Summary
Spine morphogenesis requires the integration of multiple musculoskeletal tissues with the nervous system. Cerebrospinal fluid (CSF) physiology is important for development and homeostasis of the central nervous system and its disruption has been linked to scoliosis in zebrafish [1, 2]. Suspended in the CSF is an enigmatic glycoprotein thread called the Reissner fiber, which is secreted from the subcomissural organ (SCO) in the brain and extends caudally through the central canal to where it terminates at the base of the spinal cord. In zebrafish, scospondin null mutants are unable to assemble the Reissner fiber and fail to extend a straight body axis during embryonic development [3]. Here, we describe zebrafish hypomorphic missense alleles, which assemble the Reissner fiber and straighten the body axis during early embryonic development, yet progressively lose the fiber, concomitant with the emergence of body curvature, alterations in neuronal gene expression, and scoliosis in adults. Using an endogenously tagged scospondin-GFP zebrafish knock-in line, we directly visualized Reissner fiber dynamics during the normal development and during the progression of scoliosis, and demonstrate that the Reissner fiber is critical for the morphogenesis of the spine. Our study establishes a framework for future investigations of mechanistic roles of the Reissner fiber including its dynamic properties, molecular interactions, and how these processes are involved in the regulation of spine morphogenesis and scoliosis.
Highlights
Hypomorphic mutations in zebrafish scospondin result in progressive scoliosis
The disassembly of the Reissner fiber in scospondin hypomorphic mutants results in the strong upregulation of neuronal receptors and synaptic transport components
An endogenous fluorescent knock-in allele of scospondin reveals dynamic properties of the Reissner fiber during zebrafish development
Loss of the Reissner fiber during larval development is a common feature of zebrafish scoliosis models
Results and Discussion
Adolescent idiopathic scoliosis (AIS) is a complex and common disorder causing curvature of the spine. Despite accumulating evidence pointing to its heritable nature, the underlying causes are not well established. Recent efforts showed that AIS-associated variants in the centrosomal protein gene POC5 lead to cilia defects in cell culture, and generate spine deformities when expressed in zebrafish [4, 5]. Moreover, defects in motile ependymal cell cilia leading to disruption of cerebrospinal fluid (CSF) physiology in zebrafish is also associated with scoliosis, resembling AIS [1, 2]. However, the mechanisms linking cilia and CSF defects to the onset of spine curvature in these models remain unresolved. The Reissner fiber is an enigmatic glycoprotein thread suspended in CSF of the brain and central canal of the spinal cord [6]. The chief component of the fiber is Scospondin glycoprotein, which is secreted from the sub-commissural organ (SCO) of the brain and accumulates as a structured polymer or thread [7]. Zebrafish scospondin null mutants produce no detectable Reissner material, fail to assemble a Reissner fiber, and display a ventral curled-down phenotype, due to a failure in straightening the body axis during embryonic development [3]. Similar defects in morphogenesis of the body axis during embryonic development have long been observed in zebrafish mutants, impaired in genes important for ciliogenesis or cilia motility [8–10] and many of these are observed with defects in Reissner fiber assembly [3]. Despite the clear contribution of CSF physiology and the Reissner fiber in body axis morphogenesis during embryonic development, it is not clear how disruptions of these processes are regulating spine morphogenesis during larval development and in the adults.
After a forward genetic screen for adult-viable scoliosis mutant zebrafish (Gray, R.S. and Solnica-Krezel, L. unpublished), whole genome sequencing, mapping, and variant calling of two non-complementing scoliosis mutations (Figure S1H, I), we identified two recessive missense alleles of the scospondin gene, scospondinstl297 and scospondinstl300, which both disrupt evolutionarily conserved cysteine residues at independent regions of the protein (Figure S1J, K). For each allele, incross of heterozygous carriers produced morphologically normal embryos. However, at approximately two weeks postfertilization, ∼25% of the larvae displayed scoliosis in the dorsal-ventral (Figure 1B and S1B, D) and medial-lateral (Figure 1B’ and S1B’) axes, without obvious vertebral malformation. These dysmorphologies and their developmental onset resemble spine pathologies observed in adolescent idiopathic scoliosis in humans.
