Abstract
Thalamocortical axons (TCAs) cross several tissues on their journey to the cortex. Mechanisms must be in place along the route to ensure they connect with their targets in an orderly fashion. The ventral telencephalon acts as an instructive tissue, but the importance of the diencephalon in TCA mapping is unknown. We report that disruption of diencephalic development by Pax6 deletion results in a thalamocortical projection containing mapping errors. We used conditional mutagenesis to test whether these errors are due to the disruption of pioneer projections from prethalamus to thalamus and found that, while this causes abnormal TCA fasciculation, it does not induce topographical errors. To test whether the thalamus contains important navigational cues for TCAs, we used slice culture transplants and gene expression studies. We found the thalamic environment is instructive for TCA navigation and that the molecular cues Netrin1 and Semaphorin3a are likely to be involved. Our findings indicate that the correct topographic mapping of TCAs onto the cortex requires the order to be established from the earliest stages of their growth by molecular cues in the thalamus itself.
Introduction
A striking feature of the axonal tracts that interlink the nervous system’s component parts is the high degree of order with which they map the array of neurons in one structure onto the array of neurons in their target. Often, the order of axons at the target closely mirrors that at the source. An excellent example is the mapping of thalamic neurons onto their cerebral cortical targets via the thalamocortical pathway (Fig. 1A). Thalamic neurons located at one end of the thalamus in a dorsolateral region called the dorsal lateral geniculate nucleus (dLGN) innervate the caudal (visual) part of cortex; neurons located at the other end of the thalamus in more rostral-medial regions known as the ventrolateral (VL) and ventromedial (VM) nuclei innervate more rostral cortical regions, including motor and frontal cortex; neurons located in between - in the ventromedial posterior (VMP) nuclei - innervate central (somatosensory) cortex (Fig. 1A) (Amassian and Weiner, 1966; Bosch-Bouju et al., 2013; Jones, 2007; Tlamsa and Brumberg, 2010). The mechanisms that generate this orderly topographic mapping remain poorly understood.
The maintenance of order among thalamic axons as they grow is likely to contribute to the generation of orderly topographic mapping in the mature thalamocortical tract. During embryogenesis, thalamic axons exit the thalamus from about E12.5 onwards (Auladell and Hans, 2000; Braisted et al., 1999; Tuttle et al., 1999), approximately coincident with the cessation of neurogenesis in this structure (Angevine, 1970; Li et al., 2018). They then cross the adjacent prethalamus and turn laterally out of the diencephalon and into the ventral telencephalon where they traverse two consecutive instructive regions - the corridor (Lopez-Bendito et al., 2006) and the striatum - before entering the cortex. There is evidence that the maintenance of spatial order among thalamocortical axons (TCAs) crossing the ventral telencephalon requires interactions between the axons and signals released by cells they encounter in this region (Bielle et al., 2011; Bonnin et al., 2007; Braisted et al., 1999; Dufour et al., 2003; Molnár et al., 2012; Powell et al., 2008). The importance of earlier interactions within the diencephalon remains unclear.
Here, we tested the effects of mutating the gene for the Pax6 transcription factor, which is essential for normal diencephalic patterning (Caballero et al., 2014; Clegg et al., 2015; Parish et al., 2016; Pratt et al., 2000; Stoykova et al., 1996; Warren and Price, 1997), on the topographic mapping of TCAs onto the cortex. Pax6 starts to be expressed in the anterior neural plate well before TCAs start to form (Walther and Gruss, 1991). As the forebrain develops from the anterior neural plate, Pax6 expression becomes localized in (i) cortical progenitors that generate the target neurons for TCAs, (ii) diencephalic (thalamic and prethalamic) progenitors and (iii) prethalamic (but not thalamic) postmitotic neurons (Quintana-Urzainqui et al., 2018; Stoykova et al., 1996; Warren and Price, 1997). We discovered that deletion of Pax6 from mouse embryos at the time when thalamic axons are starting to grow results in the development of a thalamocortical projection containing mapping errors. Axons from dorsolateral thalamus are misrouted medially and end up projecting abnormally rostrally in the cortex. We went on to explore the reasons for this defect.
We first used conditional mutagenesis to test whether misrouting is due to the loss of Pax6 from prethalamic neurons, since previous work has shown that (i) Pax6 is not required in the cortex for normal TCA topography (Piñon et al., 2008) and (ii) Pax6 is neither expressed nor required autonomously by thalamic neurons for them to acquire the ability to extend axons to the cortex (Clegg et al., 2015). We found that while loss of Pax6 from a specific set of prethalamic neurons prevented them developing their normal axonal projections to thalamus and resulted in the abnormal fasciculation of thalamic axons, it did not cause TCAs to misroute. This suggested that the thalamus itself contains important navigational cues for TCAs. We used slice culture transplants and gene expression studies to show (i) that the thalamic environment is indeed instructive for TCA navigation and (ii) to identify molecular changes within the thalamus that likely cause the disruption in TCA topography observed upon Pax6 deletion. Our findings indicate that the normal topographic mapping of TCAs requires that order be established and maintained from the earliest stages of their growth by molecular cues in the thalamus itself.
