots are shown, n=3.

Radiation increases CHK2-AR association

Since IR is a standard of care for patients with localized advanced prostate cancer and CHK2 is a known mediator of the DDR, we wanted to assess the impact of IR on CHK2–AR interactions. To examine the effect of radiation on the binding of AR to CHK2, hormone-sensitive LNCaP and castration-resistant Rv1 cells were exposed to 6Gy IR, which is representative of the fractionated dose of IR prostate cancer patients receive [17]. CHK2 immune complexes were generated one hour following radiation. The AR signal was quantified and normalized to total CHK2 protein (Fig. 2). IR significantly increased endogenous CHK2-AR immune complexes by 2-fold and 1.8-fold in LNCaP (Fig. 2A) and Rv1 (Fig. 2B) cells, respectively. Rv1 cells also express AR variant 7 (ARV7), which is a truncated isoform of AR that lacks the ligand binding domain (LBD) [18]. Interestingly, endogenous ARV7 also bound endogenous CHK2, and IR induced a similar increase in CHK2 – ARV7 complexes as that observed with full length AR. Thus, these results suggest that IR drives CHK2 to bind both full length and variant AR.

Figure 2.
Figure 2. Radiation transiently increases CHK2-AR association.

CHK2 immune complexes were generated one hour following radiation (6Gy) from 1mg cell extract from (A) LNCaP and (B) Rv1 cells grown in serum-supplemented media, separated by 7.5% SDS-PAGE, and immunoblotted with AR, CHK2, and ERK1/2 antibodies. Plotted is the AR or AR-V7 signal normalized to total CHK2, and compared to untreated cells (Rv1). Representative blots are shown for (A) LNCaP (n=4, p<0.003) and (B) Rv1 cells (n=3, p<0.02). (C,D) LNCaP and C4-2 cells were seeded in serum-supplemented growth media and allowed to adhere for 48hrs. Cells were exposed to 6Gy IR and CHK2 immune complexes were immunoprecipitated using a magnetic bead system 0-24hrs after radiation from 1mg cell extracts, separated by 7.5% SDS-PAGE, and blotted with AR, CHK2, pCHK2 T68, and ERK1/2 antibodies. (C) Representative blots are shown, n=3. (D) Plotted is the AR signal normalized to total CHK2 and compared to untreated cells, p<0.0001. Error bars, SEM. Band signals were quantitated on Odyssey LICOR imaging system. Statistical analysis was performed using ANOVA and Tukey test.

To further characterize the effect of radiation on CHK2-AR associations, we evaluated the kinetics of the increase in CHK2–AR protein complexes in response to IR. CHK2 was immunoprecipitated from irradiated LNCaP and C4-2 cells 1, 4, and 24 hours following IR exposure (Fig. 2C). We found that AR was maximally bound to CHK2 one hour after radiation treatment in both cell lines. This interaction was dramatically reduced to near baseline levels by 4hrs, and returned to baseline levels 24hrs after IR. Interestingly, we noticed that the temporal protein binding of CHK2 to AR paralleled the activation state of CHK2, as represented by CHK2 phosphorylation on threonine 68 (Fig. 2C) [Matsuoka, 1998]. Thus, these data show that the CHK2–AR protein complexes are transient, cresting one hour following IR. Furthermore, these observations suggest that the interaction between CHK2 and AR may be regulated by the activation state of CHK2.

AR phosphorylation regulates CHK2–AR interaction

The phosphorylation of AR on serine 81 (S81) by CDK1 and CDK9 stimulates AR transcriptional activity and growth of PCa cells [19]–[21]. Whereas, AR phosphorylation on serine 308 (S308) represses transcription and proliferation and alters AR localization during mitosis [22], [23]. To address whether S81 or S308 phosphorylation influences CHK2–AR complexes, LNCaP cells were transduced with lentiviral particles containing wtAR or AR mutants S81A or S308A (Fig. 3A). The association of AR was analyzed from endogenous CHK2 immune complexes generated one hour after irradiation. There was a 4-fold increase in AR co-immunoprecipitating with CHK2 after IR treatment of cells expressing wtAR. However, neither S81A nor S308A increased in association with CHK2 upon IR treatment indicating that phosphorylation of AR on S81 and S308 are required for the IR-induced increase in the interaction between CHK2 and AR.

Figure 3.
Figure 3. AR phosphorylation and CHK kinase activity regulates CHK2-AR association.

(A) CHK2-AR interactions requires AR phosphorylation on serines 81 and 308. LNCaP cells were transduced with lentiviral particles expressing wtAR, S81A, or S308 for 48hrs. Cells were irradiated with 6Gy, and CHK2 was immunoprecipitated one hour after IR. Representative blots are shown. Plotted is the AR signal normalized to total CHK2 and compared to untreated cells, n=3, p<0.009. Error bars, SEM. Blots were quantitated on Odyssey LICOR imaging system. Statistical analysis was performed using ANOVA and Tukey test. (B) Expression of CHK2 variants with reduced kinase activity inhibits the radiation-induced increase in CHK2-AR interactions. LNCaP cells were transfected with HA-wtAR, HA-S81A, or HA-S308 in combination with Flag-wtCHK2 for 48hrs using TransIT-2020 (Mirus). Cells were irradiated with 6Gy, and Flag was immunoprecipitated using a magnetic bead system one hour after IR. Representative blots are shown. Plotted is the HA-AR signal normalized to total Flag-CHK2 and compared to untreated cells. Error bars, SEM. Blots were quantitated on Odyssey LICOR imaging system. Statistical analysis was performed using ANOVA and Tukey test, n=3, p<0.02.

The requirement for irradiation of AR expressing target cells and AR phosphorylation for the IR-induced increase in CHK2–AR association led us to test if AR phosphorylation on S81 and S308 were increased in response to IR. AR was immunoprecipitated from irradiated cells, and phospho-S81 and phospho-S308 were measured by western blotting using phospho-specific antibodies to those sites [20], [24] (Supplemental Figure 1). There were no significant consistent changes in S81 or S308 phosphorylation in response to radiation in either cell line. Thus, these findings indicate that while the intensity of S81 and S308 phosphorylation does not markedly change with IR, S81 and S308 phosphorylation is required for CHK2–AR interactions.

Supplemental Figure 1.
Supplemental Figure 1. AR S81 and S308 phosphorylation are not altered with radiation.

LNCaP and C4-2 cells were seeded in serum-supplemented growth media for 48hrs, exposed to 6Gy IR, and AR was immunoprecipitated using a magnetic bead system 1hr after radiation from 1mg cell extracts. Proteins were separated by 7.5% SDS-PAGE, and blotted with AR, pAR S81, pAR S308, CHK2, and ERK1/2. Representative blots are shown. Plotted is the pAR signal normalized to total AR and compared to untreated cells, n=3, no statistical difference between the groups by ANOVA. Blots were quantitated on Odyssey LICOR imaging system.

