Le.MAPK and its interacting partner, Le.DRMIP, in fruiting body development in Lentinula edodes

doi:10.1016/j.gene.2007.01.030

Gene

Volume 393, Issues 1–2, 15 May 2007, Pages 87-93

https://doi.org/10.1016/j.gene.2007.01.030 Get rights and content

Abstract

Development in shiitake mushroom, Lentinula edodes, is a unique process and studies of the molecular basis of this process may lead to improvement in mushroom cultivation. Previous studies have identified a number of signal transduction genes related to mushroom development, but those genes have not been well characterized. The present work characterized a developmentally regulated MAP kinase, Le.MAPK, and its interaction with a novel gene, Le.DRMIP in the signal transduction pathway. The expression profiles of these two genes reveal their importance in fruiting body initiation and development; the Le.DRMIP transcript is localized predominantly in the developing young fruiting body and gills, which further signifies its role in cell differentiation during mushroom development.

Introduction

Lentinula edodes, the Shiitake mushroom, is the second most popular mushroom in the world. It has commercial value, since it is a favorite food with high nutritional and medical importance (Kues and Liu, 2000). Studies of the initiation and development of the fruiting body will further improve cultivation of L. edodes and other mushrooms, since the details of the molecular mechanism are still unclear. Previous studies of fruiting body development in L. edodes include the isolation and differential profiling of the expression of various enzymes (Zhao and Kwan, 1999, Zhao et al., 2000, Ohga and Royse, 2001), isolation of differentially expressed signal transduction genes such as ras (Hori et al., 1991), and identification of developmentally expressed genes, including a MAP kinase homolog Le.MAPK, from the primordium of L. edodes (Leung et al., 2000).

Mitogen-activated protein kinase (MAPK) is one of the important signal transduction proteins in cascades that regulate growth and development in many organisms. It is regulated by the phosphorylation cascade of upstream MAPK kinase (MEK) and MEK kinase (MEKK), and MAPK regulates downstream effectors such as transcription factors and growth regulators. Five MAPK pathways have been identified and characterized in Saccharomyces cerevisiae: the Fus3 MAPK pathway is involved in the pheromone response; the KSS1 pathway mediates filamentation in response to environment; the HOG1 pathway regulates cell growth under high osmotic environment; SLT2 regulates cell integrity; and SMK1 is involved in sporulation (Gustin et al., 1998).

Several MAPKs in filamentous fungi also have roles in development. MAPK MAK-2 in Neurospora crassa is important in hyphal fusion and conidial germination. Deletion mutants of MAK-2 show shortened aerial hyphae, slower hyphal growth, lack of vegetative hyphal fusion, female sterility and autonomous ascospore lethality (Pandey et al., 2004). Deletion of MAPK sakA/hogA in Aspergillus nidulans shows decreased conidial germination and increased sensitivity to stresses such as heat shock and oxidization (Kawasaki et al., 2002). In the smut fungus, Ustilago maydis, MAPK ubc3/kpp2 is essential for pheromone response, mating, and filamentation. Mutants of ubc3/kpp2 have lowered sensitivity to pheromone source, decreased pheromone production, a dose-dependent suppression of mating reaction, and reduced filamentation in the case of an uac1 (Ustilago adenylate cyclase) and ubc3/kpp2 double mutant (Mayorga and Gold, 1999, Muller et al., 1999). Although there have been many studies on the roles of MAPK in filamentation and mating during fungal development, the roles of MAPK in the development of the fruiting body in basidiomycetes has not hitherto been studied in detail.

RNA finger printing by arbitrarily primed PCR (RAP-PCR) has identified the partial sequence of a L. edodes MAPK (Le. MAPK) as a differentially expressed transcript during basidiomycete development (Leung et al., 2000). Here, we describe the use of a yeast two-hybrid library screen to further characterize this MAPK, report the isolation of its interacting partner, and investigate their roles in fruiting body development. This novel MAPK interacting partner is designated Le.DRMIP, for L. edodes Developmentally Regulated MAPK Interacting Protein. Transcript profiling and localization studies of Le.MAPK and Le.DRMIP have shown that these two genes may play a role in cell differentiation and development of gill structure during fruiting body development; this gives further insights into the relationship between the MAPK pathway and fruiting body development.