Results
Thalamocortical topography is disrupted in CAGCreER but not in EmxCreER Pax6 conditional knockouts
Previous studies have shown that constitutive loss of Pax6 function causes a total failure of TCA development, which is hypothesized to be a secondary consequence of anatomical disruption at the interface between the diencephalon and the telencephalon (Clegg et al., 2015; Georgala et al., 2011; Jones et al., 2002). No such failure occurs if Pax6 is deleted conditionally after this anatomical link is formed (Clegg et al., 2015). We first assessed whether delayed ubiquitous Pax6 deletion, induced in CAGCreER-TM Pax6fl/fl embryos (referred to here as CAGCreER Pax6 cKOs), disrupts the topography of TCA connections. We induced Cre recombinase activation by tamoxifen administration at E9.5 which caused Pax6 protein loss in CAGCreER Pax6 cKOs from E11.5 onwards (Quintana-Urzainqui et al., 2018), which is when the generation of most thalamic neurons is starting (Li et al., 2018) and before many TCAs have begun to grow (Auladell and Hans, 2000; López-Bendito and Molnár, 2003). We used both wild type and CAGCreERPax6fl/+ littermate embryos as controls since the latter express normal levels of Pax6 protein, almost certainly because of a feedback loop that compensates for a deletion in one allele by increasing the activity of the other (Caballero et al., 2014; Manuel et al., 2015).
We inserted two different axonal tracers in two cortical areas in E15.5 fixed brains. DiA was placed in the visual (caudal) cortex while DiI was placed in the somatosensory (more rostral) cortex (Fig. 1B). In controls (both wild type and Pax6fl/+), DiA retrogradely labelled cells in dorsolateral thalamic areas (dLGN; green labelling in Fig. 1C-F), while DiI labelled cells in ventromedially-located thalamic regions (red labelling in Fig. 1C-F). Labelling of these two thalamic regions was clearly separated in all cases (indicated by dotted line in Fig. 1C-F; n=3 independent replicates for each of the two genotypes). In CAGCreER Pax6 cKOs, however, the two labelled populations overlapped (Fig. 1G-I). In these mutants, the distribution of the DiA-labelled thalamic cells (from caudal cortical injections) was not obviously changed with respect to controls. However, the DiI-labelled cells (projecting to more rostral cortical areas) showed a much wider distribution than in controls and expanded to lateral thalamic areas (compare Fig.1 C-F,C’,E’F’ versus G-I,H’,I’), even overlapping with DiA stained cells at the dLGN (Fig. 1 H’,I’). This observation was consistent across three independent experiments, indicating that some TCAs from neurons located at dorsolateral thalamic levels that should project to the caudal cortex are misrouted towards more rostral cortical areas in the CAGCreER Pax6 cKOs (Fig. 1L).
Since Pax6 is expressed both in the cortex and diencephalon during TCA development, the mapping defects described above might have been due to the loss of Pax6 from the cortex. This was unlikely because a previous study showed that Pax6 is not required in the cortex for the establishment of proper topographical thalamocortical connections (Piñon et al., 2008). To confirm this, we used a cortex-specific, tamoxifen-inducible Cre line (Emx1CreER). We administered tamoxifen at E9.5, which results in a near-complete loss of cortical Pax6 between E11.5-12.5 (Georgala et al., 2011; Mi et al., 2013), and performed DiI/DiA labelling at E15.5, following the same experimental design described above for the CAGCreline. We found that the two retrogradely-labelled populations did not overlap in controls (Emx1CreER Pax6fl/+, n=3) or in mutants (Emx1CreER Pax6fl/fl, n=3) (Fig. S1A,B), suggesting that the defects of TCA mapping found in the CAGCreER Pax6 cKOs were not attributable to cortical abnormalities.
To define the anatomical region where thalamic axons probably deviated from ordered growth, we examined the TCA bundle in CAGCreERPax6 cKOs. This bundle was ordered and segregated into rostral/somatosensory (DiI) and caudal/visual (DiA) halves at its point of exit from the prethalamus and entry into the ventral telencephalon (arrows in Fig. 1 G-I), which indicated that the misrouting of lateral TCAs from dorsolateral thalamus might happen before this point, i.e. within the diencephalon.
TCAs fasciculate prematurely as they cross the prethalamus in Pax6 conditional mutants
Within the diencephalon, the first structure that thalamic axons encounter as they leave the thalamus is the prethalamus, and its neurons normally express high levels of Pax6. Therefore, we investigated whether the defects of TCA mapping in CAGCreER Pax6 cKOs might arise from a disordered growth of thalamic axons through the prethalamus. As a first step, we examined the effects of Pax6 deletion on the behaviour of thalamic axons as they cross the prethalamus.
Since the neural cell adhesion molecule L1CAM (L1) is expressed in TCAs (Fukuda et al., 1997; Ohyama et al., 2004), we examined the distribution of L1-positive thalamic axons at E13.5 in transverse and sagittal sections through the prethalamus. In controls, axons emerging from the thalamus converge progressively as they cross the prethalamus (Fig. 2A-E) to subsequently form a single thalamocortical bundle that turns laterally and exits the prethalamus (arrows in Fig. 2A,B,E). We found that in CAGCreER Pax6 cKOs (Fig. 2F-L), thalamic axons prematurely converge into larger bundles as soon as they cross the thalamic-prethalamic boundary (empty arrows in Fig. 2G-I,L).
To obtain a quantitative measurement of this observation we positioned three equally-spaced lines across different diencephalic levels in sagittal sections: (1) at the thalamic-prethalamic border (Th-PTh), guided by prethalamic expression of Pax6; (2) at a lower prethalamic position (low-PTh), guided by the end of Pax6 prethalamic expression; and (3) at the midpoint position between the two other lines (mid-PTh) (lines represented in Fig. 2D,E,K,L). We used Fiji software (Schindelin et al., 2012) to quantify the number of axon bundles crossing each line and the width of each individual bundle. We recognized individual bundles as each single L1-positive structure above a consistent intensity threshold (red lines in Fig. 2M,N). We found a significant decrease in the number of bundles crossing all three checkpoints (Fig. 2O). Axon bundle width strikingly increased at the Th-PTh border and the mid-PTh, with no significant change at the low-PTh checkpoint line (Fig. 2P) (see figure legend for statistical details). These data indicate that, in the absence of Pax6, TCAs begin to fasciculate prematurely in their route, forming bigger and fewer bundles as they cross the prethalamus (Fig. 2Q). We next tested the role of the prethalamus in TCA formation and the potential establishment of their topography.