CHK2 kinase activity is required for CHK2–AR interaction

To determine if CHK2 kinase activity was necessary for the CHK2–AR association, we tested if CHK2 mutants that are found in PCa and have impaired kinase activity could interact with the AR, and if that interaction increased with IR. We expressed Flag-wtCHK2, Flag-K373E, or Flag-T387N in combination with HA-wtAR in LNCaP cells. The K373E CHK2 mutation impairs CHK2 function suppressing cell growth and promoting survival in response to IR, as a result of reduced kinase activity due to the disruption of CHK2 autophosphorylation [25]. Less is known about the heterozygous missense mutation T387N, but it is reported to diminish kinase activity, and thus, CHK2 function [26]. Flag-CHK2 immunoprecipitations were performed and HA-AR association was evaluated (Fig. 3B). In response to IR there was a striking increase in CHK2–AR co-association in cells expressing Flag-wtCHK2 and HA-wtAR. However, the amount of IR-induced increase in CHK2–AR association in cells expressing either K373E or T387N was dramatically reduced. Therefore, these data indicate that the kinase activity of CHK2 is required for the interactions of CHK2 and AR, and that the CHK2 mutant associated with PCa, T387N, has a diminished ability to interact with the AR.

IR increases direct CHK2–AR binding

To both confirm that IR induces the increase of CHK2–AR protein complexes and determine if the increase is due to direct protein-protein interaction, we carried out far western blotting where target (Flag-wtAR and Flag-ERK2) or probe proteins (V5-wtCHK2) were isolated from cells either irradiated with 6Gy 48hrs following transient transfection, and purified one hour after radiation exposure, or kept untreated prior to immunoaffinity purification of target and probe proteins. When the cells expressing the V5-wtCHK2 probe and Flag-wtAR target were irradiated there was a 2-fold increase in V5-wtCHK2 binding to the target Flag-wtAR in response to IR (Fig. 4A). However, when the V5-wtCHK2 probe was not treated with IR, no increase in probe binding to target was observed (Fig. 4B). Together, these data indicate that radiation of cells expressing the V5-wtCHK2 probe is required for the increased CHK2–AR interaction that occurs in response to IR. Since IR increases the activity state of CHK2 as measured by phosphorylation of CHK2, this result supports the above data indicating that CHK2 kinase activity is required for the IR induced CHK2–AR association.

Figure 4.
Figure 4. Radiation increases direct CHK2-AR binding.

(A) Radiation increases direct binding of AR and CHK2. Probe = V5-wtCHK2 + IR; Targets = Flag-wtAR and Flag-ERK2-/+ IR. Representative blots are shown, n=3, p=0.004. (B) Radiation of both CHK2 and AR is required for the increase in direct association. Probe = V5-wtCHK2 - IR; Targets = Flag-wtAR and Flag-ERK2 −/+ IR. Representative blots are shown, n=3. Quantitation was performed on Odyssey LICOR imaging system. Error bars represent standard error of the mean (SEM). Statistical analysis was performed using ANOVA and Tukey test.

AR and CHK2 activity required for direct CHK2-AR binding

To determine whether AR activity is required for the increase in CHK2–AR direct binding in response to IR, far westerns were again performed by treating 293T cells expressing Flag-wtAR, Flag-ERK2, or V5-wtCHK2 with 6Gy ionizing radiation in the presence or absence of the anti-androgen Enzalutamide (Fig. 5A). As expected, far western blots revealed that radiation increased purified CHK2 binding to purified AR by 2-fold. The presence of enzalutamide blocked the IR induced increase in CHK2–AR interaction, suggesting that transcriptionally activated AR is required for the IR-induced increase in association of CHK2 and AR. This is consistent with the loss of AR phosphorylation on S81 decreasing the CHK2–AR association.

Figure 5.
Figure 5. AR and CHK2 activity required for direct CHK2-AR binding.

(A) Enzalutamide significantly impairs the association of CHK2 with AR. 293T cells were transfected with Vector, Flag-wtAR, Flag-ERK2, or V5-wtCHK2 using Fugene 6. 48hrs following transfection, cells were irradiated with 6Gy, and Flag and V5 were immunoprecipitated one hour following radiation. Far western blotting was performed. Membrane was blotted with the following antibodies: V5, AR, and ERK2. Representative blots are shown. Plotted is the V5-CHK2 signal normalized to total wtAR or ERK2 and compared to untreated cells, n=3, p<0.02. Error bars, SEM. (B) Inhibition of CHK2 with BML-277 blocks the increase in CHK2-AR interactions. 293T cells were transfected with Vector, Flag-wtAR, Flag-ERK2, or V5-wtCHK2 using Fugene 6. 48hrs following transfection, cells were pre-treated with vehicle or 10μM BML-277 for 1hr, irradiated with 6Gy, and Flag and V5 were immunoprecipitated one hour following radiation. Far western blotting was performed. Membrane was blotted with the following antibodies: V5, AR, and ERK2. Representative blots are shown. Plotted is the V5-wtCHK2 signal normalized to total AR or ERK2 and compared to untreated cells, n=3. Error bars, SEM. No statistical difference was observed between the groups.

CHK2 activity is also required for the direct CHK2–AR binding in response to IR. In parallel to the far western in Fig 5A, we performed far westerns with the cells expressing the V5-CHK2 probe pre-treated with the CHK2 inhibitor BML-277 one hour prior to IR. (Fig. 5B). Remarkably, inhibition of CHK2 kinase activity completely blocked the increase in CHK2–AR interactions that we observed when the probe was irradiated in the absence of BML-277 (Fig. 5A). We also did not detect increased binding to the control target Flag-ERK2. These data confirm the lack of increased CHK2–AR binding when cells the V5-CHK2 probe was isolated from were not irradiated (Fig. 4B). These results, along with the data in Figure 3B, indicate that the direct CHK2–AR protein binding requires CHK2 kinase activity.

PCa CHK2 mutants limit suppression of PCa growth

Since CHK2 regulates the cell cycle and PCa cell growth [4], [14], we investigated the effect of CHK2 PCa mutations, which disrupt the CHK2–AR interaction, on CHK2 regulation of PCa cell growth (Fig. 6). PCa cells were transduced with vector or CHK2 shRNA lentivirus to deplete endogenous CHK2, and then CHK2 expression was rescued with wtCHK2, K373E, or T387N. Cell growth was quantitated in the presence and absence of 0.05nM synthetic androgen R1881 seven days following transduction using CyQUANT, which assesses cell proliferation as a function of DNA content. In agreement with previous reports [4], hormone stimulated growth of vector-expressing cells and knockdown of CHK2 significantly augmented growth in all PCa cell lines tested. Re-expression of wtCHK2, K373E, and T387N in CHK2-depleted cells markedly suppressed the increase in growth induced by CHK2 knockdown in all PCa cell lines tested. Interestingly, in LNCaP cells the extent of growth inhibition induced by K373E and T387N was significantly less than that generated by wtCHK2 (Fig. 6A). The effect of CHK2 re-expression on cell growth in castration-resistant C4-2 (Fig. 6B) and Rv1 (Fig. 6C) cells was not significantly different between wtCHK2 and the kinase deficient K373E and T387N mutants, although the magnitude of inhibition caused by the mutants was consistently less than that produced by wtCHK2. Expression levels of wtCHK2, K373E, and T387N do not account for the difference observed between LNCaP and C4-2 or Rv1 (Fig. 6) since the relative expression of wtCHK2, K373E, and T387N were similar across the cell lines. These observations suggest that CHK2 kinase activity, which is reduced in the PCa mutant K373E, limits the ability of CHK2 to negatively regulate PCa cell growth, especially in androgen dependent PCa. This then raises the possibly that the PCa CHK2 K373E mutant with diminished AR binding is selected for decreasing CHK2 suppression of AR activity and PCa cell growth.