MicroCT analysis in developmentally-matched adult zebrafish at 90dpf revealed that scospondinstl297 and scospondinstl300 mutants exhibited similarities in 3D spine curvature, as well as abnormalities in bone morphology and mineralization (Figure S2). On average, patterns of sagittal and lateral displacements from midline were similar in both mutants, and most severe in posterior vertebrae (Figure S2B-C, B’-C’). In regard to bone phenotypes, both scospondinstl297 and scospondinstl300 mutants exhibited mildly increased bone mass (i.e., increased volume and thickness, Figure S2E-G, K-M and E’-G’, K’-M’) and mineralization (i.e., increased tissue mineral density, Figure S2H-J and H’-J’), perhaps as a response to increased mechanical loading of the spine after deformity. Neither mutant exhibited significant differences in centrum length (Figure S1A, A’), indicating that differences in body length were attributable to increased spinal curvature, rather than shortened or compressed vertebrae. When comparing phenotypic severity in mutant alleles (Figure S2N, O), z-scores for curvature indices were higher for scospondinstl297 compared to scospondinstl300 mutants, whereas z-scores for bone indices were generally lower.
For both alleles, incross of homozygous adult scoliosis mutant zebrafish resulted in 100% maternal zygotic (MZ) scospondin mutants. Which like zygotic mutants had overtly normal morphology as embryos, but displayed body curvatures by 13 dpf and adult-viable scoliosis at 2 months (Figure 1C, E and S1D). Complementation testing of scospondinstl297/+ heterozygous mutants with scospondinΔ16/+ heterozygous null mutants (allele described in Rose et al., co-submission) resulted in adult-viable transheterozygous scospondinstl297/Δ16 scoliosis mutants (27.1%, n=236), which phenocopied scospondinstl297/stl297 and scospondinstl300/stl300 mutants. Furthermore, complementation testing of scospondinstl297/+ heterozygous mutants with scospondinstl300+ heterozygous mutants resulted in scoliosis at 13dpf (22.7%, n=198, Figure S1E). Altogether these results confirm that scospondinstl297 and scospondinstl300 are independent hypomorphic mutations of scospondin which cause viable larval and adult scoliosis in zebrafish.
A previous report of homozygous scospondinicm13 null mutants demonstrated a severe posterior ventral curve down phenotype at 3 dpf [3]. In contrast, the majority of MZscospondinstl297 mutants developed a straight body axis out to 5 dpf (Figure S3A), while a few were observed with subtle axial curves (37%; n=150) (Figure S3B), which increased in both incidence and severity as larval development proceeded, out to 13 dpf when the majority of larvae displayed axial curvatures (94.7%; n=113)(Figure 1C, E). A similar progression of body curvature was observed in ∼50% of progeny when homozygous scospondinstl297 mutants were crossed to heterozygous scospondinstl297/+ mutant carriers, without obvious maternal effect (Figure 1C).
Scospondin protein is a large, heavily glycosylated protein composed of several repeating, well-conserved domains, established early in phylogeny [11, 12] (Figure S1L). Confirmed scospondinstl297 mutant carriers are heterozygous for a T6784A (ENSDART00000097773.4) mutation (Figure 1F and Figure S1J), predicted to alter cysteine 2262 to serine (C2262S), which is located in a conserved low-density lipoprotein (LDL) receptor domain. Homology modeling of Danio rerio Scospondin protein sequence maps onto a crystal structure of very low-density lipoprotein receptor (6byv)(https://swissmodel.expasy.org/). This model suggests the scospondinstl297 mutation could disrupt a conserved cysteine disulfide bond (CysIV-CysVI) of the LDL receptor type A motif (Figure 1G, I), which is known to be involved in protein stability of the LDL receptor [13]. Confirmed scospondinstl300 mutant carriers are heterozygous for a T2635A mutation (Figure 1F and Figure S1K), predicted to alter cysteine 879 to serine (C879S), which is a highly-conserved cystiene adjacent to a trypsin inhibitor like cysteine-rich domain (Figure 1H). Homology modeling for this residue was unsuccessful.