Prethalamic pioneer axons fail to form in Gsx2Cre Pax6 cKOs producing abnormal TCA fasciculation but no changes in topography
The prethalamus has been proposed to host a population of neurons that extend axons to the thalamus which act as “pioneer guides” for TCA navigation (Price et al., 2012; Tuttle et al., 1999). We assessed whether this population is disrupted by Pax6 loss from the prethalamus since, if it is, this might provide an explanation for phenotypes described above.
From about E9.5 on, most cells in the prethalamus express, or are derived from cells that expressed, Gsx2. We used a Gsx2Cre line (Kessaris et al., 2006) carrying an EGFP Cre reporter (Sousa et al., 2009) to visualize neurons and axons belonging to the Gsx2 lineage and we observed that prethalamic Pax6-expressing cells are included within the location of the Gsx2 lineage prethalamic population (Fig. 3A,B). Zic4 is also expressed by some prethalamic cells, with an onset of expression similar to that of Gsx2 (about E9.5; Gaston-massuet et al., 2005), and most diencephalic Zic4 lineage cells express and require Pax6 for their normal development (Li et al., 2018). Using a Zic4Cre line (Rubin et al., 2011) we observed that prethalamic neurons derived from Zic4 lineage were located in a narrow band close to the thalamic-prethalamic border (Fig. 3C-D). We assessed whether these prethalamic populations normally send axons to the thalamus.
Gsx2-lineage GFP-positive axons extended throughout the thalamus forming ordered and parallel projections (Fig. 3E) and running in close apposition to L1-positive TCAs (Fig. 3E’,E’’) from E12.5 onwards (Fig. S2). By contrast, Zic4-lineage prethalamic cells did not project axons to the thalamus (Fig. 3D), indicating that prethalamic pioneer axons arise from Gsx2-lineage and not from Zic4-lineage prethalamic cells.
Since Gsx2 is also expressed in the ventral telencephalon (Fig. 3A), and ventral telencephalic neurons are known to project to the thalamus (López-Bendito and Molnár, 2003; Métin and Godement, 1996; Molnár et al., 1998), there was a possibility that Gsx2Cre lineage axons innervating the thalamus actually originated from ventral telencephalic neurons. To confirm the existence of Gsx2-lineage prethalamic neurons projecting to the thalamus we injected the neuronal tracer NeurobiotinTM in the thalamus of E13.5 Gsx2Cre embryos and successfully labelled prethalamic neurons (arrow in Fig. 3F). NeurobiotinTM-positive cells were GFP-expressing Gsx2 lineage (Fig. 3F-F’’,G) and most of them also expressed Pax6 (arrows in Fig. 3H,H’; see summary in Fig. 3I). (Note that individual injections each involved only subregions of the thalamus, explaining why each one only labelled a discrete subset of the prethalamic neurons projecting to the thalamus). This experiment confirmed that Gsx2-lineage cells in the prethalamus project to the thalamus.
Having established that pioneer prethalamic axons belong to the Gsx2 lineage and express Pax6 we next aimed at disrupting their formation by conditionally deleting Pax6 in Gsx2-lineage cells. We crossed mice carrying the floxed Pax6 allele and EGFP Cre reporter with the Gsx2Cre line. Pax6 conditional deletion in Gsx2-lineage cells (Gsx2Cre Pax6 cKOs) caused a visible reduction in the number of GFP-positive axons projecting from prethalamus to thalamus in E12.5, E13.5 and E14.5 embryos (Fig. 4A-F). These phenotypes were seen consistently in three independent replicates of each genotype at each age. To confirm that the prethalamic axons that were lost in Gsx2Cre; Pax6loxP/loxP embryos were Pax6-expressing, we used the DTy54 YAC reporter allele to express tauGFP in cells in which the Pax6 gene is active, irrespective of whether it is mutant or not (Tyas et al., 2006). Whereas there were many tauGFP-labelled axons running from prethalamus to thalamus in controls, there were very few in experimental embryos (Fig. 4G-J).
DiI placed in the thalamus of E13.5 CAGCreER controls (CAGCreER Pax6 fl/+; n=3) retrogradely labelled a prethalamic population (arrow in Fig. 4K). In the absence of Pax6 (CAGCreER Pax6 cKOs, n=3), no prethalamic cell bodies were labelled by thalamic DiI injection (Fig. 4L), providing further evidence that the prethalamic pioneer population does not form correctly when Pax6 is deleted. Overall, our results show that prethalamic pioneer axons originating from Gsx2-lineage cells both express and require Pax6 to develop normal connections with the thalamus (Fig. 4T).
We then studied the TCAs of Gsx2Cre Pax6 cKOs. Similar to the phenotype described in CAGCreER Pax6 cKOs, Pax6 deletion in Gsx2 lineage caused abnormal premature fasciculation of axons crossing the thalamic-prethalamic border, as evidenced by L1 immunohistochemistry (Fig. 4M-R). However, unlike CAGCreER Pax6 cKOs, Gsx2Cre Pax6 cKOs did not show abnormal topographical projections, with no obvious overlap between thalamic retrogradely-labelled populations after cortical DiA and DiI placement in caudal and more rostral cortex respectively (Fig. 1B; Fig. 4S) (n=4).