Figure 6.
Figure 6. Wild-type CHK2 negatively regulates prostate cancer cell growth.

(A) LNCaP, (B) C4-2, and (C) Rv-1 cells were transduced with lentiviral particles expressing vector, shCHK2-exon 12, or shCHK2-3’UTR in combination with wtCHK2, K373E, or T387N in the presence or absence of 0.05nM R1881. CyQuant assay was performed 7 days after transduction. Cell growth was compared with untreated vector control and the values were averaged across biological replicates. Error bars, SEM, n=3. Statistical analysis was performed using ANOVA and Tukey test, p<0.01. Representative blots of CHK2 expression are shown.

CHK2 suppresses IR induction of DNAPK and RAD54

Reports in the literature suggest that the AR is a critical regulator of genes in the DDR [2], [3]. Therefore we evaluated the impact of CHK2 knockdown on IR induced transcription of DDR genes in LNCaP cells (Fig. 7). In our experiments, androgen and IR only affected DNAPK and RAD54 transcript levels; we did not observe androgen or IR induction of XRCC2, XRCC3, XRCC4, XRCC5, MRE11, RAD51, FANC1 and BRCA1 transcripts as reported by others (data not shown) [2], [3]. This discrepancy is consistent with the observation that androgen regulation of DDR genes is specific to the model system and disease state examined [27]. Knockdown of CHK2 in LNCaP cells grown in CSS and stimulated with 1nM DHT led to an increase in transcription of DNAPK and RAD54. This increase was further augmented by IR suggesting that CHK2 may suppress AR transcription of DDR genes in response to IR.

Figure 7.
Figure 7. CHK2 knockdown increases the transcription of DDR genes in the presence and absence of radiation.

Transcript levels of DDR genes in LNCaP cells transduced with CHK2 shRNAs and pLKO vector control and grown in CSS supplemented with 1nM DHT were measured by qPCR. 48hrs following transduction, cells were exposed to 2Gy ionizing radiation and RNA was isolated 6 hours later. Transcript levels were normalized to the housekeeping gene, PSMB6, and compared to pLKO. Values were averaged across biological replicates +/− standard error of the mean, n=3. Shown are the histograms for (A) DNAPKc and (B) Rad54B in LNCaP cells. Statistical analysis was performed using one-way ANOVA and Tukey’s test. * p<0.02.

CHK2 effect on IR sensitivity and DNA repair

We next examined the impact of CHK2 interactions on cell survival and sensitivity to IR (Fig. 8A). Increasing doses of IR were delivered to LNCaP cells expressing CHK2 (pLKO) or depleted of CHK2 (CHK2 KD). Cells were seeded and allowed to grow for 14 days. Clonogenic assays revealed that CHK2 knockdown promoted cell survival following ionizing radiation. This data, along with the data above indicating that CHK2 suppresses AR transcription of DNA repair genes suggested the hypothesis that loss of CHK2 could facilitate DNA repair.

Figure 8.
Figure 8. CHK2-depleted cells show increased survival and DNA damage following radiation.

(A) Knockdown of CHK2 desensitizes cells to IR. LNCaP cells were transduced with lentiviral particles expressing pLKO or CHK2 shRNAs for 48hrs, treated with 0-6Gy IR, and seeded at the appropriate cell number for colony survival assays. Results were normalized to untreated pLKO control and fitted to a standard linear quadratic model. Error bars, SEM. Statistical analysis was performed using the Student’s t-test, n=4-8, p<0.01. (B) Representative images of phospho-γH2AX, CHK2, and AR immunostaining quantified in (C). (C) phospho-γH2AX is elevated in cells depleted of CHK2. LNCaP cells were transduced with lentiviral particles expressing empty vector or CHK2 shRNAs on fibronectin-coated coverslips in the appropriate growth media. Cells were irradiated with 5Gy after 48hrs. Coverslips were processed for IF at 0, 15, and 45min following IR. Plotted is the γH2AX signal, which equals the mean grey value intensity x number of foci per nucleus. Statistical analysis was performed using ANOVA and Tukey test, p<0.0001.

To assess the effect of IR-induced DNA damage in the presence or absence of CHK2 knockdown we performed comet assays, which measures DNA breaks [28], and immunofluorescence staining of phospho-γH2AX, a marker for DNA double-strand breaks [29], [30]. Since the majority of IR induced DSBs are repaired rapidly [29], [31] we focused on early timepoints following DNA damage. Neither LNCaP or Rv1 cells showed a change in IR induced comet tail moment following 1 hour of IR (Supplemental Figure 2). In order to quantify phospho-γH2AX foci in an unbiased manner we developed an approach that utilizes automated quantitation of immunofluorescence that enables us to rapidly determine the signal intensity (Supplemental Figure 3). LNCaP cells were transduced with vector or CHK2 shRNA 48hrs before delivery of IR. Radiation induced similar levels of DNA damage 15min after exposure regardless of CHK2 expression (Fig. 8B,C). However, CHK2 knockdown exhibited a significant increase in phospho-γH2AX signal compared to vector control cells 45min after IR. γH2AX is phosphorylated in response to inputs in addition to IR induced DNA double strand breaks including RNA polymerase II dependent transcription [32]–[34]. Thus, the apparent discrepancy in the comet and γH2AX foci assay may be explained by the increase in AR transcription when CHK2 is knocked down as in Figure 7 and in our previous study [4].

Supplemental Figure 2.
Supplemental Figure 2. CHK2 Knockdown does not alter DNA breaks.

LNCaP (A) and Rv1 (B) cells were seeded in whole media for 48 hours, irradiated at the indicated doses at the specified times and processed for comet assays. Show is the percent DNA in the comet tail, comet tail length, and tail moment (% DNA x tail length). n=3 for LNCaP and n=2 for Rv1. At the same irradiation conditions there was no statistical difference between vector control and CHK2 knockdown by ANOVA and Tukey’s multiple comparisons test.

Supplemental Figure 3.
Supplemental Figure 3. Automated quantitation of foci.