In order to investigate the Reissner fiber in scospondin mutant zebrafish, we utilized an established antiserum raised against bovine Reissner fiber (AFRU) [14] for immunofluorescence. In contrast to observations in scospondin null mutants which fail to form a Reissner fiber at 3 dpf [3], we observed no defects in the assembly of the Reissner fiber in heterozygous scospondinstl297/+ (Figure 2A) or MZscospondinstl297 mutant embryos (Figure 2B). At 5 dpf, we observed AFRU-labeled Reissner fiber and expression in the floor plate and terminal ampulla region at the base of the spinal cord in all heterozygous scospondin297/+ mutant larvae (100%, n=7) (Figure 2C,E). Similarly, many of the MZscospondinstl297 larvae were observed with identical AFRU-labeled expression patterns (58%; n=19)(Figure 2D). However, several of these mutants were observed without an intact Reissner fiber or in some cases displayed only a bolus of AFRU-stained material in the central canal (42%; n=19)(Figure 2F). The presence of an intact Reissner fiber was directly correlated with a straight body axis (100%, n=11). By contrast, the absence of the Reissner fiber in these mutants was directly correlated with the onset of subtle axial curvatures in these MZscospondinstl297 mutants (100%; n=8). At 10 dpf, all scospondin297/+ heterozygous mutant larvae (100%, n=7) displayed a straight body axis with an intact Reissner fiber (Figure 2G), while all the MZscospondinstl297 mutants displayed a complete absence of the Reissner fiber (100%, n=5) and axial curvatures (100%; n=5) (Figure 2H). At 10 dpf, we also consistently observed puncta of AFRU-stained Reissner material at the apical surface of individual floor plate cells in heterozygous scospondinstl297/+ controls (Figure 2G), which was routinely accumulated at the basal surface of floor plate cells in the mutants at this stage (Figure 2H). Loss of Reissner fiber and atypical polarity of the Reissner material in the floor plate was also observed in MZscospondinstl300 at 10dpf (100%, n=6) (Figure S1F, G). We speculate that this may reveal a defect in the polarized secretion of Reissner material from the floor plate, which is a tissue that is known to assist in Reissner fiber assembly in zebrafish embryos [15]. In summary, we have shown that disruption of two independent, evolutionarily-conserved cysteine residues lead to disassembly of the Reissner fiber and scoliosis. It is tempting to speculate that these mutations lead to a cumulative failure of Scospondin/Reissner material secretion from the SCO and floor plate tissues during larval development. Altogether, these data suggest that the Reissner fiber has a continuous and instructive role in spine morphogenesis in zebrafish.
A critical question still remains of how the Reissner fiber contributes to spine morphogenesis. To address this, we sequenced bulk transcriptomes of heterozygous scospondinstl297/+ and MZscospondinstl297 mutants at three stages of spine development to capture: the beginning stages of Reissner fiber disassembly in early larvae (5 dpf), a late larval time-point to encompass robust axial curvature and complete loss of the Reissner fiber (15 dpf), and during skeletal maturation and robust scoliosis in the mutants (30 dpf). We generated three independent cDNA libraries for RNA sequencing at each developmental time point.
The most robust variation of differentially expressed genes amongst all samples was observed at 5 dpf (Figure 2I). Gene ontology analysis of differentially expressed genes at 5 dpf using high stringency (p<10-7) [16] revealed a strong upregulation of genes involved in transmembrane transporter activity, specifically for multiple ionotropic glutamatergic receptors, voltage-dependent calcium receptors, and a variety of related synaptic transport components in MZscospondinstl297 mutants (Figure S3C and Table S1). Analysis of the gene ontology did not reveal significant enrichment of function in downregulated genes. These data support the notion that the Scospondin-containing Reissner fiber is required for the regulation of aspects of neuronal development (e.g. glutamatergic neurons) in larval zebrafish, which may contribute disruption of normal neuromuscular developmental programs leading to the onset of axial curvatures through. Indeed, Scospondin has been previously shown to affect neurogenesis in vitro [17, 18]. The specific nature of any alterations in neuromuscular development at a cellular and physiological level in the scospondin hypomorphic mutant zebrafish alleles presented here, requires further investigation.