Section snippets

Strain and culture conditions

The dikaryotic L. edodes strain L54 was used in this study. The media and the culture conditions have been described previously (Leung et al., 2000).

Rapid amplification of cDNA ends (RACE)

3′ and 5′ RACE of Le.MAPK was done by using the GibcoBRL RACE system, operated according to the manufacture's instructions. A 3′ gene-specific primer (GSP) (5′CGGAATTCGCGTCGACATTCATGACAGAATA3′) and two 5′ GSPs (5′CGGAATTCAGCGTAGAAATCGTCAAG3′ and 5′CGGAATTCTGCGAGAACACAGCCAAGCGAC3′) were used for the amplification of the RACE product. The RACE

Isolation of Le.MAPK full-length sequence by 5′ and 3′ RACE and sequence analysis

The partial sequence of Le.MAPK has been reported in our previous study (Leung et al., 2000). In this study, we cloned and isolated the full-length Le.MAPK gene by 5′ and 3′ RACE. A 750 bp 5′ RACE product and a 1.2 kb 3′ RACE product were successfully generated from the gene-specific primers and sequenced. The full-length sequence was 1.75 kb and was submitted to NCBI with the accession number AF173376. The Le.MAPK full-length cDNA was translated into an amino acid sequence, which revealed that

Acknowledgments

The work in this paper was partially supported by grants from the Research Grants Council of the Hong Kong Special Administrative Region, China (RGC Ref. No. CUHK4147/01M). The work was carried out in compliance with the current laws governing genetic experimentation in Hong Kong.

References (26)

S. Kaneko et al.
Cloning and sequence analysis of the basidiomycete Lentinus edodes ribonucleotide reductase small subunit cDNA and expression of a corresponding gene in L. edodes
Gene
(2001)
D. Li et al.
Cloning and expression of cDNA encoding a mitogen-activated protein kinase from a phytopathogenic filamentous fungus
Gene
(1997)
K.J. Livak et al.
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method
Methods
(2001)
H.D. Madhani et al.
MAP kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation
Cell
(1997)
S. Ohga et al.
Transcriptional regulation of laccase and cellulase genes during growth and fruiting of Lentinula edodes on supplemented sawdust
FEMS Microbiol. Lett.
(2001)
J.D. Bendtsen et al.
Improved prediction of signal peptides: SignalP 3.0
J. Mol. Biol.
(2004)
A. Brachmann et al.
An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis
EMBO J.
(2003)
L. Breeden et al.
Regulation of the yeast HO gene
Cold Spring Habor Symp. Quant. Biol.
(1985)
A.M. Catanzariti et al.
Haustorially expressed secreted proteins from flax rust are highly enriched for avirulence elicitors
Plant Cell
(2006)
C. Csank
Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis
Infect. Immun.
(1998)

Y. Gotoh et al.

Schizosaccharomyces pombe Spk1 is a tyrosine-phosphorylated protein functionally related to Xenopus mitogen-activated protein kinase

Mol. Cell. Biol.

(1993)

M.C. Gustin et al.

MAP kinase pathways in the yeast Saccharomyces cerevisiae

Microbiol. Mol. Biol. Rev.