Confocal images are captured on a Zeiss LSM 880 at 40x oil using Zeiss Zen digital imaging software and processed into individual TIFF files for each fluorescence channel using ImageJ. An outline of nuclei (mask) from DAPI channel is created and applied to all channels. Macro-enabled image processing to measure multiple fluorescence parameters with background subtraction using the following parameters: area, IntDen, RawIntDen, Min and Max, fluorescence, background, foci count, CorDen, CorMean. gH2AX signal is the product of foci number per nuclei and mean grey value (IntDen/area).

Since superphysiological doses of androgen has been associated with transcription dependent double strand breaks [35], [36], we tested if CHK2 knockdown would augment superphysiological androgen dependent phospho-γH2AX foci. LNCaP and Rv1 cells were transduced with vector or CHK2 shRNA 48hrs before treatment with a range of the synthetic androgen R1881 up to 100nM for 6 hours (Supplemental Figure 4). We saw modest hormone induced phospho-γH2AX foci and no change with CHK2 knockdown. The superphysiologic dose of androgen likely maximally activates AR dependent transcription negating the increase in AR transcriptional activity typically observed with CHK2 knockdown.

Supplemental Figure 4.
Supplemental Figure 4. CHK2 Knockdown does not alter hormone induced phospho-γH2AX foci.

LNCaP and Rv1 cells were transduced with lentiviral particles expressing empty vector or CHK2 shRNA on fibronectin-coated coverslips in whole media for 48hrs. Media was changed to CSS overnight and cells were treated with hormone for 6 hours. Plotted is the number of phospho-γH2AX foci per cell. n=3 for LNCaP and n=2 for Rv1. At the same dose of hormone there was no statistical difference between vector control and CHK2 knockdown by ANOVA and Tukey’s multiple comparisons test.

DISCUSSION

PCa is the most frequently diagnosed cancer and the second leading cause of cancer death among American men, with approximately 88 men dying from PCa every day (pcf.org). While androgen deprivation therapy (ADT) is effective initially, most patients will relapse and develop incurable CRPC. Recently, there has been an emphasis on understanding the link between the DDR and AR, since radiation is a standard of care for locally advanced PCa where the AR is a major driver, and PARP inhibitors may be efficacious in CRPC patients with mutations in DDR genes [2]–[4], [37]–[39].

Our study identifies AR as a direct interacting protein with CHK2 in PCa cells. Several studies elucidated the role of DDR protein-AR interactions in modulating AR transcriptional activity. PARP-1 was recruited to AR binding sites, enhancing AR occupancy and transcriptional function [40]. Tandem mass spectroscopy analysis identified Ku70 and Ku80 as direct AR-interacting proteins that positively regulate AR transactivation [41]. Furthermore, BRCA1 physically interacted with the DNA-binding domain (DBD) of AR to enhance AR transactivation and induce androgen-mediated cell death through p21 expression [42]. In contrast, the association of the LBD of AR with hRad9, a crucial member of the checkpoint Rad family, suppressed AR transactivation by preventing the androgen-induced interaction between the n-terminus and c-terminus of AR [43]. Other groups reported non-genomic effects as a result of DDR protein-AR interactions. Mediator of DNA damage checkpoint protein 1 (MDC1), an essential player in the Intra-S phase and G2/M checkpoints, physically associated with FL-AR and ARV7 to negatively regulate PCa cell growth and migration [44]. Yin and colleagues, on the other hand, showed that increased clonogenic survival following IR was a consequence of DNA-PKc directly complexing with both FL-AR and ARV5-7, with radiation increasing these interactions and enzalutamide blocking the association with FL-AR but not ARV5-7 [45]. These data support a model where AR is integrated in the DDR, interfacing at multiple points in the DDR.

We show that the association of CHK2 and AR requires phosphorylation of AR on S81 and S308. Since proteins containing FHA domains bind phosphoproteins [8], we hypothesize that AR interacts with CHK2 through the CHK2 FHA domain. In support of this, the Zhao lab determined that AR physically associated with the FHA domain of another critical DDR member, MDC1 [44]. Expression of truncation mutants of different MDC1 domains in LNCaP cells led to the discovery that AR only co-immunoprecipitated with MDC1 mutants containing the FHA domain in the absence and presence of dihydrotestosterone. Their results indicated that the FHA domain of MDC1 mediated the interaction with AR. Here we report that AR phosphorylation on S81 and S308 is required for CHK2–AR binding. Interestingly neither of these phosphorylation sites were altered by IR. AR S81 and S308 can both be phosphorylated by CDK1, which is downstream of canonical CHK2 signaling [21], [24], and was the motivation for us examining these sites in response to IR. The prediction is that IR would lead to a decrease in S81 and S308 phosphorylation. However, our previous studies demonstrated that S81 is predominantly phosphorylated by CDK9, and thus is more indicative of AR transcriptional activity [20]. We also found that S308 phosphorylation was restricted to late G2 and M phase of the cell cycle [24]. CDK9 phosphorylation of S81 and the restriction of S308 phosphorylation to G2/M likely accounts for not observing significant changes in these phosphorylation sites in response to IR. The disconnect between these sites being required for the IR induced increase in CHK2–AR association but not being regulated by IR suggests that the hormone induced activation state of the AR is a critical determinant in the IR induced increase in CHK2–AR association.

In our experiments examining CHK2–AR binding, we used ERK as a positive control for a protein that interacts with CHK2 [16]. Interestingly, we observed a significant increase in CHK2–ERK association with IR. This is consistent with IR increasing CHK2 T68 phosphorylation, which is required for the CHK2–ERK interaction. These data point to a potential larger role for CHK2 beyond canonical DDR and cell cycle checkpoint signaling; consistent with this notion CHK2 has been implicated in diverse cellular processes [46]–[48]. MEK inhibition is effective in lung tumors with ATM mutations where CHK2 is inactive [49] providing further support that CHK2 negatively regulates ERK. CHK2 negatively regulating both the AR and ERK suggests the hypothesis that CHK2 may serve as a general negative regulator of mitogenic signals in response to IR.

We found that CHK2 variants with diminished kinase activity impaired the IR-induced increase in CHK2–AR interaction but did not completely block the CHK2–AR interaction. This correlated with a reduced inhibition of cell growth by the CHK2 variants. CHK2-depleted cells re-expressing CHK2 variants exhibited an approximate 2-3-fold reduction in growth inhibition in response to hormone when compared to cells re-expressing wtCHK2. Moreover, the fold change in suppression of growth between wtCHK2 and CHK2 variants was greater in androgen-dependent LNCaP cells than in castration-resistant C4-2 and Rv1 cells, suggesting that in hormone sensitive PCa CHK2 variants may play a larger role in regulating growth. Berge and colleagues discovered numerous CHK2 splice variants in breast cancer tissue, where all variants were co-expressed with wtCHK2 [50]. Furthermore, several of these variants reduced kinase activity when simultaneously expressed with wtCHK2 and displayed a dominant negative effect on wtCHK2. The impact of the CHK2 variants found in PCa on wtCHK2 function has not yet been fully explored.