To monitor the dynamic properties of the Reissner fiber during axis straightening we engineered a fluorescent scospondin knock-in allele (scospondin-GFPut24) in zebrafish. In brief, we used CRISPR/Cas9 to promote a targeted double strand break within the last exon of the scospondin gene and an EGFP donor cassette with homology arms for in-frame C-terminal tagging (Figure S4A). From the resulting adult F0 fish, we isolated a single founder male by (i) PCR screening for EGFP sequence in genomic DNA from isolated sperm samples; (ii) by confocal imaging of outcrossed progeny; and (iii) by co-localization with AFRU immunofluorescence (see methods). At 3 dpf, we observed Scospondin-GFP expression as an extremely straight Reissner fiber extending from head to tail (Figure 3A-B’ and S4B). In the head, we observed Scospondin-GFP expression in the most rostral SCO and in the flexural organ (Figure 3A, A’ and S4B-C’). In the tail, we observed expression in the floor plate and the Reissner fiber ending as a coiled mass within the terminal ampulla at the base of the spinal cord (Figure 3B, B’ and S4B’). We continue to observe the presence of the Scospondin-GFP labeled Reissner fiber and terminal ampulla in young adult fish (Figure S4D, D’). As expected, endogenous Scospondin-GFP expression is similar to previously reported expression patterns in zebrafish based on Reissner fiber antibodies and whole-mount scospondin gene expression [3, 12]. In agreement, Scospondin-GFP expression in scospondin-GFPut24, knock-in zebrafish displayed tight colocalization (Pearson’s R value, 0.98) with the expression pattern of AFRU antiserum expression [14] (Figure 3C-E).
To describe the dynamics of the Reissner fiber assembly during development we used confocal time lapse imaging in scospondin-GFPut24/+ embryos during tail morphogenesis. We first observed the assembly of Scospondin-GFP-labeled fiber in the rostral spinal canal ∼20.5 hours post fertilization (hpf) (red bracket, Figure 3F and Video S1). Shortly after, we also observed a larger fiber of Scospondin-GFP extending more caudally (red bracket, Figure 3G, H). This Scospondin-GFP material was also observed to accumulate as a bolus of material (red arrows, Figure 3I, J), which was observed to rapidly travel in a rostral to caudal direction to join established Scospondin-GFP labeled fiber at the end of the spinal cord (Figure 3K). During robust axial elongation (2-3dpf), we observed a highly dynamic breakdown and distribution of Scospondin-GFP signal outward from the terminal ampulla and into the developing fin fold (Video S2). It has long been suspected that the Reissner fiber continually grows in a rostral-caudal direction [19], consistent with the observations of directional transport of labeled-monoamines along the fiber in rat [20]. To quantify fiber motility during zebrafish development, we photobleached Scospondin-GFP-labeled Reissner fiber to mark regions for tracking (Figure 3L and Video S3). At various stages of development, we observed that photobleached regions of the Reissner fiber always traveled in a continuous rostral to caudal direction. The average speed at 3 dpf was 220+87nm/sec. In contrast, at 5 and 7 dpf the speed of the fiber was significantly slower (70+14nm/sec and 70+24nm/sec, respectively; t-test; p=1.37×10-5; Figure 3L, M). Using high-speed imaging (10Hz) at higher magnification we also observed rapid movement of Scospondin-GFP-labeled puncta along the Reissner fiber in a rostro-caudal direction, which were occasionally observed to extend away from the fiber, towards the floor plate, and retract back into the bulk Reissner fiber (Figure S4E, Video S4). In summary, we have described several dynamic properties of Reissner fiber during early zebrafish development by endogenous fluorescent Scospondin-GFP expression. This knock-in strain and observations set the stage for future studies aimed at defining molecular interactions of the Reissner fiber and the mechanisms driving the rostro-caudal motility of the fiber.
As scospondin-GFPut24 is an endogenous knock-in into a wild-type allele, we are currently precluded from dynamic imaging of the Reissner fiber in the hypomorphic scospondin mutants reported here, using this approach. However, there are obvious phenotypic similarities between scospondin hypomorphic mutants and other cilia-related scoliosis mutants described previously [1, 2]. We hypothesized that the loss of the Reissner fiber is a common phenotype associated with the onset of scoliosis in zebrafish. To test this, we crossed scospondin-GFPut24 to a dominant enhancer-trap transgenic scoliosis mutant, Et(druk-GFPdut26/+). This mutant was generated by a fortuitous, Tol2-GFP integration which displays a unique GFP-expression pattern which is tightly linked with the onset of adult-viable scoliosis (98%; n=981), without vertebral malformation (Gray, R.S., McAdow, A.R., Solnica-Krezel, L. and Johnson, S.L., unpublished). At both 3 and 5 dpf, all Et(druk-GFPdut26/+);scospondin-GFPut24/+ double mutant, knock-in larvae displayed Scospondin-GFP-labeled Reissner fiber (Figure 4A-B’). However, at the onset of scoliosis in Et(druk-GFPdut26/+);scospondin-GFPut24/+ mutants, we observed a consistent loss of Reissner fiber (100%; n=9)(Figure 4D, D’). Mutations in the kinesin family member 6 (kif6) gene cause a loss of ependymal cell cilia and scoliosis, without vertebral malformations in zebrafish [1, 21]. We assayed the Reissner fiber using AFRU immunostaining in kif6sko/sko mutants which begin to display subtle axial curvatures at 3dpf [21]. Interestingly at this time, we also observed strong defects of Reissner fiber assembly (Figure 4F), with only occasional tangles (Figure 4F’) or puncta (Figure 4F’’) of Reissner material present. Altogether the loss of Reissner fiber in two independent models of scoliosis confirms it role in the homeostasis of the straight body axis and spine morphogenesis in zebrafish.