(1998)

K. Hori et al.

Cloning, sequence analysis and transcriptional expression of a ras gene of the edible basidiomycete Lentinus edodes

Gene

(1991)

Cited by (29)

Functional analysis of the MAPK pathways in fungi
2017, Revista Iberoamericana de Micologia
Citation Excerpt :
Accordingly, a recent study described the importance of MAPK, PKA and blue light signaling pathways in the early stages of the formation of fruiting bodies (mycelial knot, mycelial pigmentation, and primordium) in the edible Basidiomycota species H. marmoreus.95 Similarly, in the Shiitake fungus Lentinula edodes, the importance of the MAPK pathway, also in early stages of the fruiting bodies development, has been described.84 In the Ascomycota fungi Cordyceps militaris,97 Sordaria macrospora,85 and Phaeosphaeria nodorum38 the role of MAPK pathway in fruiting bodies formation has been suggested, particularly the HOG pathway in the latter fungus.38
The Mitogen-Activated Protein Kinase (MAPK) signaling pathways constitute one of the most important and evolutionarily conserved mechanisms for the perception of extracellular information in all the eukaryotic organisms. The MAPK pathways are involved in the transfer to the cell of the information perceived from extracellular stimuli, with the final outcome of activation of different transcription factors that regulate gene expression in response to them. In all species of fungi, the MAPK pathways have important roles in their physiology and development; e.g. cell cycle control, mating, morphogenesis, response to different stresses, resistance to UV radiation and to temperature changes, cell wall assembly and integrity, degradation of cellular organelles, virulence, cell–cell signaling, fungus–plant interaction, and response to damage-associated molecular patterns (DAMPs).
Considering the importance of the phylogenetically conserved MAPK pathways in fungi, an updated review of the knowledge on them is discussed in this article. This information reveals their importance, their distribution in fungal species evolutionarily distant and with different lifestyles, their organization and function, and the interactions occurring between different MAPK pathways, and with other signaling pathways, for the regulation of the most complex cellular processes.
Las vías de señalización de la proteína-cinasa activada por mitógenos (abreviadas como MAPK por sus siglas en inglés) son uno de los mecanismos más importantes y evolutivamente conservados para la percepción de información extracelular en organismos eucarióticos. Las vías MAPK están involucradas en la transferencia a la célula de la información recibida de estímulos extracelulares, que ofrecen como resultado final la activación de diferentes factores de transcripción que regulan la expresión de genes en respuesta a aquellos. En todas las especies de hongos, las vías MAPK tienen importantes funciones en su fisiología y desarrollo como, por ejemplo, el control del ciclo celular, el apareamiento, la morfogénesis, la respuesta a diferentes tipos de estrés, la resistencia a la luz UV y a los cambios de temperatura, la formación e integridad de la pared celular, la degradación de los orgánulos, la virulencia, la señalización célula-célula, la interacción hongo-planta y la respuesta a patrones moleculares asociados con el daño (abreviado como DAMP, por sus siglas en inglés).
Dada la importancia de las vías MAPK en hongos, en esta revisión se discute el conocimiento adquirido más recientemente sobre ellas. Esta información revela su importancia, su distribución en especies de hongos evolutivamente distantes y con estilos de vida diferentes, su organización y función, y las interacciones que ocurren entre diferentes vías MAPK, y entre estas y otras vías de señalización que regulan los procesos celulares más complejos.
Impacts of calcium signal transduction on the fermentation production of antitumor ganoderic acids by medicinal mushroom Ganoderma lucidum
2012, Biotechnology Advances