We conclude that, while prethalamic pioneer axons play a role in avoiding premature TCA fasciculation, they are not required for the establishment of accurate thalamocortical topographic mapping (Fig. 4T).
Evidence for the importance of navigational cues in the thalamus itself
We next considered the potential importance of thalamic factors in the establishment of thalamocortical topographic order. Our results above indicate that thalamic axons might have deviated from their normal trajectories before they exited the thalamus in CAGCreER Pax6 cKOs (arrows mark deviant axons in Fig. 1 H’,I’ and Fig. 1H’’; no such axons were observed in the controls, Fig. 1C’,E’,F’). A misrouting of TCAs in the thalamus was also evident with L1 staining (Fig. 5 A,B). In controls, L1-positive axons showed a high degree of order, forming small, parallel bundles as they exit the thalamus (Fig. 5A), while in CAGCreER Pax6 cKOs they were disorganized. The largest collections of deviant axons were observed projecting from lateral to medial thalamic regions (arrow in Fig. 5B), suggesting that the loss of Pax6 had disrupted normal navigational mechanisms operating within the thalamus.
We looked for evidence that thalamic axons are actively guided through the normal thalamus by using in vitro slice culture transplants to assess the effects of repositioning lateral or medial thalamic neurons on the routes taken by their axons. We grafted thalamic slice explants from E13.5 GFP-positive donor embryos into GFP-negative host slices and cultured them for 72 hours to allow thalamic axons to regrow and navigate through the host environment. The donor grafts were positioned so that their axons had to traverse at least 200µm of host thalamic tissue before encountering the Th-PTh boundary, allowing us to assess how the host thalamic tissue affected the trajectory of the axons emerging from the donor tissue. We isolated donor explants from either lateral or medial thalamus, and grafted them either medially or laterally into host thalamus (Fig. 5C,E,G,I).
We found that axons from lateral thalamic explants showed a strong preference to follow a lateral trajectory, irrespective of whether they were grafted laterally or medially (3/3 independent experiments) (Fig. 5C-F). When the lateral axons were confronted with medial host thalamus, most made a sharp turn towards lateral positions before heading towards the prethalamus (Fig. 5E,F).
When medial explants were grafted into the medial thalamus (Fig. 5G,H), most of them navigated through a medial corridor close to and parallel with the ventricular surface (empty arrow in Fig. 5H), whereas when medial explants were grafted laterally many of their axons turned medially (arrows in Fig. 5J) (5/5 independent experiments). In addition, all transplants of medial grafts, irrespective of their location in the host, generated significant numbers of axons that navigated laterally through the thalamus (Fig. 5H,J).
These results indicated that different subsets of thalamic axons exhibit different chemotactic responses to the thalamic environment and therefore that thalamic axons are actively guided by mechanisms operating within the thalamus itself. To gain further insight into what these mechanisms might be, we went on to examine the expression of guidance molecules in the normal thalamus and in thalamus from which Pax6 has been removed.
Axon guidance molecule expression in normal and Pax6 deficient thalamus
Semaphorin 3a (Sema3a) and Netrin 1 (Ntn1) are secreted guidance molecules whose complementary gradients of expression in the ventral telencephalon are key for the correct establishment of topographical connections between thalamus and cortex (Bielle et al., 2011; Braisted et al., 1999; Molnár et al., 2012; Powell et al., 2008; Wright et al., 2007). Interestingly, we found that their transcripts are also distributed in opposing gradients in the thalamus (Fig. S3A,B). Ntn1 is most highly expressed at rostral-medial levels (Fig. S3A) while Sema3a is most highly expressed in a more caudal-lateral aspect of the thalamus and in the lateral prethalamus (Fig. S3B). In transverse in situ hybridization (ISH) of E13.5 controls we observed that Ntn1 is expressed in a narrow rostral-medial thalamic population of neurons (arrow in Fig. 6A) while Sema3a is expressed in caudal-lateral thalamic neurons (arrows in Fig. 6B) as well as flanking the TCA bundles in the prethalamus (empty arrow in Fig. 6B).
To obtain a clearer three-dimensional view of these expression patterns we reconstructed them from serial, adjacent sections stained for Sema3a, Ntn1, Pax6 and L1 in controls (Fig. 6C). The scaffold of the 3D model was built from transverse slices stained for DAPI (for the general tissue profile), Pax6 (to define thalamus and prethalamus boundaries) and L1 (to label TCAs). The location of the signalling cues was incorporated within the boundaries of the model by comparing adjacent transverse sections stained for Sema3a and Ntn1, with dots representing staining density. The 3D reconstruction confirmed that Sema3a and Ntn1 form opposing gradients in the normal embryonic thalamus (Fig. 6C), with Sema3a highest at caudal-lateral thalamic levels while Ntn1 is highest at rostral-medial thalamic levels.
We next investigated the expression patterns of the main receptors for Ntn1 and Sema3a in the thalamus of control embryos. The most interesting finding was that Unc5c, encoding a Ntn1 receptor mediating axonal repulsion (Leonardo et al., 1997), was expressed differentially from lateral to medial across the thalamus (Fig. 6D). Laterally, almost all cells expressed high levels of Unc5c whereas medially many cells did not (Fig. 6D’). Unc5c was largely absent from a narrow strip of cells close to and parallel with the ventricular zone. This strip coincided with the region that contained Ntn1-positive cells (compare Fig. 6D and A). Plxna1, encoding a Sema3a receptor that mediates repulsion (Rohm et al., 2000; Takahashi et al., 1999; Tamagnone et al., 1999) was found to be distributed relatively homogenously across the thalamus (Fig. 6E, S3C).