Multiple studies indicate that the AR is a critical regulator of genes in the DDR [2], [3]. Reports by others demonstrate that androgen and IR increased DNAPK, XRCC2, and XRCC3 [3]. This concept was supported by more global analysis of transcripts demonstrating androgen regulation of DDR genes [2]. Our data indicating that CHK2 knockdown increases DNAPK and RAD54 transcript levels leads to the hypothesis that CHK2 binding to the AR suppresses AR transcription of DDR genes enabling cells to turn off the DDR following DNA repair. This is consistent with our earlier observation that CHK2 knockdown led to the increase in the transcripts of canonical AR target genes [4]. We observed radiation resistance in CHK2 knockdown cells, consistent with CHK2 suppression of AR transcription of DDR genes. We also observed an increase in phospho-γH2AX signal when CHK2 was knocked down, but no change in DNA breaks as measured by the comet assay under similar conditions. These paradoxical results may be explained by phosphorylation of γH2AX in response to transcription induced DNA breaks [32]–[34]. These incongruous results may also be due to competing effects of CHK2 as both a regulator of the cell cycle and apoptosis [46].

The data reported herein along with our previous work [4] indicate that CHK2 acts as a tumor suppressor in PCa, either through loss of expression or mutation. This raises the concern that CHK2 antagonists in clinical development may paradoxically lead to enhanced PCa growth and resistance to IR. However, it is important to note that we have predominately used a RNAi/overexpression approach. Our RNAi approach is more similar to the CHK2 variants in PCa that have reduced kinase activity. It is important to consider that pharmacologic inhibition is different than inhibition by RNAi [51]. A pharmacologic approach that provides a sudden and complete inhibition of CHK2 kinase activity may impact PCa differently than our RNAi approach, especially when combined with IR or AR antagonists. Our work and that in the literature also suggests that approaches downstream of CHK2 may be more straightforward than targeting CHK2.

In this study, we presented data that provides mechanistic insight into our observation that CHK2 negatively regulates PCa growth. We demonstrated that AR directly bound CHK2, and that IR elevated the CHK2–AR interaction, which peaked one hour following exposure. Not only did these CHK2–AR protein complexes require AR phosphorylation on both serine 81 and serine 308, but CHK2 kinase activity was also necessary, as CHK2 kinase inhibitors disrupted CHK2–AR binding. This was verified using kinase-impaired CHK2 variants, including the K373E variant associated with 4.2% of prostate cancer. Furthermore, these CHK2 variants exhibited a diminished effect on restricting prostate cancer cell growth. We observed that knockdown of CHK2 led to an increase in PCa cell survival in response to IR. This suggests that the deregulation of CHK2 in PCa compromises the DDR and can confer resistance to radiation. In a previous study, we showed that CHK2 knockdown hypersensitized PCa cells to castrate levels of androgen and increased AR transcriptional activity on both androgen-activated and androgen-repressed genes [4]. As part of a feedback loop, AR transcriptionally represses CHK2 levels. Thus, these data along with our previously published results suggest a model where CHK2 antagonizes AR through direct binding and inhibition of transcription of AR targets, including DDR genes (Figure 9). The K373E mutation of CHK2 or loss of CHK2 expression in PCa leads to increased AR transcriptional activity and survival in response to DNA damage, all leading to a more aggressive cancer. Collectively, the work provides a foundation for the continued study of CHK2–AR interactions and functional consequences to benefit PCa therapies.

Figure 9.
Figure 9. Model of CHK2-AR.

We hypothesize the following model. In response to IR, CHK2 activation antagonizes AR through direct binding and inhibition of transcription of AR targets. CHK2 mutation, or loss of expression, that occurs in PCa leads to sustained AR transcriptional activity, an increase in DDR gene transcripts, and survival in response to DNA damage.

MATERIALS AND METHODS

Cell culture

LNCaP and C4-2 cells (a gift from Dr. L. W. K. Chung) were grown in DMEM:F12 (Invitrogen) with 5% Non-Heat Inactivated serum (Gemini) and 1% Insulin-Transferrin-Selenium-Ethanolamine (ITS) (ThermoFisher). CWR22Rv1 (Rv1) (gift from Drs. Steven Balk) and 293T cells (gift from Dr. Tim Bender) were grown in DMEM (Invitrogen) with 10% Heat-Inactivated serum. For growth experiments, phenol-red free DMEM:F12 media with 5% Charcoal-Stripped Serum (CSS) (Gemini) was used. Commercial DNA fingerprinting kits (DDC Medical) verified cell lines. The following STR markers were tested: CSF1PO, TPOX, TH01, Amelogenin, vWA, D16S539, D7S820, D13S317 and D5S818. Allelic score data revealed a pattern related to the scores reported by the ATCC, and consistent with their presumptive identity.

Reagents

Transfection: Fugene 6 (Promega); TransIT-2020 (Mirus Bio).Inhibitors: Enzalutamide (Selleck Chemicals), BML-277 (Santa Cruz Biotech).Antibodies: CHK2 (2G1D5), pCHK2 T68, ERK1/2 (137F5), Actin, Flag-Tag, V5-Tag, HA-Tag, γH2AX (Cell Signaling); AR, pAR S308 (in-house); pAR S81 (Millipore); Cy3-labeled donkey anti-rabbit (Jackson ImmunoResearch). Western blotting performed as previously described [4].

Far Western Blot

To measure direct protein interactions, the protocol was adapted from Prickett et al [52] and Wu et al [53]. 293T cells were transfected with 1) Flag-wtAR, 2) HA-wtAR, 3) Flag-ERK2, 4) V5-wtCHK2, or 5) empty vector control. Cells were treated with vehicle, enzalutamide, or BML-277, one hour before ionizing radiation (IR) exposure. Whole cell extracts were made using Triton-X lysis buffer, sonicated, and immunopurified using anti-Flag, anti-HA, or anti-V5 beads (Sigma) for 2hr at 4°C. Protein bound to beads was washed three times with Triton-X lysis buffer, eluted with 35μl 2X sample buffer, and boiled for 5 min. Proteins were resolved by SDS-PAGE and transferred to PVDF membrane. Proteins on the membrane were denatured and renatured in buffers with varying guanidine–HCl concentrations. Membranes were blocked in 3% blocking buffer (3% bovine serum albumin in Tris-buffered saline/Tween 20) for 1hr. Probes were diluted in 3% blocking buffer and incubated overnight at 4°C. Membranes were washed three times with PBS for 5min followed by fixation using 0.5% paraformaldehyde for 30 min at room temperature. Membranes were then rinsed quickly twice with PBS and quenched using 2% glycine in PBS for 10 min at room temperature. The membrane was blotted for Flag, HA, V5, AR, CHK2, or ERK1/2 and analyzed using the LI-COR Odyssey system and software.

Immunoprecipitation

CHK2 or AR protein was immunoprecipitated from 1mg cell lysate from LNCaP, C42, and Rv1 cells cultured in the appropriate growth media or LNCaP cells transiently transfected with Flag-wtAR/Flag-S81A/Flag-S308A plus V5-wtCHK2 or Flag-wtCHK2/Flag-K373E/Flag-T387N plus HA-wtAR for 48hrs; treated with radiation. Immunoprecipitations were performed with either agarose or magnetic beads, proteins were separated by 7.5% SDS-PAGE; and immunoblotted with AR, pAR S81, pAR S308, CHK2, pCHK2 T68, HA, or ERK1/2 antibodies.