Recently signal transduction engineering of secondary metabolism is receiving great interest as a powerful tool towards efficient production of valuable secondary metabolites. This work found that the calcineurin-signal transduction was significant to triterpene biosynthesis by higher fungus (mushroom). Addition of calcium ion (at 10 mM) to static liquid cultures of Ganoderma lucidum, a famous traditional medicinal mushroom, was proved as a useful strategy to enhance the production of antitumor ganoderic acids (GAs), which resulted in 3.7-, 2.6-, 4.5-, 3.2- and 3.8-fold improvement of total GAs, individual GA-Mk, -T, -S, and -Me, respectively. Experiments using Ca^2 + sensor inhibitors indicated the involvement of calcineurin signal in regulating GAs biosynthesis. Quantitative gene transcription analysis revealed that the expression levels of genes of GAs biosynthesis and Ca^2 + sensor were up-regulated with calcium addition while down-regulated under the inhibitors addition, suggesting that higher GAs production may be resulted from higher expressions of those genes. Based on the results obtained, a possible model on the effect of external calcium ion on the GAs biosynthesis via calcineurin signal transduction pathway was proposed.
Transcriptome analysis of enriched Golovinomyces orontii haustoria by deep 454 pyrosequencing
2012, Fungal Genetics and Biology
Citation Excerpt :
Homologs of EMP1 have been identified in many plant–pathogenic fungi (Cornelissen and Haring, 2001; Soanes et al., 2008), and the DRMIP-HESP domain (PF10342) present in this protein and GoEST_c4284 is also present in a haustorially expressed gene coding for a secreted protein of flax rust (Catanzariti et al., 2006). While one member of this protein class has been implicated in cell differentiation of Lentinula edodes (Szeto et al., 2007), DRMIP-HESP domain containing proteins have also been found to be enriched in the secretomes of rust fungi (Saunders et al., 2012). Overall, this suggests an important role of these proteins during pathogenesis of haustoria forming pathogens that is conserved across fungal phyla.
Powdery mildews are phytopathogenic ascomycetes that have an obligate biotrophic lifestyle and establish intimate relationships with their plant hosts. A crucial aspect of this plant–fungus interaction is the formation of specialized fungal infection structures termed haustoria. Although located within the cell boundaries of plant epidermal cells, haustoria remain separated from the plant cytoplasm by a host plasma membrane derivative, the extrahaustorial membrane. Haustoria are thought to represent pivotal sites of nutrient uptake and effector protein delivery. We enriched haustorial complexes from Arabidopsis thaliana plants infected with the powdery mildew fungus Golovinomyces orontii and performed in-depth transcriptome analysis by 454-based pyrosequencing of haustorial cDNAs. We assembled 7077 expressed sequence tag (EST) contigs with greater than 5-fold average coverage and analyzed these with regard to the respective predicted protein functions. We found that transcripts coding for gene products with roles in protein turnover, detoxification of reactive oxygen species and fungal pathogenesis are abundant in the haustorial EST contigs, while surprisingly transcripts encoding presumptive nutrient transporters were not highly represented in the haustorial cDNA library. A substantial proportion (∼38%) of transcripts coding for predicted secreted proteins comprises effector candidates. Our data provide valuable insights into the transcriptome of the key infection structure of a model obligate biotrophic phytopathogen.
CoPK32 is a novel stress-responsive protein kinase in the mushroom Coprinopsis cinerea
2011, Biochimica et Biophysica Acta - General Subjects
Citation Excerpt :
In mushrooms, investigations of MAPK and its downstream targets are extremely scarce, and their physiological roles remain to be clarified. Although a recent study found that the expression level of MAPK increases during development in the basidiomycete Lentinula edodes [12], its physiological function is still unclear. In the present study, we found that CoPK32 is a novel stress-responsive protein kinase in C. cinerea.
In a previous study, we conducted an expression cloning screen of a cDNA library prepared from Coprinopsis cinerea mycelia using Multi-PK antibodies and detected a wide variety of Ser/Thr protein kinases. One of the isolated clones, CMZ032, was found to encode a putative Ser/Thr protein kinase designated CoPK32. In the present study, we investigated the biochemical properties and physiological significance of CoPK32.
CoPK32 was expressed in Escherichia coli, and its biochemical properties were examined. The effects of high osmotic stresses on the growth of C. cinerea and on the endogenous CoPK32 activity in mycelia were also examined.