Since the discovery of the Reissner fiber multiple hypotheses have been proposed for its function including, detoxification and transport of molecules in CSF [20], neurogenesis during early brain development [17, 18], and through its direct interaction with the ciliated CSF-contacting neurons lining the central canal, as a mechanosensory organ controlling the “flexure of the body” [22, 23]. Moreover, earlier work in amphibians demonstrated that the resection of the SCO disrupted Reissner fiber assembly, led to scoliosis in some animals [24, 25]. Here, we demonstrated that two independent, evolutionally-conserved cysteine residues in Scospondin are critical for stability of the Reissner fiber during larval development. One of these cysteines (C2262) is predicted to form a disulfide bridge in one of several canonical LDL receptor A domains found in Scospondin. Interestingly, the LDL protein Apolipoprotein B has been directly visualized in the central canal in zebrafish [26] and is found in the CSF of rat and humans by proteomic analysis [27–29]. Apolipoprotein B is also an important neurogenic factor in vitro [30], is important for brain development in mice [31], and forms a complex with Scospondin CSF which can synergistically modulate neurodifferentiation in organotypic brain culture [32]. For these reasons, it is tempting to speculate that the C2262S mutation may also disrupt important LDL interactions with the Reissner fiber, causing alterations in neuronal differentiation in scospondinstl297 mutant zebrafish. Our results using a variety of genetic manipulations now demonstrate that the intact and likely dynamic nature of the Reissner fiber in vivo, is required for maintaining a straight body axis and spine morphogenesis. Whereas its disassembly is driving alterations in neuronal gene expression and the onset of atypical axial curvature, which leads to progressive scoliosis in adult zebrafish. Our study opens up a new field of exploration of the mechanisms of Reissner fiber dynamics, the importance of molecular interactions of the fiber and CSF components for neuronal development, and whether these mechanisms are more generally applicable for scoliosis in humans.
STAR METHODS
LEAD CONTACT AND MATERIALS AVAILABILITY
Further information and requests for reagents should be directed to the lead contact, Ryan S. Gray (ryan.gray{at}austin.utexas.edu).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Zebrafish Maintenance and Care
All experiments were performed according to University of Texas at Austin IACUC standards. Wild type AB strains were used unless otherwise stated. Embryos were raised at 28.5 °C in fish water (0.15% Instant Ocean in reverse osmosis water) and then transferred to standard system water at 5dpf.
WGS / WES analysis
Phenotypic, mutant zebrafish were pooled and submitted for sequencing. Non-phenotypic wild type and heterozygous siblings were pooled together and submitted for sequencing. Raw reads were aligned to zebrafish genome GRCz10 using bwa mem (v0.7.12-r1034) with default parameters and were sorted and compressed into bam format using samtools (v1.6) [33]. Variants were called using bcftools (v1.9) functions mpileup, call, and filter. mpileup parameters “-q 20” and “-Q 20” were set to require alignments and base calls with 99% confidence to be used and filter parameters “-s LowQual -e ’%QUAL<20’” were used to remove low quality variant calls. Variants were then annotated and filtered by an in-house pipeline. Briefly, variants occurring with the same allele frequency between phenotypic and aphenotypic samples were filtered from further analysis as were variants that were not called as being homozygous in the phenotypic sample. Variants in the mutant samples that were homozygous for the wild type allele were also excluded. Variants found in the dbSNP database (build v142) of known variants were also filtered out and excluded from further analysis. The wild type and mutant alleles at each variants site were tabulated, and the Fisher p-value was calculated for each variant site. These remaining variants classified based on their genomic location as being noncoding site variants, coding site variants, or variants that may affect gene splicing using zebrafish Ensembl annotation build v83. For coding site variants, the amino acid of the wild type allele and the mutant allele were determined from the Ensembl annotation. The p-values were plotted against genomic location, and a region of homozygosity in the genome with a cluster of small p-values was found. Variants occurring within this region of homozygosity were manually prioritized for nonsynonymous mutations in genes.