These expression patterns suggest that, whereas all thalamic axons might be repelled by Sema3a (due to their expression of Plxna1), only some axons might be repelled by Ntn1 (i.e. those originating laterally, which express Unc5c, and those Unc5c-expressing axons that originate medially) (Fig. 6K). This could explain why, in the grafting experiments described above, axons from lateral explants invariably navigated laterally, which would be away from medially located high levels of Ntn1. It could also explain why medial explants generated axons able to navigate on a broader front: some axons (those that express Unc5c) would be pushed relatively laterally by repulsion from medially expressed Ntn1; others (those that do not express Unc5c) would be able to maintain a medial trajectory through Ntn1-expressing territory, thereby avoiding the high levels of Sema3a expressed in lateral thalamus (Fig. 6K).
Other receptor-coding genes analysed (Dcc, Unc5a, Unc5d) showed little or no expression within the main body of the thalamus and are therefore unlikely to contribute to the navigation of thalamic axons within the thalamus (Fig. S3E,G,I).
We next asked whether the thalamic expression of Ntn1 and Sema3a and their receptors change in a way that might explain the medially-directed deviation of lateral axons that we observed in the thalamus of CAGCreER Pax6 cKOs. In these embryos, we found that the medial domain of Ntn1-expression was retained and appeared enlarged. Sema3a was still expressed higher laterally, although overall levels seemed reduced (Fig. 6F,G). These patterns are reconstructed in 3D in Fig. 6H. Ntn1 and Sema3a expression in the subpallium of CAGCreER Pax6 cKOs appeared to be unaffected (Fig. S3J-M).
Regarding the expression of guidance receptors, fewer laterally-located neurons expressed Unc5c in CAGCreER Pax6 cKOs than in controls (compare Fig. 6I’ and D’). Significant numbers of Unc5c-negative neurons were now intermingled with Unc5c-positive neurons even in the most lateral thalamic tissue (Fig. 6I’). Plxna1’s thalamic expression pattern did not change in the absence of Pax6 (Fig. 6J, S3D), nor did that of any of the other receptor-coding genes studied (Fig. S3E-J).
As reported above, we discovered that CAGCreER Pax6 cKOs show a misrouting in a medial direction of axons from the lateral thalamus (Fig. 1), and our finding that many laterally-located thalamic neurons lose their expression of Unc5c, provides a likely explanation, summarized in Fig. 6L. We propose that Unc5c-negative laterally-located thalamic neurons in CAGCreER Pax6 cKO thalamus would no longer be repelled from the medial thalamus by its high levels of Ntn1. Consequently, they would be more likely to stray, or perhaps to be pushed by relatively high lateral levels of Sema3a, towards a medial direction (Fig. 6L). Overall, our findings indicate that mechanisms exist within the thalamus itself to ensure that its TCAs exit in an orderly manner and that these mechanisms play an important part in the correct topographic mapping of TCAs onto the cortex.
DISCUSSION
During embryonic development, thalamic axons undertake a long journey, having to navigate through several tissues before they arrive to the cortex. It is therefore crucial that their guidance is tightly regulated by mechanisms placed all along the route. Previous studies have demonstrated the importance of the ventral telencephalon as an intermediate target for the establishment of correct topographical connections between thalamus and cortex. Here, gradients of signalling molecules seem to sort different subsets of TCAs towards different areas of the embryonic cortex (Antón-Bolaños et al., 2018; Bielle et al., 2011; Braisted et al., 1999; Dufour et al., 2003; Métin and Godement, 1996; Molnár et al., 2012; Vanderhaeghen and Polleux, 2004). To date, the importance of other tissues along the route in the establishment and/or maintenance of axonal topography remained unexplored. In this work, we show that if thalamic axons do not emerge in order from the thalamus they will connect with the wrong areas of the cortex, resulting in topographical defects of the thalamocortical tract. This highlights the importance of maintaining axonal order throughout the route and suggests the existence of guidance mechanisms within the diencephalon to guarantee this happens.
Indeed, our in vitro graft experiments demonstrated that the embryonic thalamic tissue is instructive for TCAs and seems to sort axons according to their original medio-lateral position. We went on to find a possible guidance mechanism acting within the thalamus. The thalamus expresses Ntn1 and Sema3a, some of the same guidance molecules known to guide TCAs in the ventral telencephalon (Bielle et al., 2011; Powell et al., 2008; Wright et al., 2007). What is more, there is an interesting correspondence between the regions expressing each of those molecules in the thalamus and in the ventral telencephalon. TCAs that emerge and navigate through the Sema3a-high region of the thalamus (lateral-caudal thalamus, dLGN) are steered towards the Sema3a-high region in the ventral telencephalon, while axons that emerge and navigate through the Ntn1-high region of the thalamus (ventral-medial thalamus, VMP) are sorted towards Ntn1-high regions in the ventral telencephalon. This suggests that each subset of thalamic axons might maintain the expression of the same combination of axon guidance receptors along the route and therefore show the same chemotactic response when confronting gradients of signalling cues. Likewise, it indicates that the same gradients of guidance molecules are re-used at different levels of the thalamocortical pathway to maintain topographic order.