CyQuant Growth Assays

Assay was performed as previously described [4]. Briefly, shCHK2-209, shCHK2-588, wtCHK2, K373E, T387N or Vector control virus was added to fibronectin-coated (1μg/ml) 96well plates. Constructs of CHK2 wild-type and variants were verified by sequencing. Cells were plated in phenol-red free DMEM:F12 or DMEM media with 5% CSS in the presence or absence of 0.05nM R1881. CyQuant reagent was added on Day 7 according to the manufacturer’s protocol (ThermoFisher). Quantification was performed using a BioTek Synergy 2 plate reader.

qPCR

RNA isolation and quantitative real-time PCR (qPCR) was performed as previously described [54], [55]. RNA concentrations were determined using a NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific). Primer sequences and annealing temperature: DNAPKc FW (ATGAGTACAAGCCCTGAG); DNAPKc RV (ATATCAGAGCGTGAGAGC) (Tm=60deg). RAD54B FW (ATAACAGAGATAATTGCAGTGG); RAD54B RV (GATCTAATGTTGCCAGTGTAG) (Tm=60deg). PSMB6 FW (CAAACTGCACGGCCATGATA); PSMB6 RV (GAGGCATTCACTCCAGACTGG) (Tm=60deg).

Clonogenic Survival Assay

LNCaP cells were transduced with lentiviral particles expressing vector or CHK2 shRNAs and treated with 0-6Gy of radiation 72hrs after transduction. Cells were trypsinized, counted, and appropriate numbers were plated in triplicate with the appropriate growth media for colony formation assays (100 cells/0Gy, 200 cells/2Gy, 1000 cells/4Gy, and 6000 cells/6Gy). After 10-14 days, colonies consisting of 50-70 cells were counted using crystal violet. Plotted is the surviving fraction (number of colonies counted/(number of cells seeded x PE) where PE = plating efficiency = number of colonies counted/number of cells seeded) following radiation.

Comet Assay

All Comet Assay steps were performed in the dark. Cells were washed twice with PBS, scraped and suspended in PBS. Cells were combined with molten LMAgarose (Trevigen, 4250-050-02) and placed into comet suitable sides. Samples were left at 4°C for 15 minutes order to create flat surface. Slides were immerse in lysis solution (Trevigen, 4250-050-01) for 40 minutes at 4°C and then in alkaline solution for 30min at room temperature. Slides were electrophoresed in 200mM NaOH, 1mM EDTA in water; pH>13 at 21Volts (300mA) for 30 minutes at 4°C. After the electrophoresis, slides were gently drained, washed twice in dH2O for 10min and immersed in 70% ethanol for 5min. Samples were left to dry overnight at RT. Samples were stained with SYBR Green at 4°C for 5 minutes and left to dry completely overnight. For quantification, images were acquired using a fluorescence microscope (Olympus BX51, High-mag) equipped with a 20×, 0.5 NA objective and a camera (DP70). Images were acquired with DPController software. Images were analyzed by ImageJ software and graphs generated using Prism (GraphPad Software). All imaging was performed at ∼24°C.

Immunofluorescence (IF)

LNCaP cells were transduced with lentivirus expressing vector or CHK2 shRNAs on 1μg/ml fibronectin-coated coverslips and treated with radiation 48hrs after transduction. Cells were allowed to recover from IR exposure for 0, 15, and 45mins. Coverslips were washed 3X with PBS, permeabilized with 0.2% Triton-X for 10mins, blocked with 2% FBS/BSA/donkey serum in PBS for 2hrs at room temperature, and incubated with γH2AX antibodies overnight at 4°C. Coverslips were mounted with Vectashield containing DAPI (ThermoFisher), and images were acquired with a LSM 880 confocal microscope (Carl Zeiss). γH2AX signals were measured using ImageJ software.

Scientific Rigor

Each experiment was performed independently a minimum of three times and each experiment had technical replicates for measuring the endpoint. An independent experiment is defined as an experiment performed on a different day with a different passage number. The number of independent experiments is reported in each figure legend. All data are shown, no outliers were removed. Statistical analysis was performed using GraphPad Prism 8.2.1 and the test used is reported in each figure legend.

FUNDING

This work was supported by the National Cancer Institute [R01 CA178338 to DG]; Paul Mellon Urologic Cancer Institute; and University of Virginia Cancer Center Patient and Friends.

COMPETING INTERESTS

The authors declare no competing financial interests

ACKNOWLEDGEMENTS

We thank the members of the laboratories of Drs. Gioeli, Jameson, Bouton, Dudley, Kashatus, Park, Rutkowski, Smith, and Zong for helpful discussions.