MicroCT scanning and analysis
MicroCT scanning was performed as previously described [34]. All analyses were performed in precaudal and caudal vertebrae only (we refer to the 1st precaudal vertebrae as vertebra 1). For analysis of spinal curvature, centrum centroid positions were identified in maximum intensity projections. A line was drawn connecting the first and last vertebrae. The absolute value of the displacements from this line were computed in the sagittal and frontal planes to compute Sagital Displacement (Sag.Disp) and Lateral Displacement (Lat.Disp) for vertebrae 1-20. For analysis of bone, FishCuT was used to quantify Length (Le), Volume (Cent.Vol), Tissue Mineral Density (TMD), and Thickness (Th) in the Centrum (Cent), Neural Arch (NA), and Haemal Arch (Haem) for vertebrae 1-16 [34]. Computation of standard scores, z-scores, and statistical testing using the global test were performed as previously described [34, 35].
Generation of endogenously tagged scospondin-GFPut24 allele
CRISPR/Cas9 targets were chosen using CHOPCHOP and guides were synthesized according to the CHOPCHOP protocols (Montague et al., 2014; Labun et al., 2016, 2019). The last exon of scospondin was targeted with the CRISPR guide AGTGTACCAGCTGCCAGGGTGGG (PAM underlined) predicted to cut 6 bp upstream of the stop codon. To generate an sgRNA guide, an oligo containing a T7 promoter, gene-specific targeting sequence, and annealing region was synthesized (Sigma-Aldrich). This oligo was annealed to a generic CRISPR oligo using CloneAmp Hifi Polymerase. RNA was synthesized using the NEB HiScribe T7 RNA synthesis kit and purified with the Zymo RNA Clean and Concentrator-5 kit.
A plasmid was constructed to serve as a donor. The plasmid contained 5’ and 3’ homology arms (776 and 532 bp respectively) flanking the eGFP coding sequence (720bp). The donor was constructed such that the PAM would be abolished and the eGFP coding sequence would be inserted just before the endogenous stop codon. The homology arms were cloned from wild-type AB* zebrafish DNA and eGFP was cloned from the p3E-2AnlsGFP plasmid (Kwan et al., 2007) using Clontech Hifi polymerase mix. These three fragments were purified (NucleoSpin Gel and PCR Clean-up, Machery-Nagel #740609) and Gibson cloned into the EcoRI site of pCS108 using the In-Fusion HD Cloning kit (Clontech) following manufacturer protocols.
Wild type AB zebrafish were incrossed and one-cell embryos were injected with 1nL of injection mix containing 5µM EnGen Spy Cas9 NLS (NEB #M0646), 100 ng/µL sgRNA, and 25 ng/µL donor plasmid. Once the embryos reached adulthood, sperm was collected from F0 males and DNA was extracted by diluting sperm into 50uL of 50mM NaOH and heated to 95°C for 40 minutes. PCR was performed with GFP-specific primers using GoTaq Green Master Mix (Promega #M7123). Males that generate an amplicon after PCR were outcrossed to WT AB females, and the progeny were screened for GFP expression in the SCO and Reissner Fiber.
Skeletal preparation
Animals were euthanized in tricaine and fixed in 10% formalin overnight, then incubated in acetone overnight. Acetone was washed away with water, and animals were stained with Bone/Cartilage Stain (0.015% Alcian Blue, 0.005% Alizarin Red, 5% Acetic Acid, 59.5% Ethanol) at 37°C overnight, and cleared in 1% KOH for days to weeks depending on the size of the fish. The fish were then moved to 25%, 50%, and then 80% glycerol and imaged.
AFRU immunofluorescence of Reissner Fiber
Animals were euthanized with high dose tricaine (MS-222), and then fixed in ice-cold methanol overnight. Animals were washed in PBSTr (1x PBS with 0.1% Triton X-100), blocked with 10% normal goat serum in 1x PBS with 0.5% Triton X-100. AFRU primary antibody was shared by Esteban Rodriguez (Rodríguez et al., 1984) and used at 1:2000 dilution in blocking solution overnight at room temperature. Specimens were then washed and stained with secondary goat anti rabbit H+L Alexa488 at 1:1000 overnight at 4°C, washed in PBSTr and counterstained with DAPI. Specimens were immobilized in 1% low-melt agarose in 1x PBS and imaged with a Nikon Ti2E with a CSU-W1 spinning disc confocal system.