The chemotactic behaviour of TCAs with respect to Sema3a and Ntn1 gradients in the thalamus and ventral telencephalon can be explained by our observations of the expression of Sema3a and Ntn1 receptors in developing thalamus. We show that all thalamic neurons seem to express homogeneous levels of Plxna1, a receptor mediating repulsion to Sema3a (Rohm et al., 2000; Takahashi et al., 1999; Tamagnone et al., 1999), while Unc5c, a receptor mediating repulsion to Ntn1 (Leonardo et al., 1997), was found to be expressed in a lateral-high medial-low gradient. According to these observations, we propose a model in which complementary expression patterns of Sema3a and Ntn1 can establish topographical order on TCAs by a mechanism of double repulsion, in which all thalamic axons have the potential to be repelled by Sema3a but only lateral axons are additionally repelled by Ntn1. It is possible that laterally-derived axons experience stronger Ntn1 repulsion the more lateral they are. Thus, lateral thalamic axons prefer to navigate through Sema3a-high, Ntn1-low regions because they might be more strongly repelled by Ntn1 than by Sema3a. Axons located in intermediate regions of the thalamus express lower levels of Unc5c, thus they might be equally repelled by Sema3a and Ntn1 and chose to navigate across regions with moderate levels of both signalling cues. Likewise, medial axons are only repelled by Sema3a and neutral to Ntn1, therefore they chose to navigate through Sema3a-low, Ntn1-high areas.
Supporting this model are the experiments showing that TCAs are repelled by Nnt1 (Bielle et al., 2011; Bonnin et al., 2007; Powell et al., 2008) and thalamic growth cones show retraction behaviour in the presence of Sema3a (Bagnard et al., 2001). Moreover, Wright and colleagues reported that in mice harbouring a mutation that makes the axons non responsive to Sema3a, axons from the ventrobasal (VB) thalamic nucleus, were caudally shifted and target the visual cortex instead of the somatosensory cortex (Wright et al., 2007). Our double repulsion model satisfactorily explains this phenotype. The VB nucleus is located in an intermediate thalamic region that would contain substantial number of Unc5c-positive neurons. In those mutants, VB axons lose their repulsion to Sema3a but many would still be repelled by Ntn1, and therefore would steer towards Sema3a-high, Ntn1-low regions both in the thalamus and the ventral telencephalon.
The behaviour of the TCAs in our explant experiments also supports the double repulsion model. Explants from lateral thalamus, which express high levels of Unc5c, invariably navigate through lateral areas of the thalamus, away from the Ntn1-rich area in the medial thalamus. Explants from medial thalamus show a preference to navigate through a medial corridor, parallel to the ventricular surface, where levels of Ntn1 are higher. These TCAs probably correspond with the subset of neurons in the medial thalamus that do not express Unc5c, and therefore are repelled by Sema3a but neutral to Ntn1. Medial explants also produce axons exhibiting a mixture of trajectories towards more lateral thalamic areas. This is compatible with the fact that a subset of medial thalamic neurons express variable levels of Unc5c, and thus are repelled with variable strength from the medial thalamus. Finally, in Pax6 deficient embryos, many lateral thalamic neurons downregulate Unc5c, while the levels of Plxna1 seem unaffected, meaning that lateral TCAs lose their repulsion to Ntn1 but they are still repelled by lateral Sema3a. This might explain why in these mutants, lateral thalamic axons are misrouted towards medial thalamic regions and subsequently take the pathway medial thalamic axons normally do.
Other molecules known to form gradients and guide TCAs in the ventral telencephalon, like Slit1 or Ephrin A5 (Bielle et al., 2011; Dufour et al., 2003; Molnár et al., 2012; Seibt et al., 2003; Vanderhaeghen and Polleux, 2004) were not analysed in this study. It remains to be tested whether these molecules and their receptors are also expressed in the thalamus in a gradient fashion and if they follow the same rules proposed in our model.
It is important to highlight that in this study we only considered the medio-lateral axis of the main thalamic body, but the same or other guidance cues and receptors probably function in other directions. For example, work in mice showed that Unc5c (Bonnin et al., 2007) and DCC (Powel et al., 2008) are also highly expressed in the rostral thalamus, at a level we did not cover in our expression and tracer analyses. Therefore, other axes of the thalamus important for the establishment of thalamocortical topography remain to be explored.
Another important question is why thalamic axons exit the thalamus at all. Why do they navigate towards the prethalamus and not in another direction, for example towards the pretectum? One previously suggested mechanism was that TCAs follow the path pioneered by axons that develop in the opposite direction from prethalamus to thalamus (Braisted et al., 1999; Mitrofanis and Guillery, 1993; Molnár et al., 1998; Qin et al., 2019). In this work, we disrupted the formation of these pioneer axons and found that TCAs not only are able to exit the thalamus but they also reach the cortex and establish correct topographic connections. Therefore, there must be other mechanisms in place to direct TCAs out of the thalamus. Our 3D reconstruction revealed that, besides the medio-lateral Sema3a gradient, this guidance cue is also higher posteriorly, where the thalamus meets the pretectum and lower anteriorly, close to the prethalamus. According to our model, all TCAs are equally repelled by Sema3a, therefore this directionality of the Sema3a gradient could serve to repel all TCAs out of the thalamus.