CoPK32 showed autophosphorylation activity and effectively phosphorylated exogenous protein substrates. CoPK32S, a splice variant that was 18 amino acids shorter than CoPK32, showed much lower protein kinase activity than CoPK32. The catalytic properties of CoPK32 deletion mutants suggested that the C-terminal region of CoPK32 was important for the kinase activity and recognition of substrates. CoPK32 was highly expressed in the actively growing region of the mycelial colony. When mycelia were stimulated by high osmotic stresses, endogenous CoPK32 was markedly activated and the mycelial growth was severely inhibited. The activation of CoPK32 activity by high osmotic stresses was abrogated by SB202190 or SB239063 as well-known inhibitors of p38 mitogen-activated protein kinase.
CoPK32 is involved in the stress response pathway in mycelia of C. cinerea in response to environmental stresses.
In C. cinerea, protein kinases such as CoPK32 play important roles in signal transduction pathways involved in stress responses.
Isolation and transcript analysis of two-component histidine kinase gene Le.nik1 in Shiitake mushroom, Lentinula edodes
2008, Mycological Research
Citation Excerpt :
Total RNA from mycelium, primordium, young fruiting bodies, and mature fruiting bodies of Lentinula edodes from the sawdust culture was fractionated by 1.2 % formaldehyde gel, transferred to a nylon membrane and hybridized with purified Le.nik1 cDNA labelled using PCR DIG probe synthesis kit (Roche). The blotted membranes were hybridized with denatured probes in 50 % formamide, 5 × SSC, 2 % blocking solution, 50 mm sodium phosphate, 0.1 % N-lauroysarcosine and 7 % (w/v) sodium dodecyl sulphate (SDS) at 42 °C (Szeto et al. 2007). Reverse transcription, RT-PCR, and data analysis were performed as described earlier (Szeto et al. 2007).
Le.nik1, a two-component histidine kinase gene of Lentinula edodes, the Shiitake mushroom, was identified. The relationship between this two-component signal transduction system and mushroom development was studied. We used a modified RNA arbitrarily-primed PCR (RAP-PCR) method to isolate Le.nik1 as a differentially expressed gene during L. edodes development. We determined the 6.29 kb full-length cDNA sequence of Le.nik1. It had high sequence homology to Neurospora crassa nik1, which encoded a histidine kinase essential for development and osmotic response. In L. edodes, the expression level of Le.nik1 was highest during primordium formation and fruiting body maturation. The transcripts were localized predominantly in the developing hymenophores, or mushroom gills, which may indicate the role of a two-component signal transduction system in cell differentiation during mushroom development. Mannitol stress influenced transcript expression of Le.nik1, suggesting that it may be involved in osmo-sensing and regulation. To our knowledge, this is the first report on the two-component system in mushrooms and the first analysis on the distribution of Le.nik1 transcript in the course of fruiting body formation and in parts of fruiting bodies.
Snowball: a novel gene family required for developmental patterning of fruiting bodies of mushroom-forming fungi (Agaricomycetes)
2024, mSystems

View all citing articles on Scopus

¹: Present address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111, United States.

View full text

Le.MAPK and its interacting partner, Le.DRMIP, in fruiting body development in Lentinula edodes

Abstract

Introduction

Section snippets

Strain and culture conditions

Rapid amplification of cDNA ends (RACE)

Isolation of Le.MAPK full-length sequence by 5′ and 3′ RACE and sequence analysis

Acknowledgments

Gene

Gene

Methods

Cell

FEMS Microbiol. Lett.

Improved prediction of signal peptides: SignalP 3.0

J. Mol. Biol.

An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis

EMBO J.

Regulation of the yeast HO gene

Cold Spring Habor Symp. Quant. Biol.

Haustorially expressed secreted proteins from flax rust are highly enriched for avirulence elicitors

Plant Cell

Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis

Infect. Immun.

Schizosaccharomyces pombe Spk1 is a tyrosine-phosphorylated protein functionally related to Xenopus mitogen-activated protein kinase

Mol. Cell. Biol.

MAP kinase pathways in the yeast Saccharomyces cerevisiae

Microbiol. Mol. Biol. Rev.

Cloning, sequence analysis and transcriptional expression of a ras gene of the edible basidiomycete Lentinus edodes

Gene