RNA sequencing
Library preparation was performed with 10ng of total RNA, integrity was determined using an Agilent bioanalyzer. ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Clontech) per manufacturer’s protocol. cDNA was fragmented using a Covaris E220 sonicator using peak incident power 18, duty factor 20%, cycles/burst 50, time 120 seconds. cDNA was blunt ended, had an A base added to the 3’ ends, and then had Illumina sequencing adapters ligated to the ends. Ligated fragments were then amplified for 12 cycles using primers incorporating unique index tags. Fragments were sequenced on an Illumina NovaSeq using paired end reads extending 150 bases.
RNA Quantification and Statistical Analysis
Raw reads were first trimmed using cutadapt to remove low quality bases and reads [36]. Trimmed reads were then aligned to zebrafish genome GRCz10 with ensembl annotation v83 using STAR (v2.5.4) with default parameters [37]. Transcript quantification was performed using featureCounts from the subread package (v1.4.6-p4) [38]. Differential expression analysis was performed by using the R package DESeq2 in negative binomial mode using quantified transcripts from featureCounts [39]. A two-fold expression change, expression higher than 1CPM, and a Benjamini and Hochberg false discovery rate less than 0.05 were set as a cutoff for a gene to considered differentially expressed.
DATA AVAILABILITY
RNAseq data (GSE138842) and WGS/WES sequencing data (GSE138920) generated during this study are available at the SRA browser.
Video S1. Confocal time-lapse inverted greyscale maximum intensity projection of scospondin-GFPut24/+ knock-in embryos during tailbud development (20-30 hpf) acquired at 5 min intervals. Time stamp is hr:min.
Video S2. Confocal time-lapse inverted greyscale maximum intensity projection of scospondin-GFPut24/+ knock-in embryos imaging the tail region during axial extension (2-3 dpf).
Video S3. Confocal time-lapse inverted greyscale maximum intensity projection of scospondin-GFPut24/+ knock-in embryos with photobleaching of the Reissner fiber (3 dpf).
Video S4. High-speed (10 Hz) confocal time-lapse inverted greyscale maximum intensity projection of the Reissner fiber in scospondin-GFPut24/+ knock-in embryos (3 dpf). Still images in Figure S4E.
Table S1. List of differentially expressed genes in 5dpf MZscospondinstl297 mutants. Significantly altered genes were identified with DEseq2 analysis.
Acknowledgements
We thank Esteban Rodriguez and Maria Montserrat Guerra (Universidad Austral de Chile) for their generous gift of the AFRU antiserum. We thank Sierra Szkrybalo for assistance with zebrafish experiments. We thank Drs. John Wallingford and Claire Wyart for critical comments this manuscript. We thank the Genome Technology Access Center in the Department of Genetics at Washington University School of Medicine for help with genomic analysis. The Center is partially supported by NCI Cancer Center Support Grant #P30 CA91842 to the Siteman Cancer Center and by ICTS/CTSA Grant# UL1TR002345 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH), and NIH Roadmap for Medical Research. This publication is solely the responsibility of the authors and does not necessarily represent the official view of NCRR or NIH. Research reported in this publication was supported in part by a grant from Spinal Cord Injury/Disease Research Program (SCIDRP) (LSK and Steve Johnson), the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health under Award Number R01-AR072009 to (R.S.G.) and by the National Institute for Child Health and Human Development of the National Institutes of Health under Award Number P01HD084387.
Footnotes
In Brief - Troutwine et al. show that missense mutations in zebrafish scospondin lead to a gradual destabilization of the Reissner fiber resulting in spine curvatures that resemble human idiopathic scoliosis. Tagging the Reissner fiber with a fluorescent protein in vivo, reveals it is extremely dynamic, continuously treadmilling from head-to-tail during development in zebrafish. Finally, they demonstrate that disassembly of the Reissner fiber is a common mechanism driving the progression of scoliosis in zebrafish.
This version has been edited for clarity. The previous version of the manuscript was not the final version submitted for review. BRT