Finally, our results have given some interesting new insights into the development and the importance of the pioneer axons from the prethalamus to the thalamus. First, we found that the prethalamic neurons extending pioneer axons to the thalamus belong to a particular lineage, the Gsx2-lineage and not the Zic4-lineage. Second, although disturbing the prethalamus-to-thalamus pioneers did not stop TCAs reaching the cortex without any topographic error, it did cause them to fasciculate prematurely as they crossed the prethalamus. Growing axons often increase their fasciculation when they cross regions that are hostile to their growth. Our and other studies have shown that the prethalamus also expresses guidance cues with potential to exert a repulsive response of TCAs (Ono et al., 2014), thus it is possible that interactions between the developing TCAs and prethalamic pioneers somehow helps the passage of the TCAs across this region. Further work is needed to discover what the consequences are if this help is unavailable.
Material and Methods
Mice
All animals (Mus musculus) were bred according to the guidelines of the UK Animals (Scientific Procedures) Act 1986 and all procedures were approved by Edinburgh University’s Animal Ethics Committee.
For conditional inactivation of Pax6, we used a tamoxifen-inducible Pax6loxP allele (Simpson et al., 2009) and a RCE:LoxP EGFP Cre reporter allele (Sousa et al., 2009) and we combined them with different Cre lines. To generate a deletion of Pax6 throughout the embryo, we used lines carrying a CAGGCre-ERTM allele (Hayashi and McMahon, 2002; Quintana-Urzainqui et al., 2018). To inactivate Pax6 in different parts of the prethalamus we used either a Gsx2-Cre (Kessaris et al., 2006) or the Zic4-Cre allele (Rubin et al., 2011). For cortex-specific deletion of Pax6, we used Emx1Cre-ERT2 (Kessaris et al., 2006).
The DTy54 YAC reporter allele (Tyas et al., 2006) was combined with the Gsx2-Cre allele to generate Gsx2Cre; Pax6loxP/loxP embryos expressing tauGFP in cells in which the Pax6 gene is active.
Embryos heterozygous for the Pax6loxP allele (Pax6fl/+) were used as controls since previous studies have shown no detectable defects in the forebrain of Pax6fl/+ embryos (Simpson et al., 2009). Embryos carrying two copies of the floxed Pax6 allele (Pax6fl/fl) were the experimental conditional knock-out (cKO) groups.
For thalamic explant experiments, we generated litters containing GFP-positive and negative embryos by crossing a line of heterozygous studs for a constitutively active form of CAGGCre-ERTM allele and the and a RCE:LoxP EGFP Cre reporter allele with wild type females.
The day the vaginal plug was detected was considered E0.5. Pregnant mice were given 10mg of tamoxifen (Sigma) by oral gavage on embryonic day 9.5 (E9.5) and embryos were collected on E12.5, E13.5, E14.5, E15.5, E16.5 or E18.5 For the DiI and DiA tracing experiments, wild type embryos (CD1 background) were additionally used as controls.
Immunohistochemistry
Embryos were decapitated and fixed in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) overnight at 4°C. After washes in PBS, heads were cryoprotected by immersion in 30% sucrose in PBS, embedded in OCT Compound and sectioned using a cryostat at 10µm.
Cryo-sections were let to stabilize at room temperature for at least 2 hours and then washed three times in PBST (1X PBS with 0.1% Triton X-100, Sigma). To block endogenous peroxidase, sections were treated with 3% H2O2 for 10 minutes. After PBS washes, antigen retrieval was performed by immersing the sections in Sodium Citrate buffer (10mM, pH6) heated at approximate 90°C using a microwave for 20 minutes. Sections were then incubated with the rabbit polyclonal anti-Pax6 (1:200, BioLegend Cat # 901302) overnight at 4°C. The secondary antibody (goat anti-rabbit bioninylated, 1:200, Vector laboratories Cat # BA-1000) was incubated for 1 hour at room temperature followed by a 30-minute incubation with Avidin-Biotin complex (ABC kit, Vector laboratories Cat # PK6100). Finally, diaminobenzidene (DAB, Vector Laboratories, Cat # SK4100) reaction was used to obtain a brown precipitate and sections were mounted in DPX media (Sigma-Aldrich, Cat # 06522).
For immunofluorescence, cryosections were incubated overnight at 4°C with the following primary antibodies: rat monoclonal anti-Neural Cell Adhesion Molecule L1 (1:500 Millipore, Cat # MAB5272, clone 324), rabbit polyclonal anti-Pax6 (1:200, BioLegend Cat # 901302), goat polyclonal anti-GFP (1:200, Abcam Cat # ab6673), rabbit polyclonal anti-GFP (1:200, Abcam Cat # ab290). The following secondary antibodies from Thermo Fisher Scientific were incubated at room temperature for one hour: Donkey anti-rat Alexa488 (1:100, Thermo Fisher, Cat # A-21208), Donkey anti-rat Alexa594 (1:100, Thermo Fisher, Cat # A-21209), Donkey anti-rabbit Alexa568 (1:100, Thermo Fisher, A10042), Donkey anti-rabbit Alexa488 (1:100, Thermo Fisher Cat # R37118), Donkey anti-goat Alexa488 (1:100, Invitrogen, Cat # A11055).
Sections were counterstained with DAPI (Thermo Fisher Scientific, Cat # D1306) and mounted in ProLong Gold Antifade Mountant (Thermo Fisher Scientific, Cat # P36930).