REFERENCES

  1. [1].↵
    N. Rhind and P. Russell, “Chk1 and Cds1: linchpins of the DNA damage and replication checkpoint pathways,” J. Cell. Sci., vol. 113 (Pt 22), pp. 3889–3896, Nov. 2000.
    OpenUrlAbstract/FREE Full Text
  2. [2].↵
    W. R. Polkinghorn et al., “Androgen receptor signaling regulates DNA repair in prostate cancers,” Cancer Discov, vol. 3, no. 11, pp. 1245–1253, Nov. 2013.
    OpenUrlAbstract/FREE Full Text
  3. [3].↵
    J. F. Goodwin et al., “A hormone-DNA repair circuit governs the response to genotoxic insult,” Cancer Discov, vol. 3, no. 11, pp. 1254–1271, Nov. 2013.
    OpenUrlAbstract/FREE Full Text
  4. [4].↵
    H. Q. Ta et al., “Checkpoint Kinase 2 Negatively Regulates Androgen Sensitivity and Prostate Cancer Cell Growth,” Cancer Res., vol. 75, no. 23, pp. 5093–5105, Dec. 2015.
    OpenUrlAbstract/FREE Full Text
  5. [5].↵
    S. Matsuoka, M. Huang, and S. J. Elledge, “Linkage of ATM to cell cycle regulation by the Chk2 protein kinase,” Science, vol. 282, no. 5395, pp. 1893–1897, Dec. 1998.
    OpenUrlAbstract/FREE Full Text
  6. [6].↵
    S. T. Kim, D. S. Lim, C. E. Canman, and M. B. Kastan, “Substrate specificities and identification of putative substrates of ATM kinase family members,” J. Biol. Chem., vol. 274, no. 53, pp. 37538–37543, Dec. 1999.
    OpenUrlAbstract/FREE Full Text
  7. [7].↵
    J. Ahn, M. Urist, and C. Prives, “The Chk2 protein kinase,” DNA Repair (Amst.), vol. 3, no. 8–9, pp. 1039–1047, Sep. 2004.
    OpenUrlCrossRefPubMed
  8. [8].↵
    J. Li et al., “Structural and functional versatility of the FHA domain in DNA-damage signaling by the tumor suppressor kinase Chk2,” Mol. Cell, vol. 9, no. 5, pp. 1045–1054, May 2002.
    OpenUrlCrossRefPubMedWeb of Science
  9. [9].↵
    C. García-Limones et al., “CHK2 stability is regulated by the E3 ubiquitin ligase SIAH2,” Oncogene, vol. 35, no. 33, pp. 4289–4301, 18 2016.
    OpenUrl
  10. [10].↵
    L. Tsvetkov, X. Xu, J. Li, and D. F. Stern, “Polo-like kinase 1 and Chk2 interact and co-localize to centrosomes and the midbody,” J. Biol. Chem., vol. 278, no. 10, pp. 8468–8475, Mar. 2003.
    OpenUrlAbstract/FREE Full Text
  11. [11].↵
    S. Yang, C. Kuo, J. E. Bisi, and M. K. Kim, “PML-dependent apoptosis after DNA damage is regulated by the checkpoint kinase hCds1/Chk2,” Nat. Cell Biol., vol. 4, no. 11, pp. 865–870, Nov. 2002.
    OpenUrlCrossRefPubMedWeb of Science
  12. [12].↵
    C. Stevens, L. Smith, and N. B. La Thangue, “Chk2 activates E2F-1 in response to DNA damage,” Nat. Cell Biol., vol. 5, no. 5, pp. 401–409, May 2003.
    OpenUrlCrossRefPubMedWeb of Science
  13. [13].↵
    A. Hirao et al., “DNA damage-induced activation of p53 by the checkpoint kinase Chk2,” Science, vol. 287, no. 5459, pp. 1824–1827, Mar. 2000.
    OpenUrlAbstract/FREE Full Text
  14. [14].↵
    J. Bartek and J. Lukas, “Chk1 and Chk2 kinases in checkpoint control and cancer,” Cancer Cell, vol. 3, no. 5, pp. 421–429, May 2003.
    OpenUrlCrossRefPubMedWeb of Science
  15. [15].↵
    C. Y. Peng, P. R. Graves, R. S. Thoma, Z. Wu, A. S. Shaw, and H. Piwnica-Worms, “Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216,” Science, vol. 277, no. 5331, pp. 1501–1505, Sep. 1997.
    OpenUrlAbstract/FREE Full Text
  16. [16].↵
    B. Dai et al., “Functional and molecular interactions between ERK and CHK2 in diffuse large B-cell lymphoma,” Nat Commun, vol. 2, p. 402, 2011.
    OpenUrlCrossRefPubMed
  17. [17].↵
    “National Comprehensive Cancer Network. Prostate Cancer http://www.nccn.org/professionals/physician_gls/pdf/prostate.pdf.”
  18. [18].↵
    S. M. Dehm, L. J. Schmidt, H. V. Heemers, R. L. Vessella, and D. J. Tindall, “Splicing of a novel androgen receptor exon generates a constitutively active androgen receptor that mediates prostate cancer therapy resistance,” Cancer Res, vol. 68, pp. 5469–77, 2008.
    OpenUrlAbstract/FREE Full Text
  19. [19].↵
    S. Chen, Y. Xu, X. Yuan, G. J. Bubley, and S. P. Balk, “Androgen receptor phosphorylation and stabilization in prostate cancer by cyclin-dependent kinase 1,” Proc Natl Acad Sci U S A, 2006.
  20. [20].↵
    V. Gordon et al., “CDK9 regulates AR promoter selectivity and cell growth through serine 81 phosphorylation,” Mol Endocrinol, vol. 24, pp. 2267–80, 2010.
    OpenUrlCrossRefPubMedWeb of Science
  21. [21].↵
    S. Chen, S. Gulla, C. Cai, and S. P. Balk, “Androgen receptor serine 81 phosphorylation mediates chromatin binding and transcriptional activation,” J. Biol. Chem., vol. 287, no. 11, pp. 8571–8583, Mar. 2012.
    OpenUrlAbstract/FREE Full Text
  22. [22].↵
    D. Gioeli et al., “Androgen receptor phosphorylation. Regulation and identification of the phosphorylation sites,” J Biol Chem, vol. 277, pp. 29304–14, 2002.
    OpenUrlAbstract/FREE Full Text
  23. [23].↵
    H. Zong et al., “Cyclin D3/CDK11p58 complex is involved in the repression of androgen receptor,” Mol Cell Biol, vol. 27, pp. 7125–42, 2007.
    OpenUrlAbstract/FREE Full Text
  24. [24].↵
    Y. Koryakina, K. E. Knudsen, and D. Gioeli, “Cell-cycle-dependent regulation of androgen receptor function,” Endocr. Relat. Cancer, vol. 22, no. 2, pp. 249–264, Apr. 2015.
    OpenUrlAbstract/FREE Full Text
  25. [25].↵
    M. Higashiguchi et al., “Clarifying the biological significance of the CHK2 K373E somatic mutation discovered in The Cancer Genome Atlas database,” FEBS Lett., Oct. 2016.
  26. [26].↵
    M. Wasielewski, et al., “Deleterious CHEK2 1100delC and L303X mutants identified among 38 human breast cancer cell lines,” Breast Cancer Res. Treat., vol. 113, no. 2, pp. 285–291, Jan. 2009.
    OpenUrlPubMed
  27. [27].↵
    K. Jividen, K. Z. Kedzierska, C.-S. Yang, K. Szlachta, A. Ratan, and B. M. Paschal, “Genomic analysis of DNA repair genes and androgen signaling in prostate cancer,” BMC Cancer, vol. 18, no. 1, p. 960, Oct. 2018.
    OpenUrl
  28. [28].↵
    A. R. Collins, “The comet assay for DNA damage and repair: principles, applications, and limitations,” Mol. Biotechnol., vol. 26, no. 3, pp. 249–261, Mar. 2004.
    OpenUrlCrossRefPubMedWeb of Science
  29. [29].↵
    J. Vignard, G. Mirey, and B. Salles, “Ionizing-radiation induced DNA double-strand breaks: a direct and indirect lighting up,” Radiother Oncol, vol. 108, no. 3, pp. 362–369, Sep. 2013.
    OpenUrlCrossRefPubMed
  30. [30].↵
    W. M. Bonner et al., “γH2AX and cancer,” Nature Reviews Cancer, vol. 8, no. 12, pp. 957–967, Dec. 2008.
    OpenUrlCrossRefPubMedWeb of Science
  31. [31].↵
    M. I. Affentranger and W. Burkart, “Assessment of radiation-induced DNA strand breaks and their repair in unlabeled cells,” Cytometry, vol. 13, no. 1, pp. 31–38, 1992.
    OpenUrlCrossRefPubMedWeb of Science
  32. [32].↵
    I. Singh et al., “High mobility group protein-mediated transcription requires DNA damage marker γ-H2AX,” Cell Res., vol. 25, no. 7, pp. 837–850, Jul. 2015.
    OpenUrlCrossRefPubMed
  33. [33].
    H. Bunch et al., “Transcriptional elongation requires DNA break-induced signalling,” Nature Communications, vol. 6, p. 10191, Dec. 2015.
  34. [34].↵
    J.-H. Ji et al., “De novo phosphorylation of H2AX by WSTF regulates transcription-coupled homologous recombination repair,” Nucleic Acids Res., vol. 47, no. 12, pp. 6299–6314, Jul. 2019.
    OpenUrl
  35. [35].↵
    M. C. Haffner et al., “Androgen-induced TOP2B-mediated double-strand breaks and prostate cancer gene rearrangements,” Nat. Genet., vol. 42, no. 8, pp. 668–675, Aug. 2010.
    OpenUrlCrossRefPubMedWeb of Science
  36. [36].↵
    P. Chatterjee et al., “Supraphysiological androgens suppress prostate cancer growth through androgen receptor-mediated DNA damage,” J. Clin. Invest., vol. 130, Jul. 2019.
  37. [37].↵
    J. Mateo et al., “DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer,” N. Engl. J. Med., vol. 373, no. 18, pp. 1697–1708, Oct. 2015.
    OpenUrlCrossRefPubMed
  38. [38].
    L. Li et al., “Targeting poly(ADP-ribose) polymerase and the c-Myb-regulated DNA damage response pathway in castration-resistant prostate cancer,” Sci Signal, vol. 7, no. 326, p. ra47, May 2014.
    OpenUrlAbstract/FREE Full Text
  39. [39].↵
    Y. Yin et al., “Chk1 inhibition potentiates the therapeutic efficacy of PARP inhibitor BMN673 in gastric cancer,” Am J Cancer Res, vol. 7, no. 3, pp. 473–483, 2017.
    OpenUrl
  40. [40].↵
    M. J. Schiewer et al., “Dual roles of PARP-1 promote cancer growth and progression,” Cancer Discov, vol. 2, no. 12, pp. 1134–1149, Dec. 2012.
    OpenUrlAbstract/FREE Full Text
  41. [41].↵
    G. L. Mayeur, W. J. Kung, A. Martinez, C. Izumiya, D. J. Chen, and H. J. Kung, “Ku is a novel transcriptional recycling coactivator of the androgen receptor in prostate cancer cells,” J Biol Chem, vol. 280, pp. 10827–33, 2005.
    OpenUrlAbstract/FREE Full Text
  42. [42].↵
    S. Yeh et al., “Increase of androgen-induced cell death and androgen receptor transactivation by BRCA1 in prostate cancer cells,” Proc. Natl. Acad. Sci. U.S.A., vol. 97, no. 21, pp. 11256–11261, Oct. 2000.
    OpenUrlAbstract/FREE Full Text
  43. [43].↵
    L. Wang et al., “Human checkpoint protein hRad9 functions as a negative coregulator to repress androgen receptor transactivation in prostate cancer cells,” Mol. Cell. Biol., vol. 24, no. 5, pp. 2202–2213, Mar. 2004.
    OpenUrlAbstract/FREE Full Text
  44. [44].↵
    C. Wang et al., “MDC1 functionally identified as an androgen receptor co-activator participates in suppression of prostate cancer,” Nucleic Acids Res., vol. 43, no. 10, pp. 4893–4908, May 2015.
    OpenUrlCrossRefPubMed
  45. [45].↵
    Y. Yin et al., “Androgen Receptor Variants Mediate DNA Repair after Prostate Cancer Irradiation,” Cancer Res., vol. 77, no. 18, pp. 4745–4754, 15 2017.
    OpenUrl
  46. [46].↵
    L. Zannini, D. Delia, and G. Buscemi, “CHK2 kinase in the DNA damage response and beyond,” J Mol Cell Biol, vol. 6, no. 6, pp. 442–457, Dec. 2014.
    OpenUrlCrossRefPubMed
  47. [47].
    H.-H. Choi et al., “CHK2 kinase promotes pre-mRNA splicing via phosphorylating CDK11(p110),” Oncogene, vol. 33, no. 1, pp. 108–115, Jan. 2014.
    OpenUrlCrossRefPubMed
  48. [48].↵
    T. Choudhuri, S. C. Verma, K. Lan, M. Murakami, and E. S. Robertson, “The ATM/ATR signaling effector Chk2 is targeted by Epstein-Barr virus nuclear antigen 3C to release the G2/M cell cycle block,” J. Virol., vol. 81, no. 12, pp. 6718–6730, Jun. 2007.
    OpenUrlAbstract/FREE Full Text
  49. [49].↵
    M. Smida et al., “MEK inhibitors block growth of lung tumours with mutations in ataxia-telangiectasia mutated,” Nat Commun, vol. 7, p. 13701, 06 2016.
    OpenUrl
  50. [50].↵
    E. O. Berge, V. Staalesen, A. H. Straume, J. R. Lillehaug, and P. E. Lønning, “Chk2 splice variants express a dominant-negative effect on the wild-type Chk2 kinase activity,” Biochim. Biophys. Acta, vol. 1803, no. 3, pp. 386–395, Mar. 2010.
    OpenUrlPubMed
  51. [51].↵
    K. J. Jensen, C. B. Moyer, and K. A. Janes, “Network Architecture Predisposes an Enzyme to Either Pharmacologic or Genetic Targeting,” Cell Syst, vol. 2, no. 2, pp. 112–121, Feb. 2016.
    OpenUrl
  52. [52].↵
    T. D. Prickett et al., “TAB4 stimulates TAK1-TAB1 phosphorylation and binds polyubiquitin to direct signaling to NF-kappaB,” J. Biol. Chem., vol. 283, no. 28, pp. 19245–19254, Jul. 2008.
    OpenUrlAbstract/FREE Full Text
  53. [53].↵
    Y. Wu, Q. Li, and X.-Z. Chen, “Detecting protein-protein interactions by Far western blotting,” Nat Protoc, vol. 2, no. 12, pp. 3278–3284, 2007.
    OpenUrlCrossRefPubMedWeb of Science
  54. [54].↵
    V. Gordon et al., “CDK9 regulates AR promoter selectivity and cell growth through serine 81 phosphorylation,” Molecular Endocrinology (Baltimore, Md.), vol. 24, no. 12, pp. 2267–2280, Dec. 2010.
    OpenUrlCrossRefPubMedWeb of Science
  55. [55].↵
    H. Whitworth et al., “Identification of Kinases Regulating Prostate Cancer Cell Growth Using an RNAi Phenotypic Screen,” PLoS ONE, vol. 7, no. 6, Jun. 2012.
Back to top
Posted September 05, 2019.
Download PDF
Email
Checkpoint kinase 2 regulates prostate cancer cell growth through physical interactions with the androgen receptor
Huy Q Ta, Natalia Dworak, Melissa L Ivey, Daniel Gioeli
bioRxiv 759142; doi: https://doi.org/10.1101/759142
Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools

Subject Area