In situ hybridization
In vitro transcription of digoxigenin-labelled probes was done with DIG RNA-labeling kit (Sigma-Aldrich, Cat # 11175025910). The following digoxigenin-labelled probes were synthetized in the lab from cDNA: Ntn1 (kindly donated by Dr Thomas Theil; forward primer: CTTCCTCACCGACCTCAATAAC, reverse primer: GCGATTTAGGTGACACTATAGTTGTGCC TACAGTCACACACC), Sema3a (forward primer: ACTGCTCTGACTTGGAGGAC, reverse primer: ACAAACACGAGTGCTGGTAG), Plxna1 (forward primer: GACGAGATTCTGGTGGCTCT, reverse primer: CATGGCAGGGAGAGGAAGG), DCC (forward primer: AACAGAAGGTCAAGCACGTG, reverse primer: CAATCACCACGACCAACACA), Unc5a (forward primer: CTGTCAGACCCTGCTGAGT, reverse primer: GGGCTAGAGTTCGCCAGTC), Unc5d (forward primer: GGACAGAGCTGAGGACAACT, reverse primer: GTATCAAACGTGGCGCAGAT). Unc5c probe was kindly donated by Dr. Vassiliki Fotaki, University of Edinburgh, UK and Dr Suran Ackerman, UCSanDiego, USA). Cryosections were processed for in situ hybridization (ISH) using standard protocols. Some slides were counterstained for nuclear fast red (Vector Laboratories, Cat# LS-J1044-500).
Axon Tract Tracing
For cortical injections, brains were dissected between E15.5 and E18.5 and fixed in 4% PFA in PBS at 4°C for at least 48 hours. After washes in PBS, filter paper impregnated in DiI (NeuroVue Red, Molecular Targeting Technologies, Cat # FS-1002) and DiA (NeuroVue Jade, molecular Targeting Technologies, Cat # FS-1006) was inserted approximately in the somatosensory and visual areas of the cortex, respectively. Brains were incubated at 37°C in PBS for 4 weeks to allow the diffusion of the tracers.
For thalamic injections in fixed tissue, embryos were dissected at E13.5 and fixed overnight in 4%PFA in PBS at 4°C. After PBS washes, brains were cut in half at the midline and DiI was inserted in the thalamus using a fine probe. Brains were incubated for 1 week in PBS at 37°C.
Brains were then cryoprotected in 30% sucrose, embedded in OCT Compound and sectioned in a cryostat at 30µm. Sections were counterstained with DAPI diluted 1:1000 in distilled water.
For thalamic injections in non-fixed tissue, we applied neurobiotin (Vector Laboratories, Cat # SP-1120), and amino derivative of biotin used as an intracellular label for neurons. The tracer in powder was held at the tip of an entomological needle (00) and recrystallized using vapour from distilled water. Brains were cut in half and the crystal was inserted in the thalamus. Brains were then immersed in continuously oxygenated Ringer (124mM NaCl, 5mM KCl, 1.2mM KH2P04, 1.3mM MgSO4 7H2O, 26mM NaHCO3, 2.4mM CaCl2 2H2O, 10mM glucose) and incubated overnight at RT.The tissue was fixed in 4% PFA in PBS overnight at 4°C, washed in PBS, cryoprotected in 30% sucrose and sectioned in a cryostat at 10µm. Neurobiotin was visualized by incubating the sections with either Strep488 or Strep546.
Thalamic explants and slice culture
E13.5 embryos were dissected, embedded in 4% low melting temperature agarose (Lonza, Cat # 50100) and sectioned in a vibratome to produce 300µm-thick coronal slices. Lateral or medial thalamic explants were dissected from slices belonging to GFP-positive embryos and transplanted into equivalent rostral/caudal slices belonging to GFP-negative embryos (see schemas in Fig. 5). The thalamus and its different medio-lateral regions were recognized under the dissecting scope by anatomical landmarks. Slices were then cultured for 72 hours in floating membranes (Whatman nuclepore track-etched membranes, Cat# WHA110414) over serum-free Neurobasal medium (Thermo Fisher Scientific, Cat# 21103049) in 60mm center well organ culture dishes (Falcon, Cat# 353037). Cultures were fixed in 4% PFA overnight at 4°C, cryoprotected in 30% sucrose and cryosectioned at 10µm to be processed for immunofluorescence.
Quantifications of numbers of axons and bundle width
Images were blinded-analysed for at least three embryos for each condition. We positioned three lines across the prethalamus (as specified in Results) and generated a L1 intensity profile using Fiji Software (Schindelin et al., 2012). Intensity profiles were then processed by tracing a line at an arbitrary (but constant for all quantifications) intensity level and quantifying the number and width of bundles crossing the line. Statistical significance was assessed applying two-tailed unpaired Student’s t-test and N=3.
3D reconstruction
We used Free-D software (Andrey and Maurin, 2005) to reconstruct the structure of thalamus and prethalamus from transverse slices stained with DAPI and antibodies against L1 and Pax6 to reveal the thalamocortical tract and the limits of the diencephalic structures, respectively. The thalamus territory was recognisable by an intense DAPI staining and Pax6-negative mantle zone, contrasting with prethalamus and pretectum, which express high levels of Pax6 in the postmitotic neurons. The location of the signalling molecules was included in the model by comparison of transversal and sagittal sections stained for Ntn1 and Sema3a and their adjacent sections processed for Pax6 and L1 with the sections used to build the model scaffold. Dots are representation of staining density.
Microscopy and imaging
ISH and IHQ images were taken with a Leica DMNB microscope coupled to a Leica DFC480 camera. Fluorescence images were taken using a Leica DM5500B automated epifluorescence microscope connected to a DFC360FX camera. Image panels were created with Adobe Photoshop CS6.
Competing interests
No competing interests.
Funding
This work was supported by a Marie Curie Fellowship from the European Commission [624441]; a Medical Research Council UK Research Grant [N012291] and a Biotechnology and Biological Sciences Research Council UK Research Grant [N006542].
Acknowledgements
We thank Dr Vassiliki Fotaki for providing the Unc5c probe.